Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

This finch uses its powerful bill to break open seeds, which it feeds on throughout the year (5). In winter they may form groups with other finches and buntings (3), and as natural seed stocks dwindle at this time of year, they increasingly rely on artificial food sources, such as bird tables (6). Greenfinches nest in small colonies in trees and bushes (2) and only defend a very small area around their nest. They sing and display in spring and have a characteristic wavering display flight that shows off their yellow wing and tail flashes (5). Between four and six eggs are produced per clutch, and incubation takes up to 15 days. The young are fully fledged 18 days after hatching (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The greenfinch is a well-known bird as it often visits gardens (5) and drives other birds away from feeders (6). It is a relatively heavy looking bird, with a chunky bill and a stout body (5). It can be recognised by the yellow outer-most wing feathers (the primaries) which are visible when the bird is perching, the yellow flashes on the tail, seen easily when the bird is in flight, and the greenish underparts (2). Males have a yellowish-green breast and are much more yellow than the duller greyish female (2). Juveniles are similar to females, but are streaked (5). A twittering call is produced in flight; other vocalisations include a canary-like song and a wheezy, nasal 'dschruuuuuh' (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Widespread and common throughout Britain. Elsewhere, the breeding range of this species extends throughout mainland Europe, north-western Africa and reaches east to Turkey (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in a very wide range of habitats including woodland edges, parks, gardens, conifer plantations and tall hedgerows (3) (2). The greenfinch is more likely to feed in fields and gardens in winter (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
imago of Ornithomya avicularia ectoparasitises Carduelis chloris

Animal / parasite / ectoparasite
imago of Ornithomya fringillina ectoparasitises Carduelis chloris

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Carduelis chloris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Carduelis chloris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCCACAAAGACATTGGCACCCTATATTTAATTTTCGGCGCATGAGCCGGGATAGTAGGTACTGCCCTAAGTCTTCTCATCCGAGCAGAATTAGGCCAACCCGGAGCCCTTCTAGGCGACGACCAAGTCTATAACGTAGTCGTCACAGCCCATGCTTTTGTAATAATTTTCTTCATAGTCATACCCATCATAATTGGGGGATTCGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCTCCATCTTTCCTGCTGCTACTAGCATCTTCCACTGTAGAAGCAGGTGTTGGCACAGGTTGAACAGTATACCCCCCACTAGCTGGCAACCTAGCCCATGCTGGAGCTTCAGTTGACTTAGCAATCTTTTCCCTACATTTAGCCGGTATCTCCTCAATCCTTGGGGCAATCAACTTCATTACAACAGCAATTAACATAAAACCTCCTGCCCTATCGCAATACCAAACCCCTCTATTCGTCTGATCAGTCCTAATCACTGCAGTACTCCTACTTCTCTCCCTCCCAGTCCTTGCTGCAGGAATCACAATGCTTCTTACAGACCGCAACCTAAACACCACATTCTTCGACCCCGCAGGAGGAGGCGACCCAGTCCTATACCAACATCTCTTCTGATTTTTCGGTCACCCAGAAGTATATATCCTTATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Amber List (medium conservation concern) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 14,000,000-32,000,000 breeding pairs, equating to 42,000,000-96,000,000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 44,700,000-128,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is not threatened at present, and abundance has not changed significantly since the 1960s (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European Greenfinch

Eggs MHNT

The European Greenfinch, or just Greenfinch (Carduelis chloris) is a small passerine bird in the finch family Fringillidae. The genus Carduelis might be split up and in this case, the greenfinches would be separated in their old genus Chloris again.[citation needed]

This bird is widespread throughout Europe, north Africa and south west Asia. It is mainly resident, but some northernmost populations migrate further south. The Greenfinch has also been introduced into both Australia and New Zealand. In Malta it is considered a prestigious song bird which has been trapped for many years. It has been domesticated and many Maltese people breed them.

Chloris is from the Greek Khloros meaning "green" or "yellowish-green".[2]

Antonio Arnaiz-Villena et al. (1998) and Antonio Arnaiz-Villena et al. (2006) studied the Eurasian Bullfinch phylogeny.[3][4][5]

Description[edit]

The Greenfinch is 15 cm long with a wing span of 24.5 to 27.5 cm. It is similar in size and shape to a House Sparrow,[6] but is mainly green, with yellow in the wings and tail. The female and young birds are duller and have brown tones on the back. The bill is thick and conical. The song contains a lot of trilling twitters interspersed with wheezes, and the male has a "butterfly" display flight.

Behaviour and ecology[edit]

Woodland edges, farmland hedges and gardens with relatively thick vegetation are favoured for breeding. It nests in trees or bushes, laying 3 to 8 eggs.

This species can form large flocks outside the breeding season, sometimes mixing with other finches and buntings. They feed largely on seeds, but also take berries.

References[edit]

  1. ^ BirdLife International (2012). "Carduelis chloris". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Jobling, James A (1991). A Dictionary of Scientific Bird Names. OUP. ISBN 0-19-854634-3. 
  3. ^ Arnaiz-Villena, Antonio; Alvarez-Tejado M.; Ruiz-del-Valle V.; García-de-la-Torre C.; Varela P; Recio M. J.; Ferre S.; Martinez-Laso J. (1998). "Phylogeny and rapid Northern and Southern Hemisphere speciation of goldfinches during the Miocene and Pliocene Epochs". Cell.Mol.Life.Sci. 54(9):1031–41. 
  4. ^ Arnaiz-Villena, A; Zamora J; Ernesto L; Ruiz-del-Valle V; Moscoso J; Serrano-Vela JI; Rivero-de-Aguilar J (2006). "Rhodopechys obsoleta (desert finch): a pale ancestor of greenfinches(Carduelis spp.) according to molecular phylogeny". Journal of Ornithology 147 (3. p. 448–456.). 
  5. ^ Zamora, J; Moscoso J; Ruiz-del-Valle V; Ernesto L; Serrano-Vela JI; Ira-Cachafeiro J; Arnaiz-Villena A (2006). "Conjoint mitochondrial phylogenetic trees for canaries Serinus spp. and goldfinches Carduelis spp. show several specific polytomies". Ardeola. 53(1): 1–17. 
  6. ^ The Birds of the Western Palearctic [Abridged]. OUP. 1997. ISBN 0-19-854099-X. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!