Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Dutch (1) (learn more)

Overview

Brief Summary

This small perky little bird is one of the most common birds in the Netherlands. It may be small but it is extremely boisterous. In fact, you hear wrens more often than you see them. They are forest birds, but will make their nests anywhere where you find trees. Hundreds nest in gardens, parks, woods and even in the dunes nowadays. They eat small animals, such as spiders and insects. But when scarse, they easily switch to seeds and berries.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Winter wrens have a range of approximately 5,430,000 square kilometers with about 36,000,000 individuals. They are found in the temperate northern hemisphere, including Europe, much of Asia, and North America. There are some gaps in this range, including a large part of Turkmenistan. Winter wrens are most common in eastern and western North America and Eurasia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); mediterranean sea (Native )

Other Geographic Terms: holarctic

  • Drovetski, S., R. Zink, S. Rohwar, I. Fadeev, E. Nesterov, I. Karagodin, A. Koblik, Y. Red'kin. 2004. Complex biogeographic history of a Holarctic passerine. Proceedings of the Royal Society London, 271: 545-551.
  • BirdLife International, 2008. "2008 IUCN Red List of Threatened Species" (On-line). Troglodytes troglodytes. Accessed January 08, 2009 at http://www.iucnredlist.org/details/147806.
  • Robinson, R. 2005. "BirdFacts: profiles of birds occurring in Britain & Ireland" (On-line). Wren Troglodytes troglodytes. Accessed January 08, 2009 at http://blx1.bto.org/birdfacts/results/bob10660.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Winter wrens are tiny brown birds with dark barring on their wings, tails, and ventral surfaces. They have a light stripe just above their eyes and their throats are lighter than the rest of their bodies. Juveniles are darker than adults and the sexes look the same. They have a narrow bill and a short tail which usually points upward.

Winter wrens have round, short wings with strong distal feathers. These features are adaptations to living in dense vegetation. Round, short wings require less effort and room to suddenly take off or stop and they are easier to maneuver within obstacles. Having heavier, stronger feathers at the ends of their wings protects them from breakage when they inevitably smack something in their crowded environment.

Winter wrens sexes can be distinguished during the breeding season by the presence of either a brood patch (female) or a cloacal protuberance (male). Age can be determined by the number of spots on their fourth primaries.

A species' average basal metabolic rate is influenced by several factors, including size and plumage color. Birds which eat mainly invertebrate prey generally have intermediate basal metabolic rates, compared to similar birds eating different diets. Temperate species average higher BMRs than tropical species and flighted birds are higher than flightless ones. Winter wrens average 0.60 kJ/h basal metabolic rate.

Range mass: 8 to 12 g.

Range length: 8 to 12 cm.

Range wingspan: 12 to 16 cm.

Average basal metabolic rate: 0.60 kJ/h cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • McNab, B. 2009. Ecological factors affect the level and scaling of avian BMR. Comparative Biochemistry and Physiology, Part A, 152: 22-45.
  • Dawson, A. 2006. The scaling of primary flight feather length and mass in relation to wing shape, function and habitat. IBIS, 147: 283-292.
  • 2003. "Cornell Lab of Ornithology: All About Birds" (On-line). Winter Wren. Accessed January 08, 2009 at http://www.birds.cornell.edu/AllAboutBirds/BirdGuide/Winter_Wren_dtl.html.
  • Peach, W., C. du Feu, J. McMeeking. 1995. Site tenacity and survival rates of Wrens Troglodytes troglodytes and Treecreepers Certhia familiaris in a Nottinghamshire wood. IBIS, 137: 497-507.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Winter wrens are found in a wide range of habitats. They prefer deciduous forests, but they are also common in pastures, farms, scrub forests, coniferous forests, towns, and villages. They also occur on heath, grasslands, marshes, and in croplands. Winter wrens prefer thick vegetation close to the ground.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest ; mountains

Wetlands: marsh

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Mathevon, N., T. Aubin. 1997. Reaction to conspecific degraded song by the wren Troglodytes troglodytes: Territorial response and choice of song post. Behavioral Processes, 39: 77-84.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.710 - 7.710
  Nitrate (umol/L): 1.075 - 1.075
  Salinity (PPS): 8.907 - 8.907
  Oxygen (ml/l): 8.179 - 8.179
  Phosphate (umol/l): 0.270 - 0.270
  Silicate (umol/l): 11.140 - 11.140
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Winter wrens are insectivores that eat a wide variety of invertebrate prey. They hunt for food on the ground. In addition to insects and their larvae, they also regularly consume millipedes and spiders. If they are in riparian areas they may prey on aquatic invertebrates. Their small size allows them to forage in places where other insectivorous birds cannot successfully forage.

Animal Foods: insects; terrestrial non-insect arthropods; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Winter wrens are important members of the ecosystem because they eat insects and are food for larger predators. In addition to these roles, they are parasitized by both invertebrates and vertebrates. They suffer from feather mites of the family Proctophyllodidae, which includes the genera Proctophyllodes and Monojoubertia. They are subject to nest parasitism by common cuckoos, Cuculus canorus.

Commensal/Parasitic Species:

  • Harper, D. 1999. Feather mites, pectoral muscle condition, wing length and plumage coloration of passerines. Animal Behavior, 58: 553-562.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Domestic cats, which are ubiquitous anywhere humans exist, are major predators of native animals, including winter wrens. Northern harriers (Circus cyaneus) eat adult wrens. Nests are preyed on by many animals, including crows and jays and weasels. Interestingly, crows and jays destroy empty nests in addition to ones containing eggs or nestlings.

Winter wrens have a few adaptations to counteract possible attacks by predators or nest parasites. Cryptic coloration makes them and their nests hard to find, and their habit of building several nests makes the real nest harder to locate. They also avoid nesting near established nests. Despite these countermeasures, cuckoos in Germany heavily parasitize them.

Known Predators:

Anti-predator Adaptations: cryptic

  • Maclean, M., D. Carslake, M. Evans, S. Townley, D. Hodgson. 2008. The usefulness of sensitivity analysis for predicting the effects of cat predation in the population dynamics of their avian prey. IBIS, 150 (Suppl. 1): 100-113.
  • Clarke, R., M. Combridge, P. Combridge. 1997. A comparison of the feeding ecology of wintering Hen Harriers Circus cyaneus centred on two heathland areas in England. IBIS, 139: 4-18.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Male winter wrens use song to establish and maintain their territories. Their songs are variable and fast, using between 15 and 40 notes per second, and the entire song lasts 5 to 10 seconds. They are impressively loud. Winter wrens use ten times as much power to deliver their songs as roosters would if they weighed the same amount. They also use other calls, which are only one or two notes.

Male winter wrens listen to the songs of other wrens in order to know who and where they are. Their songs are high-pitched, averaging around 5500 hertz, so they are subject to a lot of deterioration as they travel farther from the singing wren. To avoid some of this degradation, wrens choose high places from which to sing so their messages will travel farther with less degradation of the signal. These perches are generally 1 to 4 meters high. Winter wrens also use singing perches to listen for the songs of other males. Winter wrens seem to be able to understand and respond to even highly degraded signals from other male winter wrens. They can determine how degraded the song is, indicating to the listener how far away the singer is. Winter wrens react more aggressively when they know the singer is close rather than if they know he is far away.

Singing is most important just before and after dawn. This is the time when intruding males will attempt to steal territory so a defending male must be ready to meet his challenger with a song. Dominance is determined by who sings the best songs. Females listen to these contests and, if they like the intruder’s song, they may sneak off afterward and seek extra-pair copulations. Males who have defended their territory recently sing more than males who have not. However, they sing less in cold weather, especially after cold nights.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Holland, J., T. Dabelsteen, C. Bjorn, S. Pedersen. 2001. The location of ranging cues in wren song: evidence from calibrated interactive playback experiments. Behavior, 138: 189-206.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Winter wrens typically live only two years, but birds which survive longer than two years can still be reproductively active. Breeding males have been found up to 4 years old. The longest recorded lifespan in the wild was 6 years and 8 months.

Average lifespan

Status: wild:
6.75 years.

Average lifespan

Status: wild:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding season is mid-March to mid-August. Males either return each year to their previous breeding territory or remain on site year-round. Males in poor territories generally only keep one mate, but males in better areas can be polygamous. Males establish territories by singing and displaying and they defend these territories very aggressively against intruding males. Familiarity with their sites allows them to know the best places for resources and food. They build several nests on their territories, which can be used for shelter or by a mate forming a nest. Males build up to twelve nests, but average six.

Females are as not faithful to the same locations year after year. Unlike males, which defend territories, females rely on broader home ranges which they do not defend. They search in their range for a suitable male. Even when a female joins a male, only the male will defend the territory.

Males initially attract females with songs. When a female arrives, the male will give her a tour of all the cock nests in his territory. While giving her the tour, he displays in and around his nests. Females typically examine several nests before choosing and prefer males whose territories contain more nests. When a female chooses one, she will settle in and provide the nest with feathers and hair to make it suitable for brooding. If her nest is destroyed by a predator, she will usually abandon her mate and his territory and find a new mate. Polygamous males continue to try to attract females while his established mate or mates try to raise their broods. Males can have up to 9 mates.

Older males often begin building nests earlier than younger ones, allowing them to build more nests. Females do not seem to mate selectively with older males, however, because too many factors determine how many nests a male has on his territory. Some males have more nest building ability than others and this ability can outweigh age benefits when it comes to accruing nests.

Mating System: monogamous ; polygynous

Males build nests (called cock nests) of anything they find, including moss, feathers, twigs and grass. They often build it in a hole which may have been dug by the wren or found. They may also build on branches. Nests are domed and have an entrance hole. Males begin building cock nests up to a month before females begin laying eggs. Individual males vary widely in when they begin building, with the earliest building two months before the latest. After settling in to a nest site, females produce about 5 to 7 eggs, which are white with reddish brown spots. Eggs are 1.3 grams in weight of which 6% is shell.

Breeding interval: Winter wrens breed once yearly.

Breeding season: Breeding season is from mid-March to mid-August.

Range eggs per season: 1 to 9.

Average eggs per season: 5-7.

Range time to hatching: 16 to 18 days.

Range fledging age: 15 to 18 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Females incubate the eggs and the young hatch at an altricial stage with some downy feathers. Raising the brood is generally the female’s responsibility, but some males help. Monogamous males spend more time on domestic activities, while polygamous males continue to spend time on singing and courting females. Some males don't care the their young at all, some males provide an equal amount of care as females. Males are capable of raising broods on their own.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Evans, M. 1997. Nest building signals male condition rather than age in wrens. Animal Behavior, 53: 749-755.
  • Evans, M., A. Goldsmith. 2000. Male wrens with large testes breed early. Animal Behavior, 60: 101-105.
  • Evans, M., J. Burn. 1996. An experimental analysis of mate choice in the wren: a monomorphic, polygynous passerine. Behavioral Ecology, 7 (1): 101-108.
  • Amrhein, V., N. Erne. 2006. Dawn singing reflects past territorial challenges in the winter wren. Animal Behavior, 71: 1075-1080.
  • 2003. "Cornell Lab of Ornithology: All About Birds" (On-line). Winter Wren. Accessed January 08, 2009 at http://www.birds.cornell.edu/AllAboutBirds/BirdGuide/Winter_Wren_dtl.html.
  • Armstrong, E. 1956. Territory in the wren Troglodytes troglodytes . IBIS, 98: 430-437.
  • Peach, W., C. du Feu, J. McMeeking. 1995. Site tenacity and survival rates of Wrens Troglodytes troglodytes and Treecreepers Certhia familiaris in a Nottinghamshire wood. IBIS, 137: 497-507.
  • Robinson, R. 2005. "BirdFacts: profiles of birds occurring in Britain & Ireland" (On-line). Wren Troglodytes troglodytes. Accessed January 08, 2009 at http://blx1.bto.org/birdfacts/results/bob10660.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Troglodytes troglodytes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTACTCATCCGAGCAGAGCTGGGCCAGCCAGGTGCACTACTTGGGGACGACCAAGTCTACAATGTAATTGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATGATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCCGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCCTTCCTACTCCTACTAGCCTCCTCTACCATTGAAGCCGGAGTGGGTACAGGTTGAACGGTATATCCACCCCTAGCAGGCAACCTAGCTCACGCTGGAGCATCAGTCGATCTAGCCATCTTCTCCCTCCACCTAGCAGGCATCTCCTCAATCCTAGGCGCAATCAACTTCATTACAACAGCAATCAACATAAAACCCCCCGCCCTATCCCAATATCAAACACCCCTATTCGTCTGATCTGTCCTAATCACCGCAGTCCTCTTACTACTCTCCCTCCCCGTCCTCGCCGCAGGCATTACCATGCTCCTAACAGACCGAAACCTCAACACTACATTCTTCGACCCTGCAGGAGGAGGAGACCCCGTCCTCTACCAACACCTATTCTGATTCTTCGGGCACCCAGAAGTCTACATCCTAATTCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Troglodytes troglodytes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

With 36,000,000 individuals and no serious trends of declining populations, winter wrens are not considered a species of concern. Populations of winter wrens in Britain are increasing.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Hewson, C., A. Amar, J. Lindsell, R. Thewlis, S. Butler, K. Smith, R. Fuller. 2007. Recent changes in bird populations in British broadleaved woodland. IBIS, 149 (Suppl. 2): 14-28.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rich et al. (2004) estimated the global population to number 40,000,000 individuals. In Europe, the breeding population is estimated to number 23,000,000-40,000,000 breeding pairs, equating to 69,000,000-120,000,000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 288,000,000-2,400,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.10,000-100,000 breeding pairs in China; c.100-100,000 breeding pairs in Taiwan; possibly c.10,000-100,000 breeding pairs in Korea; c.100-100,000 breeding pairs in Japan and possibly c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of winter wrens on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because winter wrens are small, insectivorous birds, they are affected by cold weather more than many other bird species. Their population levels drop when temperatures are consistently too low. As a result they are used as indicators of changing climate. They may help to control pest populations in areas of human habitation.

Positive Impacts: research and education; controls pest population

  • Robinson, R., S. Baillie, H. Crick. 2007. Weather-dependent survival: implications of climate change for passerine population processes. IBIS, 149: 357-364.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian wren

Eurasian wren signing (2012). Texel, Netherlands

The Eurasian wren (Troglodytes troglodytes), is a very small bird, and the only member of the wren family Troglodytidae found in Eurasia and Africa (Maghreb). In Anglophone Europe, it is commonly known simply as the wren. It was once lumped with Troglodytes hiemalis of eastern North America and Troglodytes pacificus of western North America as the winter wren. The Eurasian wren occurs in Europe, a belt of Asia from northern Iran and Afghanistan across to Japan. It is migratory in the only northern parts of its range.[2] It is also highly polygynous, an unusual mating system for passerines.

The scientific name is taken from the Greek word "troglodytes" (from "trogle" a hole, and "dyein" to creep), meaning "cave-dweller", and refers to its habit of disappearing into cavities or crevices whilst hunting arthropods or to roost. The taxonomy of the genus Troglodytes is currently unresolved, as recent molecular studies have suggested that Cistothorus spp. and Thryorchilus spp. are within the clade currently defined by Troglodytes.[3][4]

Taxonomy[edit]

Recent reviews of the Troglodytes genus have shown that winter wrens are the most distantly related of all species-group within Troglodytes, and have shown that two other groups, the timberline wren (Thryorchilus browni) and the four species within the genus Cistothorus, are within the clade defined by all of the Troglodytes. To make Troglodytes monophyletic, Rice et al. (1999)[3] proposed that winter wrens could be placed in their own genus, Nannus. Alternatively, as suggested by Gómez et al. (2005),[4] Troglodytes could be made more inclusive by including the current Thryorchilus and Cistothorus genera. By studying the songs and genetics of individuals in an overlap zone between Troglodytes hiemalis and Troglodytes pacificus, Toews and Irwin (2008)[5] found strong evidence of reproductive isolation between the two. It was suggested that the pacificus subspecies be promoted to the species level designation of Troglodytes pacificus with the common name of 'Pacific wren'. By applying a molecular clock to the amount of mitochondrial DNA sequence divergence between the two,[6] it was estimated that Troglodytes pacificus and Troglodytes troglodytes last shared a common ancestor approximately 4.3 million years ago, long before the glacial cycles of the Pleistocene, thought to have promoted speciation in many avian lineages inhabiting the boreal forest of North America.[7]

Description[edit]

Eurasian wrens have great variation in their plumage between distinct populations.

The 9- to 10.5-cm-long and 6-10 g wren is rufous brown above, greyer beneath, barred with darker brown and grey, even on wings and tail. The bill is dark brown, the legs pale brown. Young birds are less distinctly barred.

The plumage is subject to considerable variation, and where populations have been isolated, the variation has become fixed in one minor form or another. There are around 27 subspecies of this taxonomically complex bird. The disputed subspecies orii, the Daito winter wren, became extinct around 1940 – if it is indeed a valid taxon and not merely based on an anomaly.

Thus in Scotland, in addition to the typical bird T. t. indigenus, there are three distinct insular subspecies: one, T. t. hirtensis, is confined to the island of St Kilda; another, T. t. zetlandicus, to Shetland; and the third, T. t. fridariensis, to Fair Isle. The St Kilda wren is greyer above, whiter beneath, with more abundant bars on the back; the Shetland wren and Fair Isle wren are darker.

Behaviour and ecology[edit]

This small, stump-tailed wren is almost as familiar in Europe as the robin. It is mouse-like, easily lost sight of when it is hunting for food, but is found everywhere from the tops of the highest moors to the sea coast.

In most of northern Europe and Asia, it nests mostly in coniferous forests, where it is often identified by its long and exuberant song. Although it is an insectivore, it can remain in moderately cold and even snowy climates by foraging for insects on substrates such as bark and fallen logs.

Its movements as it creeps or climbs are incessant rather than rapid; its short flights swift and direct but not sustained, its tiny round wings whirring as it flies from bush to bush.

It is a bird of the uplands even in winter, vanishing into the heather when snow lies thick above, a troglodyte indeed. It frequents gardens and farms, but it is quite as abundant in thick woods and in reed-beds.[8]

At night, usually in winter, it often roosts, true to its scientific name, in dark retreats, snug holes and even old nests. In hard weather, it may do so in parties, consisting of either the family or of many individuals gathered together for warmth.

For the most part insects and spiders are its food, but in winter large pupae are taken and some seeds.

Vocalizations[edit]

When this bird is annoyed or excited, its call runs into an emphatic churr, not unlike clockwork running down. Its song is a gushing burst of sweet music, loud and emphatic. It has an enormous voice for its size, ten times louder, weight for weight, than a cockerel. Its song may sometimes be confused for the Dunnock, which has warble that is shorter and weaker. The wren's song also incorporates repeated trill sounds while the Dunnock's does not.

song

Problems playing this file? See media help.

Individuals vary in quality as well as volume of their song. The song begins with a few preliminary notes, then runs into a trill, slightly ascending, and ends in full clear notes or another trill. At all and any season, the song may be heard, though most noticeable during spring. Despite its generally mouse-like behaviour, the male may sing from an exposed perch as its whole body quivers from the effort. Male has remarkable long and complex vocalizations, with a series of tinkling trills one after the other for seconds on end.[9]

Breeding[edit]

Adult with four hatchlings; one has just been fed a spider or harvestman

The male wren builds several nests, up to 6 or 7. These are called "cock nests" but are never lined until the female chooses one to use.

The normal round nest of grass, moss, lichens or leaves is tucked into a hole in a wall, tree trunk, crack in a rock or corner of a building, but it is often built in bushes, overhanging boughs or the litter which accumulates in branches washed by floods.

Five to eight white or slightly speckled eggs are laid in April, and second broods are reared. The eggs of the St. Kilda wren are marginally larger and often more boldly spotted; six is the usual number.

Wrens are highly polygynous, that is to say a male can have, at any one time, more than one female with an active nest on his territory. An active nest is one in which there are eggs or nestlings. A male has been recorded with four females breeding on his territory.[10] Bigamy and trigamy are the most common forms of polygyny.

Relationship with humans[edit]

In European folklore, the wren is the king of the birds, according to a fable attributed to Aesop by Plutarch,[11] when the eagle and the wren strove to fly the highest, the wren rested on the eagle's back, and when the eagle tired, the wren flew out above him. Thus, Plutarch implied, the wren proved that cleverness is better than strength. The wren's majesty is recognized in such stories as the Grimm Brothers' The Willow-Wren and the Bear. Aristotle[12] and Plutarch called the wren basileus (king) and basiliskos (little king). In German, the wren is called Zaunkönig. An old German name was “Schneekönig”, and in Dutch, it is “winterkoning”, which all refer to king. In Japan, the wren is labelled king of the winds.

It was a sacred bird to the Druids, who considered it "supreme among all the birds",[citation needed] and used its musical notes for divination. The shape-shifting Fairy Queen took the form of a wren, known as "Jenny Wren" in nursery rhymes. A wren's feather was thought to be a charm against disaster or drowning.

The wren also features in the legend of Saint Stephen, the first Christian martyr, who supposedly was betrayed by the noisy bird as he attempted to hide from his enemies. Traditionally, St. Stephen's Day (26 December) has been commemorated by Hunting the Wren, wherein young wrenboys would catch the bird and then ritually parade it around town, as described in the traditional "Wren Song". The Wren, the Wren, the king of all birds, St. Stephen's day was caught in the furze. Although he is little, his family's great, I pray you, good landlady, give us a treat.[13] The tradition, and the significance of the wren as a symbol and sacrifice of the old year, is discussed in Sir James Frazer's [[The Golden Bough]].[14]

According to Suetonius, the assassination of Julius Caesar was foretold by an unfortunate wren. On the day before the Ides of March, a wren was seen being pursued in a frenzy by various other birds. With a conspicuous sprig of laurel clamped in its beak, the wren flew desperately into the Roman Senate, but there its pursuers overtook it and tore it to pieces.[15]

Cultural depictions[edit]

References[edit]

  1. ^ BirdLife International (2012). "Troglodytes troglodytes". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Brewer, David; Mackay, Barry Kent (2001). Wrens, Dippers and Thrashers. Christopher Helm. ISBN 1-873403-95-X. 
  3. ^ a b Rice, Nathan H; Peterson, A. Townsend; Escalona-Segura, Griselda (1999) "Phylogenetic Patterns in Montane Troglodytes Wrens" The Condor, Vol. 101, No. 2 (May, 1999), pp. 446-451 doi:10.2307/1370013 Abstract retrieved 20 November 2007
  4. ^ a b Martínez Gómez, Juan E.; Barber, Bruian R.; Peterson, A. Townsend (2005): "Phylogenetic position and generic placement of the Socorro Wren (Thryomanes sissonii)". Auk 122(1): 50–56. [English with Spanish abstract] DOI:10.1642/0004-8038(2005)122[0050:PPAGPO]2.0.CO;2 PDF text retrieved 20 November 2007
  5. ^ Toews, David P. L.; Darren E. Irwin (2008). "Cryptic speciation in a Holarctic passerine revealed by genetic and bioacoustic analyses". Molecular Ecology 17 (11): 2691–2705. doi:10.1111/j.1365-294X.2008.03769.x. ISSN 0962-1083. PMID 18444983. 
  6. ^ Drovetski, S. V.; R. M. Zink; S. Rohwer; I. V. Fadeev; E. V. Nesterov; I. Karagodin; E. A. Koblik; Y. A. Red'kin (2004). "Complex biogeographic history of a Holarctic passerine". Proceedings of the Royal Society B: Biological Sciences 271 (1538): 545–551. doi:10.1098/rspb.2003.2638. ISSN 0962-8452. PMC 1691619. PMID 15129966. 
  7. ^ Weir, J. T.; D. Schluter (2004). "Ice sheets promote speciation in boreal birds". Proceedings of the Royal Society B: Biological Sciences 271 (1551): 1881–1887. doi:10.1098/rspb.2004.2803. ISSN 0962-8452. PMC 1691815. PMID 15347509. 
  8. ^ BBC.co.uk
  9. ^ del Hoyo, J. Elliott, A. & Christie, D. (2005) Handbook of the Birds of the World. Volume 10: Cuckoo-shrikes to Thrushes. Lynx Edicions. ISBN 84-87334-72-5.
  10. ^ Burn J. L., 1996, Polygyny and the Wren, D.Phil thesis, University of Oxford
  11. ^ Plutarch, Political Precepts xii.806e; Laura Gibb, tr. Aesop's Fable #238; Plutarch's brief account is referenced by Erasmus, Adages iii.7.1, accounting for the hostility of the eagle ("a creature at war with everyone") towards the wren
  12. ^ Aristotle, The History of Animals, IX.11.
  13. ^ Hymns and Carols of Christmas on-line Text retrieved 20 November 2007
  14. ^ Frazer, James George (1890). The Golden Bough: A Study in Magic and Religion (two vols). Macmillan, 1890. Full text (HTML) retrieved 20 November 2007
  15. ^ Suetonius. The Lives of the Twelve Caesars. p. 50. Retrieved 2010-11-13. 
  16. ^ The Jungle Book
  17. ^ Subscribe.ru
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!