Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Comprehensive Description

Miscellaneous Details

"They make engaging pets, becoming exceedingly tame and confiding, following their master about and flying long distances when called."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"A common bird of hill forests and urban gardens. Distinguished by a tall pointed black crest, red face patch and brownish upper parts."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: Native to south-central and southeastern Asia. Introduced and established in Hawaii (well established in Honolulu, Oahu; expanding throughout island), southern Florida, Australia, and Nicobar Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Distinguishable at a glance from the foregoing by the presence of an upstanding, pointed black crest which sometimes curves forward almost over the beak. The crimson ' whiskers ' and undertail patch, and white underparts are other diagnostic features. Sexes alike."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Somewhat smaller and slimmer than the Myna. (8"""")."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

P. j. jocosus P. j. fuscicaudatus P. j. abuensis P. j. pyrrhotis P. j. emeria P. j. whistleri P. j. monticola P. j. pattani P. j. peguensis
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Forest edge and clearings, second-growth woodland, brushy areas, cultivated lands, villages, suburban residential areas (AOU 1983). Suburbs and parklands of Miami area in Florida. Nests in shrub, small tree, or vine, usually in twig fork, 0.5-2.5 m above ground (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

In gardens and open scrub country.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly fruits, also flowers, buds, nectar, seeds, and some insects. Fruits of "Brazilian pepper tree" important in Florida. (Terres 1980). Nestlings initially fed soft-bodied insects and caterpillars, later berries and fruits.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The Red-whiskered Bulbul is another of the more familiar birds of our gardens and countryside, being found wherever trees afford the prospect of food and shelter, not uncommonly in the heart of noisy cities. Its joyous, querulous notes may be heard at all hours of the day. The birds go about in pairs, """"but numbers will collect at some tree or shrub in fruit. Their diet consists principally of berries— those of the Lantana being a favourite— but they also devour a considerable number of spiders, insects and caterpillars."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs have been recorded in March in Florida; nests January-August in Hawaii. Clutch size is 2-4 (usually 3); 2-3 broods per year in India. Incubation, by both sexes, lasts 12-14 days. Young are tended by both parents, leave nest at about 13 days, independent at 3 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Nests may be found at all seasons of the year, but chiefly from February to August. The nest, like that of the Red-vented Bulbul, is a compact cup made of rootlets, fine twigs and grass. Casuarina needles are utilised where available. The site selected is usually some low tree, shrub or hedge in a garden or in scrub country, there being little effort at concealment. Occasionally it is placed in the thatch or palm-leaf walls and roofs of huts, the birds sitting complacently on the eggs or feeding the young within a few inches of the inmates. The eggs—two to four in number—are very similar to those of the last species. Both sexes share in next building, incubation and care of the young. The incubation period is 15-16 days. Two, or even three, broods are frequently raised or attempted in succession, the casualty among the eggs and young being amazingly heavy."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pycnonotus jocosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGCGCATGAGCCGGGATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGCGCTCTTCTAGGAGATGATCAAATCTACAATGTAGTAGTCACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTCATACCAATCATAATTGGCGGATTTGGAAACTGACTAGTACCCCTAATAATTGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGGCTACTTCCCCCATCTTTCCTCCTACTACTAGCCTCATCCACAGTGGAAGCAGGAGCTGGAACAGGTTGAACCGTGTACCCACCACTGGCTGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACTTAGCAGGTATCTCCTCAATCTTAGGAGCAATTAACTTTATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTTGTATGATCCGTCTTAATCACTGCAGTCCTACTTCTCCTGTCCCTTCCAGTTCTTGCAGCTGGTATTACCATGCTACTCACCGACCGTAACCTTAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCAGTACTATACCAACACCTTTTCTGATTTTTCGGTCATCCAGAAGTCTATATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pycnonotus jocosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Least Concern ver 3.1
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common in many areas, abundant in south and west India and very common in Hong Kong (del Hoyo et al. 2005). National population sizes have been estimated at c.10,000-100,000 breeding pairs in China and c.100-10,000 introduced breeding pairs in Japan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-whiskered bulbul

The red-whiskered bulbul (Pycnonotus jocosus) is a passerine bird found in Asia. It is a member of the bulbul family. It is a resident frugivore found mainly in tropical Asia. It has been introduced in many tropical areas of the world where populations have established themselves. It feeds on fruits and small insects and they conspicuously perch on trees and their calls are a loud three or four note call. The distinctive crest and the red-vent and whiskers makes them easy to identify. They are very common in hill forests and urban gardens within its range.

Taxonomy[edit]

The red-whiskered bulbul was one of the many species originally described by Carl Linnaeus in 1758 in his Systema Naturae. He placed it along with the shrikes under Lanius.

Local names include Turaha pigli-pitta in Telugu, Sipahi bulbul in Bengali, Krong-hua-juk (กรงหัวจุก) in Thai, and Phari-bulbul or Kanera bulbu in Hindi.[2]

Subspecies[edit]

The populations found across their range show a range of plumage variations and some of these are recognized as subspecies:[3][4]

  • jocosus, the nominate form is found in Hong Kong[5]
  • fuscicaudatus of peninsular India has nearly complete breast band and no white tip to tail
  • abuensis of northwestern India (type locality Mount Abu[6]) is pale and has a broken breast band and no white tip to tail
  • pyrrhotis of the terai is pale above with white tail tips and widely separated breast band
  • emeria of Eastern peninsula and Ganges Delta is warm brown above with a slim bill and a long crest (also introduced into Florida[7])
  • whistleri is found in the Andaman Islands and has a warm brown above, a heavier bill and a shorter crest than emeria
  • monticola is found in northeastern India and has darker upperparts than pyrrhotis
  • pattani is found in Thailand
  • peguensis not always recognized was described from southern Burma[8]

Description[edit]

The red-whiskered bulbul is about 20 centimetres (7.9 in) in length. It has brown upper-parts and whitish underparts with buff flanks and a dark spur running onto the breast at shoulder level. It has a tall pointed black crest, red face patch and thin black moustachial line. The tail is long and brown with white terminal feather tips, but the vent area is red.

The loud and evocative call is a sharp kink-a-joo (also transcribed as pettigrew or kick-pettigrew or pleased to meet you[3]) and the song is a scolding chatter. It is more often heard than seen, but will often perch conspicuously especially in the mornings when they call from the tops of trees. The life span is about 11 years.[9]

Hybrids have been noted in captivity with Pycnonotus cafer, Pycnonotus leucotis, Pycnonotus xanthopygos, Pycnonotus melanicterus and Pycnonotus leucogenys[10] and leucism has been recorded.[11] Several avian malaria parasites have been described from the species.[12]

Distribution and habitat[edit]

Immature of race emeria from Kolkata

This is a bird of lightly wooded areas, more open country with bushes and shrubs, and farmland. Irruptions have been noted from early times with Thomas C. Jerdon noting that they "periodically visiting Madras and other wooded towns in large flocks."[2]

It has established itself in Australia, Los Angeles, Hawaii,[13] and Florida[14] in the United States, and in the Mauritius, Assumption Island[15] and Mascarene Islands.[16][17] In Florida, it is only found in a small area, and its population could be extirpated easily.[18]

The red-whiskered bulbul was introduced by the Zoological and Acclimatization Society in 1880 to Sydney, and became well established across the suburbs by 1920, and continued to spread slowly to around 100 km away. It is now also found in suburban Melbourne and Adelaide, although it is unclear how they got there.[19]

Behaviour and ecology[edit]

Nest
Red-whiskered bulbul, at Mauritius

The red-whiskered bulbul feeds on fruits (including those of Cascabela thevetia that are toxic to mammals), nectar and insects.[20]

The breeding season is spread out and peaks from December to May in southern India and March to October in northern India.[4] Breeding may occur once or twice a year.[21] The courtship display of the male involves head bowing, spreading the tail and drooping wings.[21] The nest is cup-shaped, and is built on bushes, thatched walls or small trees. It is woven of fine twigs, roots, and grasses, and embellished with large objects such as bark strips, paper, or plastic bags.[18] Clutches typically contain two to three eggs.[21] Adults (possibly the female[3]) may feign injury to distract potential predators away from the nest.[21][22] The eggs have a pale mauve ground colour with speckles becoming blotches towards the broad end. Eggs measure 21 mm and are 16 mm wide.[23] Eggs take 12 days to hatch. Both parents take part in raising the young. Young birds are fed on caterpillars and insects which are replaced by fruits and berries as they mature.[3] The chicks are psilopaedic (having down only in the pterylae).[7] Eggs and chicks may be preyed on by the greater coucal, Calotes versicolor, and crows.[3]

They defend territories of about 3,000 square metres (32,000 sq ft) during the breeding season.[24] They roost communally in loose groups of hundred or more birds.[25][26]

On the island of Réunion, this species established itself and also aided the spread of alien plant species such as Rubus alceifolius. In Florida they feed on fruits and berries of as many as 24 exotic plants including loquat (Eriobotrya japonica), Lantana spp., Brazilian pepper (Schinus terebinthifolius) and figs (Ficus).[27] In Mauritius they aid the dispersal of Ligustrum robustum and Clidemia hirta. Seeds that pass through their gut germinate better.[28] Populations of the red-whiskered bulbul on the island of Reunion have diversified in the course of thirty years and show visible variations in bill morphology according to the food resources that they have adapted to utilize.[29]

Relationship with humans[edit]

This species was once a popular cagebird in parts of India. C. W. Smith noted[30] that

These birds are in great request among the natives, being of a fearless disposition, and easily reclaimed. They are taught to sit on the hand, and numbers may thus be seen in any Indian bazaar.

The species continues to be a popular cagebird in parts of Southeast Asia.[16]

References[edit]

  1. ^ BirdLife International (2012). "Pycnonotus jocosus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Jerdon, TC (1863). The Birds of India. Volume 2, part 1. Military Orphan Press, Calcutta. pp. 92–93. 
  3. ^ a b c d e Ali, S. and Ripley, S. D. (1996). Handbook of the birds of India and Pakistan 6 (2 ed.). Oxford University Press. pp. 75–80. 
  4. ^ a b Rasmussen, PC and Anderton, JC (2005). Birds of South Asia: The Ripley Guide. Smithsonian Institution and Lynx Edicions. 
  5. ^ Dickinson, E.C. & R.W.R.J. Dekker (2002). "Systematic notes on Asian birds. 25. A preliminary review of the Pycnonotidae." (PDF). Zool. Verh. Leiden 340: 93–114. 
  6. ^ Whistler, H. (1931). "Description of new races". Bull. Brit. Orn. Club 52: 40–41. 
  7. ^ a b Carleton, Alison Rand and Owre, Oscar T (1975). "The Red-whiskered Bulbul in Florida:1960–71" (PDF). Auk 92 (1): 40–57. doi:10.2307/4084416. 
  8. ^ Dickinson, E. C.; Dekker, R.W. R. J. (2002). "Systematic notes on Asian birds. 25. A preliminary review of the Pycnonotidae." (PDF). Zool. Verh. Leiden 340: 93–114. 
  9. ^ Brown, C. Emerson (1928). "Longevity of birds in captivity" (PDF). The Auk 45 (3): 345–348. doi:10.2307/4076026. 
  10. ^ McCarthy, Eugene M. (2006). Handbook of Avian Hybrids of the World. Oxford University Press. pp. 257–258. ISBN 0-19-518323-1. 
  11. ^ Law, S. C. (1921). "An albinoid Otocompsa emeria". J. Bombay Nat. Hist. Soc. 28 (1): 281–282. 
  12. ^ Peirce, M. A. (1984). "Haematozoa of Zambian birds IX. Redescription of Haemoproteus otocompsae, a parasite of Pycnonotidae". Journal of Natural History 18 (6): 965. doi:10.1080/00222938400770841. 
  13. ^ Van Riper, Charles, III; Van Riper, Sandra G.; Berger, Andrew J. (1979). "The Red-Whiskered Bulbul in Hawaii" (PDF). The Wilson Bulletin 91 (2): 323–328. 
  14. ^ Rand, Alison C. (1980). Factors responsible for the successful establishment of exotic avian species in southeastern Florida in Proceedings of the 9th Vertebrate Pest Conference. University of Nebraska, Lincoln. 
  15. ^ Prys-Jones, RP, MS Prys-Jones & JC Lawley (1981). "The birds of Assumption Island, Indian Ocean: Past and future" (PDF). Atoll Research Bulletin 248. doi:10.5479/si.00775630.248.1. Archived from the original on 13 September 2006. 
  16. ^ a b Philippe, Clergeau; Mandon-Dalger, Isabella (2001). "Fast Colonization of an Introduced Bird: the Case of Pycnonotus jocosus on the Mascarene Islands". Biotropica 33 (3): 542–546. doi:10.1111/j.1744-7429.2001.tb00210.x. 
  17. ^ Rand, Alison C. (1980). Factors responsible for the successful establishment of exotic avian species in southeastern Florida in Proceedings of the 9th Vertebrate Pest Conference (1980). University of Nebraska, Lincoln. 
  18. ^ a b Rising, James D. (2001). "Bulbuls". In Elphick, Chris; Dunning, John B., Jr.; Sibley, David Allen. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf. pp. 448–449. ISBN 978-1-4000-4386-6. 
  19. ^ Long, John L. (1981). Introduced Birds of the World: The worldwide history, distribution and influence of birds introduced to new environments. Terrey Hills, Sydney: Reed. p. 298. ISBN 0-589-50260-3. 
  20. ^ Raj, PJ Sanjeeva (1963). "Additions to the list of birds eating the fruit of Yellow Oleander (Thevetia neriifolia )". J. Bombay Nat. Hist. Soc. 60 (2): 457–458. 
  21. ^ a b c d Begbie, Arundel (1908). "Note on the habits of the Bengal Red-whiskered Bulbul Otocompsa emeria". J. Bombay Nat. Hist. Soc. 18 (3): 680. 
  22. ^ Aitken, E.H. (1901). "Artifices practised by bulbuls". Journal of the Bombay Natural History Society 14: 162–163. 
  23. ^ Herklots GAC (1934). "The Birds of Hong Kong. Part XIV. The Bulbuls" (PDF). Hong Kong Naturalist 5 (1): 1–5. 
  24. ^ Sotthibandhu, S. (2003). "Territorial defense of the red-whiskered bulbul, Pycnonotus jocosus (Pycnonotidae), in a semi-wild habitat of the bird farm" (PDF). Songklanakarin J. Sci. Technol. 25 (5): 553–563. 
  25. ^ De, G (1976). "Communal roosting of Redwhiskered Bulbuls". Newsletter for Birdwatchers 16 (4): 11–12. 
  26. ^ Neelakantan, K. K. (1976). "Communal roosting in the Redwhiskered Bulbul". Newsletter for Birdwatchers 16 (2): 4–5. 
  27. ^ Daniel Simberloff & Betsy Von Holle (1999). "Positive interactions of nonindigenous species: invasional meltdown?" (PDF). Biological Invasions 1: 21–32. doi:10.1023/A:1010086329619. 
  28. ^ Linnebjerg, JF; DM Hansen; JM Olesen (2009). "Gut passage effect of the introduced red-whiskered bulbul (Pycnonotus jocosus) on germination of invasive plant species in Mauritius". Austral Ecology 34 (3): 272–277. doi:10.1111/j.1442-9993.2008.01928.x. 
  29. ^ Amiot, Christophe; Lorvelec, Olivier; Mandon-Dalger, Isabelle; Sardella, Antonia; Lequilliec, Patricia; Clergeau, Philippe (2007). "Rapid morphological divergence of introduced Red-whiskered Bulbuls Pycnonotus jocosus in contrasting environments". Ibis 149 (3): 482–489. doi:10.1111/j.1474-919X.2007.00671.x. 
  30. ^ Smith, C. W. Journal of the Asiatic Society of Bengal X.: 640. 

Other sources[edit]

  • Deignan, H. G. (1948) The races of the Red-whiskered Bulbul, Pycnonotus jocosus (Linnaeus). J. Washington Acad. Sci. 38(8), 279–281.
  • Fraser, F. C. (1930) Note on the nesting habits of the Southern Red-whiskered Bulbul (Otocompsa emeria fuscicaudata). J. Bombay Nat. Hist. Soc. 34(1), 250–252.
  • Michael, Bindhu; Amrithraj, M.; Pillai, K. Madhavan (1997). "A note on Isospora infection in a Southern Redwhiskered Bulbul (Pycnonotus jocosus fuscicaudatus)". Zoos' Print 12 (12): 5. 
  • Kinloch, A. P. (1922). "Nidification of the Southern Redwhiskered Bulbul Otocompsa emeria fuscicaudata". Journal of the Bombay Natural History Society 28 (2): 545. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!