You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Troglodytes aedon

A small (4 ½ -5 inches) wren, the House Wren is most easily identified by its plain tan-brown back, tan breast, short tail (often held up at an angle), curved bill, and faint white eye-stripes. This species may be distinguished from the similar Carolina Wren (Thryothorus ludovicianus) by that species’ larger size and redder plumage and from Bewick’s Wren (Thryothorus ludovicianus) by that species’ larger size and brighter eye-stripes. Male and female House Wrens are similar to one another in all seasons. The House Wren breeds in southern Canada and the northern half of the United States, with other breeding populations occurring from southern Mexico and the West Indies to southern South America. In winter, populations breeding in North America winter in the southern half of the United States and northern Mexico. By contrast, tropical and South American House Wren populations are non-migratory. House Wrens inhabit a variety of semi-open habitats, including bushy fields, woodland edges, and scrub. This species has also adapted to life in well-vegetated urban and suburban areas, and its habit of nesting in artificial nest-boxes, also known as “bird houses,” has become part of this species’ English-language common name. House Wrens exclusively eat small insects. In appropriate habitat, House Wrens may be seen foraging for food on the ground or in the branches of bushes and shrubs. Birdwatchers may also listen for this species’ song, a rapid series of warbled notes. House Wrens are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

House wrens are native to the Nearctic region. During the breeding season they live from southern Canada to southern Argentina, Chile and the Falkland Islands. They spend the winter in a narrower range; the southern limits of the United States, southwestern California east to Florida and south throughout the Gulf Coast and Mexico.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Johnson, L. 1998. House Wren (Troglodytes aedon) No. 380. A Poole, F Gill, eds. The Birds of North America. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Breeding range extends from southern British Columbia across southern Canada to New Brunswick, and south to northern Baja California, Texas, and northern Georgia; also Mexico, West Indies, and Central and South America (to Tierra del Fuego). During the northern winter, this species ranges from the southern United States southward.

The southern limit of the wintering range of North American populations is about at the northern limit of resident populations in Central America, so migratory and resident populations rarely co-occur (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

House wrens are small, squat birds without bold or characteristic markings. They have long, curved bills and, like other wrens, perch in a characteristic posture with their tail held erect. Their heads, napes, and backs are almost uniformly brown with very fine darker brown stripes. Their throats and chests are light grey, and they may have some black, dark brown, or pinkish spots on their flanks, tails, and wings. There is a faint, white eyebrow-like stripe above their eyes.

House wrens are usually 11 to 13 cm long and weigh 10 to 12 g. Males and females are identical in coloration, but males are slightly larger in some traits.

There are about 30 recognized subspecies of Troglodytes aedon. These subspecies are differentiated by plumage shading, amount of barring on flanks, variation in wing-to-tail proportions, and vocalizations.

Range mass: 10 to 12 g.

Range length: 11 to 13 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike; male larger

  • McGillivray, W., G. Semenchuk. 1998. Field Guide To Birds of Alberta. Edmonton, AB: Federation of Alberta Naturalists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 12 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the wild, house wrens live in open, shrubby woodlands. However, they were named for their preference for small town and suburban backyards and human-made bird houses. Small wood-lots and forest edges are also common habitats for these birds. Human farming and towns have created more good breeding habitat for the wren by breaking forests up into small chunks. This explains why house wrens have expanded their range and their population in North America has grown. During the winter, wrens live in thickets, shrubby and brushy areas, riparian forests, and savannas in the southern United States. In Mexico, they prefer tropical evergreen and semideciduous forests.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: House wrens inhabit thickets, shrubbery, and brushy areas in partly open situations, open woodland, farmlands, chaparral, and areas around human habitations; also (south of the United States) humid montane forest, forest edge, clearings, pine-oak associations, and mangroves. This species occurs most often in human-disturbed habitats. It sleeps in all seasons in crannies in buildings, holes in trees, niches in banks, or in similar sites. Nests usually are in cavities (natural, abandoned woodpecker holes, bird boxes, and within various human artifacts).

House wrens commonly reuse nesting cavities in successive years. Prior to reuse, the male usually removes the old nest-lining and sometimes the old sticks as well. Removal of old nest material can significantly reduce the abundance of parasitic mites that may attack the wrens.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

North- and south-temperate populations are migratory; tropical populations are resident. Breeding populations north of the southern United States migrate south for winter, south to southern Mexico. Spring migrants arrive in northern breeding areas March-May.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

House wrens feed primarily on small, terrestrial insects. The independent young and adults consume mostly spiders, beetles, and bugs while the nestlings are fed mostly grasshoppers, crickets, and caterpillars. Adults feed their young and supplement their own diet with sources of calcium such as mollusk shells. House wrens forage primarily in the woodland subcanopy, in shrubs and among herbaceous ground cover.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats almost entirely insects; also other small invertebrates (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

House wrens help to control insect populations. They also supply food for many different animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of house wrens include cats, rats, opossums, woodpeckers, foxes, owls, raccoons, squirrels, and various snakes. Adult house wrens respond to predators by chasing and striking at the predator while giving a loud, harsh alarm call.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Troglodytes aedon is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Troglodytes aedon preys on:
Insecta
Sitta canadensis

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Drilling and Thompson (1988) for intensive study, using 910 nest boxes over several years, of natal and breeding dispersal in Illinois.

Density was 10-18 pairs per 40 ha in northern Arizona pine forest (Brawn and Balda 1988).

Sometimes destroys the clutches of other birds, including conspecifics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

House wrens are widely known for their songs. While both sexes produce calls and songs, the males' songs are more complex. Altogether, 130 different song types are known from house wrens. Unmated males can sing for up to 10 minutes. Males with a mate often sing a "whispering song", which is very quiet, and is only sung around the time of copulation. The purpose of the quiet song may be to avoid revealing the location of his fertile mate to other males. The female sings during the first days of pairing when she responds to her mate's song.

House wrens also communicate using body language. If a predator approaches, males crouch and drop their wings, raise their back feathers, and lower their fanned-out tail.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known house wren lived to be at least 7 years old. It is difficult to estimate the lifespan of these birds because they do not return to the same area every year.

Range lifespan

Status: wild:
7 (high) years.

Average lifespan

Status: wild:
108 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

House wrens are socially monogamous, meaning that one male and one female mate together and share parental responsibilities. However, some studies have shown that males that have surplus nest sites in their territory advertise for secondary mates. About 10% of the males in one study were polygynous. Adults often switch breeding partners between the first and second brood of a season. Breeding pairs do not last for any more than one season.

Mating System: monogamous

House wrens breed between late April and early September, with the majority of clutches started in mid-late May. The males are the first to return from migration and establish territory for nesting within a few hours/days of arrival. The females return in time to complete the nest after choosing a male. Females that nest at low latitudes (including most of the U.S.) and/or low altitudes generally raise two broods per season.

House wrens nest in tree cavities, such as old woodpecker holes. They prefer cavities closer to the ground with small entrances. The male begins building the nest by placing sticks in the bottom of the cavity. When the female arrives, she finishes building the nest. The female lays a clutch of 4 to 8 (usually 6) eggs, which she incubates for about 12 days. The chicks are altricial when they hatch, and are brooded by the female. Both parents feed the chicks, which fledge after 15 to 17 days. The chicks all leave the nest within a few hours of each other. After the chicks leave the nest, both parents continue to feed them for about 13 days.

House wrens are able to breed (have reached sexual maturity) when they are 1 year old, but some first time breeders skip the regular breeding time and choose instead to breed alongside the older birds who are attempting a second clutch in a season.

Breeding interval: House wrens may raise up to two broods each breeding season.

Breeding season: House wrens breed between late April and early September.

Range eggs per season: 4 to 8.

Average time to hatching: 12 days.

Range fledging age: 15 to 17 days.

Average time to independence: 13 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average time to hatching: 14 days.

Average eggs per season: 7.

House wren chicks are completely helpless and dependant on their parents, who both care for the young. They fledge after about 15 to 17 days and all leave the nest within a few hours of each other. The parents continue to feed them for about 13 days after they leave the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Johnson, L. 1998. House Wren (Troglodytes aedon) No. 380. A Poole, F Gill, eds. The Birds of North America. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding season is relatively short and strongly seasonal in the north, protracted and variable in the tropics (e.g., see Young, 1994, Condor 96:341-353). Egg laying in the United States begins as early as April in some areas, in May in most regions. Nesting may extend into July or August in some areas. Clutch size averages about 3-4 at low latitudes, about 5-7 at high latitudes (Young, 1994, Auk 111:545-555). Individual females in the north produce 2, sometimes 3, broods per year (3-4 in Costa Rica). Incubation, by the female, lasts 12-15 days. Young are tended by both parents, leave nest at 12-18 days; male may feed fledged young while the female renests. Breeding is most commonly monogamous; males sometimes polygynous.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Troglodytes aedon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCATCAACCGATGACTATTTTCCACCAACCACAAAGACATCGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGGATGGTAGGTACTGCCCTTAGCCTCCTCATCCGAGCAGAGCTGGGCCAACCTGGCGCCTTACTCGGAGACGACCAAGTCTACAATGTGATCGTCACAGCCCATGCTTTCGTGATAATCTTCTTCATAGTTATACCAATCATGATCGGAGGATTCGGCAACTGACTAGTCCCCTTAATGATCGGAGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTACTACTCCTAGCCTCCTCCACCGTTGAAGCAGGGGTCGGAACAGGTTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCATGCCGGGGCATCAGTCGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTATCTCCTCCATTCTAGGCGCAATCAATTTCATCACAACAGCAATCAACATAAAACCCCCCGCCCTATCCCAATACCAAACACCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTCCTGCTCCTCTCCCTCCCCGTACTTGCCGCAGGCATCACCATGCTACTAACAGATCGAAACCTCAACACCACATTCTTCGACCCCGCAGGAGGCGGAGACCCTGTCCTCTACCAGCACTTGTTCTGATTCTTCGGACACCCAGAAGTCTATATCCTAATTCTCCCCGGATTCGGAATCATCTCCCACGTAGTAGCTTACTACTCAGGAAAAAAAGAGCCTTTCGGCTACATAGGAATGGTATGAGCCATACTATCCATCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Troglodytes aedon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 67
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

House wrens are a very successful species because they have benefited from forest fragmentation and other human-induced habitat changes. They are quite tolerant of pesticides, habitat alteration and nest disturbance, allowing them to live and reproduce successfully even in human populated areas. This species is protected under the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimated the global population to number >50,000,000 individuals (A. Panjabi in litt. 2008), which is placed in the band 50,000,000-100,000,000 individuals here.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of house wrens on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

House wrens eat insects that may be considered to be pests by humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

House Wren

The House Wren (Troglodytes aedon) is a very small songbird of the wren family, Troglodytidae. It occurs from Canada to southernmost South America, and is thus the most widely distributed bird in the Americas.[2] It occurs in most suburban areas in its range and it is the single most common wren. Its taxonomy is highly complex and some subspecies groups are often considered separate species.

Contents

Description

Though living about 9,000 kilometres (5,600 mi) away, Southern House Wrens in São Paulo (Brazil) differ from their northern relatives in voice more than in looks.

Adults are 11 to 13 cm (4.3 to 5.1 in) long, with a 15 cm (5.9 in) wingspan and weigh about 10 to 12 g (0.35 to 0.42 oz).[3] Among standard measurements, the wing chord is 4.7 to 5.3 cm (1.9 to 2.1 in), the tail is 3.9 to 4.4 cm (1.5 to 1.7 in), the culmen is 1.1 to 1.3 cm (0.43 to 0.51 in) and the tarsus is 1.6 to 1.8 cm (0.63 to 0.71 in).[2] The subspecies vary greatly, with upperparts ranging from dull greyish-brown to rich rufescent-brown, and the underparts ranging from brown, over buff and pale grey, to pure white. All subspecies have blackish barring to the wings and tail, and some also to the flanks. All subspecies show a faint eye-ring and eyebrow and have a long, thin bill with a blackish upper mandible, and a black-tipped yellowish or pale grey lower mandible. The legs are pinkish or grey. The short tail is typically held cocked.

This bird's rich bubbly song is commonly heard during the nesting season but rarely afterwards. There is marked geographical variation in its song, though somewhat more gradual than in the birds' outward appearance which can strikingly differ e.g. on neighboring islands in the Caribbean.[4] Birds from far north and south of the species' range nonetheless have songs that differ markedly.

Systematics and taxonomy

The House Wren is usually divided into three distinct subspecies groups and one or several distinct island-endemic subspecies. Some or all of these are often considered distinct species.

It has also been suggested that the taxa from the Lesser Antilles represent one or more separate species, but there is less agreement as to their subdivision, because as far as they have been studied to date, there is little clear biogeographical structure among these populations.[4]

Three additional taxa from more oceanic islands have traditionally been included in the House Wren, but are increasingly considered as separate species:

The Socorro Wren is a highly distinct form, appearing somewhat like a mixture between a House Wren and a Bewick's Wren (Thryomanes bewickii).

Ecology

In North America, the House Wren is thought to achieve the highest density in floodplain forests in the western great plains where it uses woodpecker holes as nesting sites. In South and Central American it can be found in virtually any habitat and is, as indicated by its common name, often associated with humans. North American birds migrate to the southern United States and Mexico for winter. Most return to the breeding grounds in late April to May, and leave for winter quarters again around September to early October.[5] These birds forage actively in vegetation. They mainly eat insects such as butterfly larvae, also spiders and snails. Southern house wrens rarely attend mixed-species feeding flocks.[6]

Reproduction

Audubon's illustration of nesting House Wren

The nesting habits do not seem to differ significantly between the Northern and Southern House Wrens at least. They usually construct a large cup nest in various sorts of cavities, taking about a week to build. The nest is made from small dry sticks and is usually lined with a variety of different materials. These include: feather, hair, wool, spider cocoons, strips of bark, rootlets, moss, and trash. The male wren finds dry sticks, which he adds to the nest. Once he is done, the female inspects at the nest; but if she does not approve of the construction, she will throw any unwanted sticks to the ground. After this process, the female lines the nest. Nest cavities are usually a few meters above ground at most, but occasionally on cliffs as high up as 15 meters and more at least in southern populations[verification needed]; they may be natural or man-made, often using bird houses.

House Wrens are feisty and pugnacious animals considering their tiny size. They are known to occasionally destroy the eggs of other birds nesting in their territory by puncturing the eggshell. They are also known to fill up other birds' nests within its territory with sticks to make them unusable.

Adult bringing food for young (note begging calls)

Depending on the exact population, the House Wrens' clutch is usually between two and eight red-blotched cream-white eggs,[7] weighing about 1.4 grams each and measuring c.17 and 13.4 mm at the widest points. Only the female incubates these, for around 12–19 days,[7] and she will every now and then leave the nest for various reasons. When on the nest, the male provisions her with food. The young, which like all passerines hatch almost naked and helpless, take another 15–19 days or so to fledge[citation needed]. They are being fed by both parents, and need plenty of food given their tiny size (see also Bergmann's Rule). As the young near fledging, the parents spend much of their time procuring food for them. Brood loss due to predation was found to be light in the Southern Andean Yungas, with predation of nestling young being almost insignificant.[8] Known predators of House Wrens at the nest include cats, rats, opossums, woodpeckers, foxes, raccoons, squirrels, snakes and owls. Adults away from the nests can usually avoid these predators although both small hawks and owls occasionally predate free-flying adult wrens.[9]

Migrant populations are nesting within 6 weeks of returning from winter quarters, leaving theoretically time for a second brood.[10][5] In the subtropical montane forest of northwestern Argentina and similar habitat, the Southern House Wren breeds in the rainy summer months from late October to late December.[8]

In Washington, D.C. area, House Wren parents made significantly more feeding trips per hour in suburban backyards compared to rural backyards. Yet rural nestlings grew at a faster rate than their suburban counterparts. In addition, suburban parents spent less time brooding (sitting on the nest) compared to rural parents. Such results suggest that suburban backyard habitats offer House Wrens food for nestlings that is inferior in either quality or quantity to what rural habitats offer. Food items may, for example, be smaller in suburban habitats, and force adults to make more trips to the box.[11]

Conservation status

The House Wren may have been displaced somewhat in some northern parts of its range by the introduction of the House Sparrow, but is still common and widespread throughout most of the Americas. It is not considered threatened by the IUCN,[1] though this would certainly not hold true for several of the island population if they turn out to be true species.

Some taxa, especially from the Lesser Antilles, are rare and highly endangered or possibly already extinct. Several factors seem to have contributed to a varying degree to the decline of these birds, namely habitat destruction, predation by introduced mongooses, and hurricanes:

The Saint Vincent Wren (Troglodytes aedon musicus) of Saint Vincent was close to extinction in the mid-late 20th century; it has since recovered and today is not uncommon[4]

As remarked above, these are variously placed in T. musculus if that is considered distinct, or as one or several distinct species.

In culture

John James Audubon illustrates the House Wren in Birds of America (published, London 1827–38) as Plate 83. The image was engraved and colored by the Robert Havell, London workshops.. The original watercolor by Audubon was purchased by the New York History Society where it remains to this day (January 2009).

Troglodytes Aedon was one of the two pets of King Friday the XVIII in Mister Rogers' Neighborhood. Trog, as the King called him, was a wooden wren on a stick, and Trog had his own song. King Friday's other pet was a mockingbird (also a wooden bird on a stick) named Mimus Polyglottos (see Neighborhood of Make-Believe).

Brazilian footballer Garrincha earned his nickname from one of the names the House Wren has in Rio de Janeiro.[12]

References

  1. ^ a b BirdLife International (2012). "Troglodytes aedon". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b Wrens, Dippers, and Thrashers: A Guide to the Wrens, Dippers, and Thrashers of the World by David Brewer & Sean McMinn. Yale University Press (2001). ISBN 978-0300090598.
  3. ^ House Wren, Life History, Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2013-03-18.
  4. ^ a b c d e f VanderGaast, Jay & Jaramillo, Alvaro (2005): Field Guides Incorporated Trip List – Lesser Antilles April 9, 2005 to April 23, 2005.
  5. ^ a b Ohio Ornithological Society (2004): Annotated Ohio state checklist
  6. ^ Machado, C.G. (1999): A composição dos bandos mistos de aves na Mata Atlântica da Serra de Paranapiacaba, no sudeste brasileiro [Mixed flocks of birds in Atlantic Rain Forest in Serra de Paranapiacaba, southeastern Brazil]. Revista Brasileira de Biologia 59(1): 75–85 [Portuguese with English abstract]. doi:10.1590/S0034-71081999000100010
  7. ^ a b Kroodsma, D.E. & Brewer, D. (2005): Troglodytidae. pp. 356–447 in: del Hoyo, J.; Elliott, A. & Christie, D.A. (2005). Handbook of the Birds of the World. Vol. 10. Cuckoo-shrikes to Thrushes. Lynx Edicions, Barcelona. ISBN 84-87334-72-5
  8. ^ a b Auer, Sonya K.; Bassar, Ronald D.; Fontaine, Joseph J. & Martin, Thomas E. (2007). "Breeding biology of passerines in a subtropical montane forest in Northwestern Argentina". Condor 109 (2): 321–333. doi:10.1650/0010-5422(2007)109[321:BBOPIA]2.0.CO;2. 
  9. ^ Brown, J. (2001). Troglodytes aedon, Animal Diversity Web. Accessed March 18, 2013.
  10. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bull. 18 (2): 47–60. 
  11. ^ Newhouse, M., Marra, P. P. & Johnson, L. S. (2008). "Reproductive Success of House Wrens in Suburban and Rural Land-Use Areas". The Wilson Journal of Ornithology 120: 99. doi:10.1676/06-156.1. 
  12. ^ Castro, Ruy (1995). Estrela Solitária: um Brasileiro Chamado Garrincha (in Portuguese). Companhia das Letras. p. 28. ISBN 8571644934. 

Further reading

  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Complex of five groups; species limits within complex are not well understood (AOU 1983). Groups are: aedon (Northern House-Wren), brunneicollis (Brown-throated Wren), musculus (Southern House-Wren), martinicensis Antillean House-Wren), and beani (Cozumel Wren) (AOU 1998). Phillips (1986) used the specific name domesticus for this species, from which he separated the Cozumel Island beani. Banks and Browning (1995) acknowledged that based on priority alone, the correct name is T. domesticus, but they argued for retention of the name T. aedon because that would best serve nomenclatural stability.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!