Overview

Distribution

Geographic Range

Brown thrashers are found from southeastern Canada through eastern, central, and southeastern United States. Brown thrashers are the only thrasher species east of the Rocky Mountains and central Texas. During the breeding season brown thrashers primarily inhabit areas of southern Canada south to east central Texas. Migration is over short distances and at night. In winter, these birds migrate from the northern parts of their range into the southern parts of their range.

Biogeographic Regions: nearctic (Native )

  • Howard, R., A. Moore. 1991. A Complete Checklist of the Birds of the World. San Diego, CA: Academic Press Inc..
  • Robbins, C., B. Bruun, H. Zim. 1983. A guide to filed identification birds of North America. New York, New York: Western Publishing Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDING: southeastern Alberta across south Canada to New Brunswick, south to eastern Texas, Gulf Coast, and southern Florida, west to eastern Colorado. NON-BREEDING: eastern New Mexico, eastern Oklahoma, western Tennesse, and southern Maryland south to southeastern Texas, Gulf Coast, and southern Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults have rufous upperparts and white underparts with a long, black tail. They have long, straight bills and yellow eyes. Males and females are alike in size and coloration. They are from 23.5 cm to 30.5 cm long, with wingspans of 9.4 to 11.1 cm long. The young appear the same except their upperparts are spotted and their eyes are gray. There are two sub-species, brown thrashers (T. rufum rufum) and long-billed thrashers (T.rufum longirostre). Long-billed thrashers are unique in their dull upperparts, gray head, orange eye, and long, straight bill.

Range mass: 89 (high) g.

Average mass: 68.8 g.

Range length: 235 to 305 mm.

Range wingspan: 94 to 111 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Dunning, J. 1993. CRC handbook of avian body masses. Boca Raton, FL: CRC Press.
  • Godfrey, W. 1986. The Birds of Canada. The Birds of Canada, Rev. ed. Edition. Ottawa, ON: National Museum of Natural Science.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 29 cm

Weight: 69 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Brown thrashers are found in warm, dry habitats, such as warm forest edges and dense thickets. They are also found in suburban and agricultural areas.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

  • Peterson, A. 1999. Sensitivity of distributional prediction algorithms to geographic data completeness. Ecological Modeling, 117: 159-164.
  • Peterson, A. 2001. Predicting species’ geographic distributions based on ecological niche modeling. The Condor, 103 3: 599-605. Accessed October 15, 2006 at http://0-www.bioone.org.ariadne.kzoo.edu/perlserv/?request=get-document&doi=10.1650%2F0010-5422%282001%29103%5B0599%3APSGDBO%5D2.0.CO%3B2#I0010-5422-103-3-599-PETERSON2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Thickets and bushy areas in deciduous forest clearings and forest edge, shrubby areas and gardens; in migration and winter also in scrub (AOU 1983). BREEDING: Nests on ground under small bush or as high as about 4 m in tree, shrub, vine.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations north of southeastern U.S. move south for winter. Arrives in New England in late April (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brown thrashers eat insects, primarily beetles and other arthropods, fruits, and nuts. They forage for food on the ground in leaf litter below trees and shrubs. These birds sweep the soil and leaf litter with rapid side-to-side movements that scatter leaves. After sweeping a few times, they will probe the soil and litter with their beaks.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects and other invertebrates and small fruits, also some small amphibians and reptiles; forages on or near ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Ecosystem roles include competition with other birds for nesting sites and resources. Also these birds are prey for many snakes and other birds.

Commensal/Parasitic Species:

  • Equinox (Oxford) Ltd. 1985. Mockingbirds. Pp. 360-361 in C Perrins, A Middleton, eds. The Encyclopedia of Birds. New York: Facts On File Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Gray catbirds (Dumetella carolinensis) have been documented visiting brown thrasher nests to break the eggs. Two hypotheses are proposed to explain this heterospecific egg destruction behavior: resource competition and egg predation. These birds both live in shrubs and have similar timing in breeding. They compete for the resources of this habitat. Once the catbird has broken the egg, usually it will consume the contents. This egg consumption is consistent with the proposed egg predation hypothesis. The eggs of brown thrashers are also preyed on by many species of snakes. Adults and nestlings are preyed on by falcons.

To respond to predation, brown thrashers have a few natural defenses. Adults are aggressive and often chase predators from the nest. Adults will use their bill to hit predators, these are large birds and they can cause significant damage to small and medium-sized predators. Other defenses include flapping theirwings and vocalizations.

Known Predators:

  • Rivers, J., B. Sandercock. 2004. Predation by gray catbird on brown thrasher eggs. The Southwestern Naturalist, 49/1: 101-103.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Toxostoma rufum (red-eyed vireo, yellow warbler, gold finch, catbird, brown thrasher, towhee, robin) is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Toxostoma rufum (red-eyed vireo, yellow warbler, gold finch, catbird, brown thrasher, towhee, robin) preys on:
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nest predation accounted for 54% of nest failures in Kansas (Murphy and Fleischer 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Brown thrashers communicate mainly with vocalizations. They use mimicry extensively as well and are well known for their songs. Males have the largest documented song repertoire of all North American bird. This includes over 1100 types of songs. At young ages, birds most commonly use "alarm noises". Primary modes of perception include visual and tactile. Brown thrashers use mainly vision to find food and their tactile abilities to search for and manipulate food.

Communication Channels: acoustic

Other Communication Modes: mimicry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Year-to-year survival is age dependent for brown thrashers. Survival rate is approximately 35% for their first and second years, 50% between second and third years, and 75% between third and fourth years. Limitations to lifespan include disease (for example Salmonella tymphimurium), parasitism, and sometimes exposure to cold temperatures. The longest known lifespan in the wild is twelve years and in captivity, ten to twelve years.

Range lifespan

Status: wild:
12 (high) years.

Range lifespan

Status: captivity:
10 to 12 years.

Typical lifespan

Status: wild:
11.34 to 17.61 years.

Average lifespan

Status: wild:
14.14 years.

Average lifespan

Status: captivity:
12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

When males arrive at the breeding grounds they establish a territory. In the southern parts of their range breeding starts in February and March, in the northern parts, breeding starts in May and June. Soon after this, pairs are formed and they begin to build a nest. Mates find each other with calls, most commonly using a call similar to a "tick" or "tchuck". Once the bond is formed and the nest is built, the pair will mate.

Mating System: monogamous

Brown thrasher breeding seasons vary with geographic region. Birds in the southern region breed from February to March; while those in the northern region breed from May to June. Brown thrashers lay three to five eggs each breeding season. Incubation takes about two weeks, once the eggs have hatched, nestlings take from 9 to 13 days to fledge. Independence is reached 17 to 19 days later.

Breeding interval: Brown thrashers breed once yearly.

Breeding season: Breeding season varies geographically. Southern populations breed in February and March, northern populations birds breed in May and June

Range eggs per season: 3 to 5.

Range time to hatching: 11 to 14 days.

Range fledging age: 9 to 13 days.

Range time to independence: 17 to 19 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both parents incubate, brood, and feed nestlings. They incubate by sitting tightly on the nest and slip off when disturbed. During the incubation period, the female does the majority of the incubating. Both parents feed the chicks.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Fergus, C. 2004. "Gray Catbird, Northern Mockingbird and Brown Thrasher" (On-line). Pennsylvania Game Commision. Accessed November 12, 2006 at http://www.pgc.state.pa.us/pgc/cwp/view.asp?a=458&q=150398.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size 3-6 (usually 4). Sometimes 2 broods per year. Incubation 11-14 days, by both sexes. Young tended by both parents, leave nest in 9-13 days. May find new mate for second nesting. See Murphy and Fleischer (1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Toxostoma rufum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBIR712-08|EF484233|Toxostoma rufum| AACCGATGATTATTTTCAACCAACCACAAAGATATCGGCACCCTCTACCTAATCTTCGGCGCATGAGCCGGAATAGTCGGTACCGCCCTA---AGCCTCCTTATTCGAGCAGAACTAGGCCAACCTGGAGCCCTCCTAGGTGAC---GACCAAGTCTACAACGTAGTCGTCACAGCACATGCCTTCGTAATAATCTTCTTTATGGTTATGCCAATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATA---ATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATGAGCTTCTGACTACTCCCACCATCCTTCCTACTACTACTAGCATCTTCCACAGTAGAGTCAGGAGTAGGAACAGGCTGAACTGTATACCCACCCCTAGCTGGTAACCTAGCCCACGCCGGAGCTTCAGTAGACCTA---GCTATCTTCTCCCTACACCTAGCTGGTATCTCTTCCATCCTAGGAGCTATCAACTTCATTACAACAGCAATCAACATAAAACCACCCGCCCTCTCACAATACCAAACCCCACTATTTGTTTGATCAGTACTAATCACCGCGGTATTACTCCTCCTATCCCTTCCTGTACTCGCCGCA---GGCATTACCATGCTCCTTACAGACCGCAATCTCAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTATATCAACACCTTTTCTGATTCTTCGGCCATCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATAATCTCCCACGTAGTAGCCTACTACTCAGGAAAAAAA---GAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATTGGTTTCCTAGGCTTCATCGTCTGAGCCCATCACATGTTCACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Toxostoma rufum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 12
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Brown thrashers are not listed as threatened or endangered in any part of their range. No management actions are known to increase or maintain populations. Dangers include pesticides, collisions with structures, and some degradation of habitats. These effects have yet to become harmful enough to cause concern.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Brown thrashers can be significant pests in fruit orchards and crop fields.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Brown thrashers are one of the best and most spectacular singers of all North American birds. Avid bird watchers enjoy the chance to see and hear these birds.

Positive Impacts: ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown Thrasher

The Brown Thrasher (Toxostoma rufum) is a bird in the Mimidae family, a family which also includes the New World Catbirds and Mockingbirds.

Brown Thrasher, High Island, Texas

Contents

Description

Ash, North Carolina

The Brown Thrasher is bright reddish-brown above with thin, dark streaks on its buffy underparts. Its long, rufous tail is rounded with paler corners, and eyes are a brilliant gold. Adults average about 11.5 in (29 cm) long with a wingspan of 13 in (33 cm), and have an average mass of 2.4 oz (68 g).[3]

Although not in the thrush family, this bird is sometimes erroneously called the Brown Thrush.[4]

Habitat and range

It is found in thickets and dense brush, often searching for food in dry leaves on the ground. It also enjoys the convergence of mowed to unmowed lawns, particularly if there are ample shrubs or shrubby trees, i.e., fruit orchards that the undergrowth is left undisturbed. It also enjoys perennial gardens and can be seen jumping from the ground to catch insects on flowers and foliage. Its breeding range includes the United States and Canada east of the Rocky Mountains. It is a partial migrant, with northern birds wintering in the southern USA, where it occurs throughout the year. There is a single British record of this unlikely transatlantic vagrant.

Behavior

Feeding

This bird is omnivorous, eating insects, berries, nuts and seeds, as well as earthworms, snails, and sometimes lizards.

Breeding

The female lays 3 to 5 eggs in a twiggy nest lined with grass. The nest is built in a dense shrub or low in a tree. Both parents incubate and feed the young. These birds raise two or three broods in a year. They are able to call in up to 3000 distinct songs. The male sings a series of short repeated melodious phrases from an open perch to defend his territory and is also very aggressive in defending the nest.

Vocal Development

Brown Thrashers are known to have as many as over 3000 unique songs in their vocal repertoire. [5] [6] [7]

Conservation and threats

Although this bird is widespread and still common, it has declined in numbers in some areas due to loss of suitable habitat.

In culture

The Brown Thrasher is the official state bird of Georgia, and was the inspiration for the name of Atlanta's former National Hockey League team, the Atlanta Thrashers.

Gallery

References

  1. ^ BirdLife International (2004). Toxostoma rufum. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006. Database entry includes justification for why this species is of least concern
  2. ^ Barrows, W.B. 1912. Michigan bird life. Michigan Agricultural College. Lansing, Michigan. xi + 846 pp. (Brown Thrasher, p. 661)
  3. ^ Sibley, David Allen (2000). National Audubon Society: The Sibley Guide to Birds. New York: Alfred A. Knopf. pp. 544. ISBN 0-679-45122-6.  (Brown Thrasher, p. 412.)
  4. ^ "Columbia Encyclopedia (sixth edition, 2008): Mimic Thrush". http://www.encyclopedia.com/doc/1E1-mimicthr.html. 
  5. ^ http://www.birds.cornell.edu/AllAboutBirds/studying/birdsongs/vocaldev
  6. ^ http://www.tropicalbirds.com/thrasher.php
  7. ^ http://www.outdooralabama.com/watchable-wildlife/what/Birds/tmt/bt.cfm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Brown Thrasher

The Brown Thrasher (Toxostoma rufum), sometimes erroneously called the Brown Thrush,[2] is a bird in the Mimidae family, a group that also includes the New World catbirds and mockingbirds.

Brown Thrasher High Island, Texas

Contents

Description

The Brown Thrasher is bright reddish-brown above with thin, dark streaks on its buffy underparts. Its long rufous tail is rounded with paler corners. Eyes are a brilliant gold. Adults average about 11.5 in (29 cm) long with a wingspan of 13 in (33 cm), and have an average mass of 2.4 oz (68 g).[3]

Habitat and range

It is found in thickets and dense brush, often searching for food in dry leaves on the ground. It also enjoys the convergence of mowed to unmowed lawns, particularly if there are ample shrubs or shrubby trees, i.e., fruit orchards that the undergrowth is left undisturbed. It also enjoys perennial gardens and can be seen jumping from the ground to catch insects on flowers and foliage. Its breeding range includes the United States and Canada east of the Rocky Mountains. It is a partial migrant, with northern birds wintering in the southern USA, where it occurs throughout the year. There is a single British record of this unlikely transatlantic vagrant.

Behavior

Feeding

This bird is omnivorous, eating insects, berries, nuts and seeds, as well as earthworms, snails, and sometimes lizards.

Breeding

The female lays 3 to 5 eggs in a twiggy nest lined with grass. The nest is built in a dense shrub or low in a tree. Both parents incubate and feed the young. These birds raise two or three broods in a year. They are able to call in up to 3000 distinct songs. The male sings a series of short repeated melodious phrases from an open perch to defend his territory and is also very aggressive in defending the nest.

Vocal Development

Brown Thrashers are known to have as many as over 3000 unique songs in their vocal repertoire. [4] [5] [6]

Conservation and threats

Although this bird is widespread and still common, it has declined in numbers in some areas due to loss of suitable habitat.

In Culture

The Brown Thrasher is the official state bird of Georgia, and was the inspiration for the name of Atlanta's former National Hockey League team, the Atlanta Thrashers.

Media

References

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Suggested to constitute a superspecies with T. LONGIROSTRE and T. GUTTATUM (Mayr and Short 1970). However, although T. RUFUM and T. LONGIROSTRE are likely sister species, they differ by 5% sequence divergence in their mitochondrial DNA (more than other closely related Toxostoma species), and T. GUTTATUM was distinct from both T. RUFUM and T. LONGIROSTRE in the phylogenetic analyses of Zink et al. (1999). Placed in Sturnidae in Sibley and Ahlquist (1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!