You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Troglodytes aedon

A small (4 ½ -5 inches) wren, the House Wren is most easily identified by its plain tan-brown back, tan breast, short tail (often held up at an angle), curved bill, and faint white eye-stripes. This species may be distinguished from the similar Carolina Wren (Thryothorus ludovicianus) by that species’ larger size and redder plumage and from Bewick’s Wren (Thryothorus ludovicianus) by that species’ larger size and brighter eye-stripes. Male and female House Wrens are similar to one another in all seasons. The House Wren breeds in southern Canada and the northern half of the United States, with other breeding populations occurring from southern Mexico and the West Indies to southern South America. In winter, populations breeding in North America winter in the southern half of the United States and northern Mexico. By contrast, tropical and South American House Wren populations are non-migratory. House Wrens inhabit a variety of semi-open habitats, including bushy fields, woodland edges, and scrub. This species has also adapted to life in well-vegetated urban and suburban areas, and its habit of nesting in artificial nest-boxes, also known as “bird houses,” has become part of this species’ English-language common name. House Wrens exclusively eat small insects. In appropriate habitat, House Wrens may be seen foraging for food on the ground or in the branches of bushes and shrubs. Birdwatchers may also listen for this species’ song, a rapid series of warbled notes. House Wrens are most active during the day.

Threat Status: Least Concern

  • Johnson, L. Scott. 1998. House Wren (Troglodytes aedon), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/380
  • Northern House Wren (Troglodytes aedon). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Troglodytes aedon. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • eBird Range Map - House Wren. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

House wrens are native to the Nearctic region. During the breeding season they live from southern Canada to southern Argentina, Chile and the Falkland Islands. They spend the winter in a narrower range; the southern limits of the United States, southwestern California east to Florida and south throughout the Gulf Coast and Mexico.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Johnson, L. 1998. House Wren (Troglodytes aedon) No. 380. A Poole, F Gill, eds. The Birds of North America. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

House Wrens are native to the Nearctic region. During the breeding season they live from southern Canada to southern Argentina, Chile and the Falkland Islands. They spend the winter in a narrower range; the southern limits of the United States, southwestern California east to Florida and south throughout the Gulf Coast and Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

House wrens are small, squat birds without bold or characteristic markings. They have long, curved bills and, like other wrens, perch in a characteristic posture with their tail held erect. Their heads, napes, and backs are almost uniformly brown with very fine darker brown stripes. Their throats and chests are light grey, and they may have some black, dark brown, or pinkish spots on their flanks, tails, and wings. There is a faint, white eyebrow-like stripe above their eyes.

House wrens are usually 11 to 13 cm long and weigh 10 to 12 g. Males and females are identical in coloration, but males are slightly larger in some traits.

There are about 30 recognized subspecies of Troglodytes aedon. These subspecies are differentiated by plumage shading, amount of barring on flanks, variation in wing-to-tail proportions, and vocalizations.

Range mass: 10 to 12 g.

Range length: 11 to 13 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike; male larger

  • McGillivray, W., G. Semenchuk. 1998. Field Guide To Birds of Alberta. Edmonton, AB: Federation of Alberta Naturalists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

House Wrens are small, squat birds that lack bold or characteristic markings. They have long, curved bills and are seen perching in the "wren posture" with the tail held up. Their heads, napes, and backs are almost uniformly brown with their throats and chests a uniform light grey. Some black, dark brown, or pinkish spots appear on their flanks, tails, and wings. There is a faint, white stripe above their eyebrows. They are usually 11 to 13 cm long and weigh between 10 and 12 g.

Range mass: 10.0 to 12.0 g.

Range length: 11.0 to 13.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the wild, house wrens live in open, shrubby woodlands. However, they were named for their preference for small town and suburban backyards and human-made bird houses. Small wood-lots and forest edges are also common habitats for these birds. Human farming and towns have created more good breeding habitat for the wren by breaking forests up into small chunks. This explains why house wrens have expanded their range and their population in North America has grown. During the winter, wrens live in thickets, shrubby and brushy areas, riparian forests, and savannas in the southern United States. In Mexico, they prefer tropical evergreen and semideciduous forests.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the wild House Wrens live in open, shrubby woodlands. However, they were named for their preference for small town and suburban backyards and human-made bird houses. Small wood-lots and forest edges are also well known habitats for these birds. Human farming and towns have created more good breeding habitat for the wren by fragmenting forests, which explains why the House Wren has expanded its range and numbers in North America. During the winter wrens live in thickets, shrubby and brushy areas, riparian forests, and savannas in the southern United States. In Mexico, they prefer tropical evergreen and semideciduous forests.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: chaparral ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

House wrens feed primarily on small, terrestrial insects. The independent young and adults consume mostly spiders, beetles, and bugs while the nestlings are fed mostly grasshoppers, crickets, and caterpillars. Adults feed their young and supplement their own diet with sources of calcium such as mollusk shells. House wrens forage primarily in the woodland subcanopy, in shrubs and among herbaceous ground cover.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

House wrens feed primarily on small, terrestrial Insecta. The independent young and adults consume mostly Araneae, Coleoptera, and Heteroptera while the babies still in the nest (called nestlings) are fed mostly Orthoptera, Gryllidae, and Lepidoptera. Adults will feed their young, and supplement their own diet, with sources of calcium such as mollusk shells.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

House wrens help to control insect populations. They also supply food for many different animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of house wrens include cats, rats, opossums, woodpeckers, foxes, owls, raccoons, squirrels, and various snakes. Adult house wrens respond to predators by chasing and striking at the predator while giving a loud, harsh alarm call.

Known Predators:

  • domestic cats (Felis silvestris)
  • brown rats (Rattus norvegicus)
  • Virginia opossums (Didelphis virginiana)
  • woodpeckers (Piciformes)
  • red foxes (Vulpes vulpes)
  • owls (Strigiformes)
  • raccoons (Procyon lotor)
  • squirrels (Sciuridae)
  • various snakes (Serpentes)
  • Mississippi kites (Ictinia mississippiensis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

House Wrens help to control several insect populations. They also supply an abundant food source for many different types of animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adults respond to predators by chasing and striking at the predators while giving a loud, harsh alarm call. Felis silvestris, Rattus norvegicus, Didelphis virginiana, Piciformes, Vulpes vulpes, Strigiformes, Procyon lotor, Sciuridae, and various Squamata are known predators of this species.

Known Predators:

  • Felis silvestris
  • Muridae
  • Didelphis virginiana
  • Piciformes
  • Vulpes vulpes
  • Strigiformes
  • Procyon lotor
  • Sciuridae
  • Squamata

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Troglodytes aedon is prey of:
Accipiter striatus
Accipiter cooperii

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Troglodytes aedon preys on:
Insecta
Sitta canadensis

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

House wrens are widely known for their songs. While both sexes produce calls and songs, the males' songs are more complex. Altogether, 130 different song types are known from house wrens. Unmated males can sing for up to 10 minutes. Males with a mate often sing a "whispering song", which is very quiet, and is only sung around the time of copulation. The purpose of the quiet song may be to avoid revealing the location of his fertile mate to other males. The female sings during the first days of pairing when she responds to her mate's song.

House wrens also communicate using body language. If a predator approaches, males crouch and drop their wings, raise their back feathers, and lower their fanned-out tail.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

House Wrens are widely known for their songs. While both sexes produce calls and songs, the males' songs are more complex. Altogether 130 different song types are known from House Wrens. Unmated males can sing for up to 10 minutes. Males with a mate are known to produce a "whispering song", where he sings without opening his bill to produce a very quiet song. This song type only occurs around the time of copulation. The purpose of the quiet song may be to not reveal the location of his fertile mate to other males. The female sings during the first days of pairing when she responds to her mate's song.

They will also communicate using body language. If a predator is approaching the male will crouch, droop his wings, erect his back feathers, and lower his fanned out tail.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest known house wren lived to be at least 7 years old. It is difficult to estimate the lifespan of these birds because they do not return to the same area every year.

Range lifespan

Status: wild:
7 (high) years.

Average lifespan

Status: wild:
108 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest House Wren has been known to live is 7 years. It is hard to keep track of the age of individual birds because they do not always return to the same spot every year.

Range lifespan

Status: wild:
7.0 (high) years.

Average lifespan

Status: wild:
108 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

House wrens are socially monogamous, meaning that one male and one female mate together and share parental responsibilities. However, some studies have shown that males that have surplus nest sites in their territory advertise for secondary mates. About 10% of the males in one study were polygynous. Adults often switch breeding partners between the first and second brood of a season. Breeding pairs do not last for any more than one season.

Mating System: monogamous

House wrens breed between late April and early September, with the majority of clutches started in mid-late May. The males are the first to return from migration and establish territory for nesting within a few hours/days of arrival. The females return in time to complete the nest after choosing a male. Females that nest at low latitudes (including most of the U.S.) and/or low altitudes generally raise two broods per season.

House wrens nest in tree cavities, such as old woodpecker holes. They prefer cavities closer to the ground with small entrances. The male begins building the nest by placing sticks in the bottom of the cavity. When the female arrives, she finishes building the nest. The female lays a clutch of 4 to 8 (usually 6) eggs, which she incubates for about 12 days. The chicks are altricial when they hatch, and are brooded by the female. Both parents feed the chicks, which fledge after 15 to 17 days. The chicks all leave the nest within a few hours of each other. After the chicks leave the nest, both parents continue to feed them for about 13 days.

House wrens are able to breed (have reached sexual maturity) when they are 1 year old, but some first time breeders skip the regular breeding time and choose instead to breed alongside the older birds who are attempting a second clutch in a season.

Breeding interval: House wrens may raise up to two broods each breeding season.

Breeding season: House wrens breed between late April and early September.

Range eggs per season: 4 to 8.

Average time to hatching: 12 days.

Range fledging age: 15 to 17 days.

Average time to independence: 13 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 14 days.

Average eggs per season: 7.

House wren chicks are completely helpless and dependant on their parents, who both care for the young. They fledge after about 15 to 17 days and all leave the nest within a few hours of each other. The parents continue to feed them for about 13 days after they leave the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Johnson, L. 1998. House Wren (Troglodytes aedon) No. 380. A Poole, F Gill, eds. The Birds of North America. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: monogamous

House Wren nest sizes range from 4 to 8 eggs, with one egg laid per day. Females develop single large incubation patches (bare areas of skin on their bellies) and will spend over half of their time incubating the eggs, once their entire clutch has been laid. Hatching begins about 12 days after the last egg is laid and occurs only during daylight hours. House Wrens are able to breed (have reached sexual maturity) when they are 1 year old, but some first time breeders skip the regular breeding time and choose instead to breed alongside the older birds who are attempting a second clutch in a season.  House Wrens nest in tree cavities, such as old woodpecker holes. They preferring cavities closer to the ground with small entrances.

Breeding interval: Breeding occurs in late April to early May with the majority of nests started in mid to late May. Some females that start a nest early will sometimes make a second nest in late June to early July.

Breeding season: Late April to July

Range eggs per season: 4.0 to 8.0.

Average time to hatching: 12.0 days.

Range fledging age: 15.0 to 17.0 days.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 14 days.

Average eggs per season: 7.

The young are completely helpless and depend on their parents, who both care for the young. They fledge after about 15 to 17 days and all leave the nest within a few hours of each other.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Troglodytes aedon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCATCAACCGATGACTATTTTCCACCAACCACAAAGACATCGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGGATGGTAGGTACTGCCCTTAGCCTCCTCATCCGAGCAGAGCTGGGCCAACCTGGCGCCTTACTCGGAGACGACCAAGTCTACAATGTGATCGTCACAGCCCATGCTTTCGTGATAATCTTCTTCATAGTTATACCAATCATGATCGGAGGATTCGGCAACTGACTAGTCCCCTTAATGATCGGAGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTACTACTCCTAGCCTCCTCCACCGTTGAAGCAGGGGTCGGAACAGGTTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCATGCCGGGGCATCAGTCGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTATCTCCTCCATTCTAGGCGCAATCAATTTCATCACAACAGCAATCAACATAAAACCCCCCGCCCTATCCCAATACCAAACACCCCTATTCGTCTGATCCGTCCTAATCACTGCAGTCCTCCTGCTCCTCTCCCTCCCCGTACTTGCCGCAGGCATCACCATGCTACTAACAGATCGAAACCTCAACACCACATTCTTCGACCCCGCAGGAGGCGGAGACCCTGTCCTCTACCAGCACTTGTTCTGATTCTTCGGACACCCAGAAGTCTATATCCTAATTCTCCCCGGATTCGGAATCATCTCCCACGTAGTAGCTTACTACTCAGGAAAAAAAGAGCCTTTCGGCTACATAGGAATGGTATGAGCCATACTATCCATCGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Troglodytes aedon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 67
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Not Recognized (NR)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5