Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroplex picus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTAACCGATGATTATTCTCTACCAACCATAAAGACATTGGAACCCTTTACTTAATCTTCGGAGCATGAGCCGGCATAATTGGAACTGCCCTAAGCCTTTTAATCCGAGCCGAACTCGGGCAACCAGGCACTCTCCTAGGTGACGACCAAATTTATAATGTTATCGTCACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGGTTTGGCAACTGGCTAGTACCACTAATAATTGGAGCCCCTGACATAGCATTCCCTCGAATAAACAATATAAGCTTCTGACTTCTTCCACCATCCTTCCTTCTACTCCTAGCCTCCTCTACAGTAGAAGCAGGTGCAGGAACAGGATGAACAGTATATCCACCCTTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACTTAGCTATCTTCTCCCTTCACCTAGCCGGTGTATCCTCCATCCTAGGGGCTATCAACTTTATTACAACTGCGATCAACATAAAACCACCAGCCCTCTCACAATATCAAACCCCCTTATTTGTTTGATCCGTCCTCATCACTGCTGTCCTTCTTCTTCTCTCCTTACCCGTCCTAGCTGCCGGCATCACAATGCTCTTAACAGACCGCAACCTAAATACCACATTCTTCGACCCAGCTGGAGGTGGAGATCCCATCCTATACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendroplex picus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Straight-billed Woodcreeper

The Straight-billed Woodcreeper (Dendroplex picus) is a species of bird in the woodcreeper subfamily (Dendrocolaptinae). Its genus, Dendroplex, was recently confirmed to be distinct from Xiphorhynchus. It is found in Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Panama, Peru, Suriname, Trinidad and Tobago, and Venezuela. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical moist lowland forests, subtropical or tropical mangrove forests, and heavily degraded former forest.

The Straight-billed Woodcreeper's range is in central and north South America, east of the Andes cordillera, and encompasses the entire Amazon Basin and the Caatinga. The species is found in Panama of Central America, and only the four countries, Chile, Argentina, Paraguay and Uruguay, of southernmost South America are excluded from the South American range.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!