Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Progne subis

A large (7 ¼ -8 ½ inches) swallow, the male Purple Martin is most easily identified by its large size, dark purple-black body, and notched tail. Female Purple Martins are purplish gray above and pale below with streaking on the breast. While the male is unmistakable in North America, the female resembles other pale breasted swallows, although it is generally much larger. On migration and during the winter, both sexes may be confused with other species of martin occurring in the American tropics. The Purple Martin breeds across much of the eastern United States and southern Canada. Other populations breed on the Pacific coast from California to British Columbia, in the interior west, and in western Mexico. This species is a long-distance migrant, wintering primarily in Bolivia and southern Brazil. Purple Martins historically bred along forest edges near water, nesting in old woodpecker holes in dead trees. Today, almost all Purple Martins, particularly those breeding in the east, nest in man-made nest boxes in urban or suburban areas. In winter, this species is found foraging over open savannah and fields, roosting in trees or buildings nearby. Purple Martins exclusively eat flying insects. In the Purple Martin’s breeding range, the easiest way to find this species is to look for the large, white, pole-mounted nest boxes in which Purple Martins prefer to nest. While foraging, this species may be seen swooping over ponds, lakes, and open country while catching insects in flight. Purple Martins are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: west of Cascades and Sierra Nevada from southwestern British Columbia south to northwestern Mexico and Arizona; east of Rocky Mountains from northeastern British Columbia, central Alberta, east through northern Minnesota, northern Wisconsin, southern Ontario, to Nova Scotia, south to Gulf coast and southern Florida. NON-BREEDING: locally from northern South America south to northern Bolivia, northern Argentina, and southern Brazil, east of Andes; apparently mainly in southern Brazil (Hilty and Brown 1986, Stiles and Skutch 1989, Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The Purple Martin can be found throughout nearly the entire United States east of the Rocky Mountains. Although declining in many western states, it is also found in isolated areas in Canada, Oregon, Washington, California, Utah, Colorado, Arizona, New Mexico and Mexico. The bird is an early spring migrant returning from its winter grounds in South America.

(National Geographic 1999)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Progne subis, commonly known as purple martins, inhabit the Nearctic region and can be found across North and South America. Progne subis is a migratory species that breeds in North and Central America and overwinters in South America. The northern extent of the breeding range includes the Canadian Territories of Alberta, Saskatchewan, and southern Manitoba. Purple martins breed across the eastern half of the United States, and also may be found along the Pacific coastline including the entire Baja Peninsula.

Purple martins overwinter across most of South America including the countries of Colombia, Venezuela, Guyana, Suriname, Ecuador, Peru, Brazil, Bolivia, Paraguay and Argentina. Their winter range has been recorded to be South American lowlands anywhere east of the Andes Mountains. Concentrated populations have been found to winter in Bolivia and some provinces of Brazil. There have been some records of purple martin populations found in the British Isles, but these birds rarely migrate outside of the Americas.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Brauning, D. 1992. Atlas of Breeding Birds in Pennsylvania. Pittsburgh: University of Pittsburgh Press.
  • Brown, C. 1997. Birds Of North America. Philadelphia, PA: The American Ornithologists/ Union and The Academy of Natural Sciences.
  • Johnston, R. 1966. The Adaptive Basis of Geographic Variation in Color of The Purple Martin. The Condor, 68/3: "219-228". Accessed November 07, 2010 at http://www.jstor.org/stable/1365555.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Full grown Purple Martins average eight inches in length. Mature males are dark colored birds with purple glossy feathers. The females and juvenile birds are mostly gray with white patches on the breast and stomach. The head, nape and rump tend to be slightly darker. In their first spring, males resemble females but often show some purple coloration. Purple Martins have similar body shape to other swallows but tend to be larger. In flight they resemble the European Starling, but have a forked tail and longer wings. Also, the birds fly like typical swallows with short glides alternating with very rapid flapping.

(National Geographic 1999)

Average mass: 45 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Purple martins have an average body mass of 56 g. They have a wingspan of 45.7 cm long and an average body length of 20.3 cm.

Progne subis exhibits distinct sexual dimorphism. Males and females differ slightly in size, where the males tend to be a bit larger than the females. Males are entirely shiny, deep purple or almost black in coloration. Purple martin males have less shine on their blackish wings and tails compared to their heads and backs. Females are overall gray or gray-blue with darker wings and crown feathers, and feature a white breast smudged with varying degrees of gray. Western females are overall paler than eastern.

Juvenile purple martins are overall gray to black with a white belly and gray-streaked breast. In juveniles, there is a much clearer line between their gray throats and white bellies compared to females which will have a primarily gray belly. In flight, a juvenile's tail may have a narrow, slight fork whereas adult tails are distinctly forked and wider.

Purple martins have a dark, black-brown bill and the average length is 8.2 mm for males and 8.5 mm for females. Their gape tends to be yellow in young birds and a dull orangey-brown color in adults. Their legs and feet have a black brown coloration and their eyes are dark brown.

Populations residing in the southwest United States exhibit lighter coloration than purple martins in other regions. This lighter coloration is hypothesized to be an adaptation to the desert climate and serves to absorb less heat.

Range mass: 10 to 55 g.

Average mass: 48 g.

Range length: 18 to 22 cm.

Average length: 20.3 cm.

Range wingspan: 39 to 43 cm.

Range basal metabolic rate: 2.6 KJ*g^-1*day^-1 to 4.0 KJ*g^-1*day^-1 cm^3 oxygen/hour.

Average basal metabolic rate: 3.0 KJ*g^-1*day^-1 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

  • Layton, R. 1972. The Purple Martin. Jackson, Missisippi: Nature Books Publishers.
  • Wade, J. 1966. What You Should Know About The Purple Martin. Griggsville, Illinois: J. L. Wade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 20 cm

Weight: 49 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: A wide variety of open and partly open situations, frequently near water or around towns (Subtropical and Temperate zones, in winter also Tropical Zone) (AOU 1983). South America: congregates in roosts in city plazas and parks (Ridgely and Tudor 1989). In west and formerly in east nests in tree cavities, abandoned woodpecker holes (including those in saguaro cacti), crevices in rocks; in east and midwest now nests in bird-houses and gourds put up by humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Generally, Purple Martins inhabit open areas and prefer an open water source nearby. Martins adapt well in and around people, but are out competed by starlings and sparrows in urban areas. The birds like open spaces to maximize the effectiveness of their incredible flying ability. Having water nearby helps support plentiful insects for food.

(PMCA 2001)

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Progne subis prefer open spaces that are situated close to any water source, as they are insectivores and are attracted to the large populations of insects near wetlands, swamps, and wet meadows. Purple martins also seem to avoid high elevations, for instance the Appalachian Mountains, but may be found at elevations from less than 100 m to 4,000 m. Due to colonization and human interactions in their natural habitats, purple martins are now accustomed to human interaction and live in close proximity with humans today. They tend to find shelter in urban settlements, often living in specially made birdhouses called "martin houses". Historically, this species inhabited forest edges, montane forests, and deserts and nested in abandoned woodpecker cavities. Some populations that breed in the western United States continue to live in these natural settings, however most utilize man-made martin houses.

During migration, these birds stopover in a variety of habitats. They usually fly over coastal lines and cross the Gulf of Mexico. They have been recorded in lowlands and the high mountain ranges of Venezuela and Columbia. They are often seen in cities and open areas while migrating south.

Wintering habitats include rainforests, agricultural areas, and clearings of South America. They may also reside in urban plazas.

Range elevation: <100 to 4000 m.

Average elevation: 2600 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates mainly along coast. Arrives in southern U.S. by early February (January in southern Florida), northern states and southern Canada in April (Morton and Derrickson 1990). Migrates through Costa Rica August to mid-October and late January-April (Stiles and Skutch 1989). Present in South America mostly September-March (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Catches insects in the air; occasionally forages by walking along the ground. Eats ants, wasps, beetles, grasshoppers, dragonflies, etc. Forages often over fields, water, or marshes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Purple Martins only eat flying insects that they catch while in flight. Martins have a diverse diet, which includes: dragonflies, moths, bees, junebugs, flying ants, butterflies, and many more. They do not eat mosquitoes however, as some people like to believe. Martins are extremely agile and fast fliers, which aids them in their quest for food. They normally fly at 45 mph or more. The limitations of their diet and foraging technique leave them at risk of starvation if bad weather persists for three days or more in a row. Heavy rain or cold temperatures are often lethal causing high casualties of Purple Martins.

(PMCA 2001, Coates Manufacturing)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Purple martins are primarily insectivores. They capture food in flight and rarely glean insects from foliage or the ground. Purple martins prefer eating fruit flies Ceratitis, mosquitoes Culicidae, wasps Polistes, beetles Coleoptera, ants Formicidae, grasshoppers Orthoptera, cicadas Cicadidae as well as dragonflies Anisoptera. Purple martins may consume 400 flies or 2000 mosquitoes in a day. Young purple martins prefer eating dragonflies over other insects while adults show no specific preference to dragonflies.

Purple martins rarely eat spiders Araneida and prefer any other insect instead. Generally purple martin diets consists of 23% wasps and bees (Hymenoptera), 16% flies, 15% assorted bugs like stink bugs (Pentatomidae) and black bugs (Thyreocoridae), and 12% were beetles (Onthophagus). Purple martins also eat butterflies and moths (Lepidoptera) but dragonflies seem to be preferred.

Purple martins are greatly dependent on the weather, since it has a profound effect on insect populations. At low temperatures insect food sources tend to decrease, where as at high temperature purple martins have an abundance of food. High velocity winds also decrease food availability. Purple martins tend to eat beetles throughout all the seasons, but flies tend to disappear from their diet in late August. Insect populations tend to be at its highest during August which coincides with greater nutritional need in preparation for fall migration. It is during August that purple martins must hoard up food and nutrients for the long flight back south. These birds consume water in flight by skimming any water source.

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Purple martins play roles as predator, prey, competitor, and host. Purple martins are insectivorous and are known to be effective pest controllers. Purple martins are preyed upon by many species and also serve as a host to several species of parasites. Purple martin populations have been greatly affected by mite parasites, specifically Dermanyssus prognephilus that live inside their nests. These blood-feeding parasites are able to decrease clutch size and an outbreak may lead to colony abandonment. Other parasites include ticks, beetles, louseflies, fleas, and bowflies.

Purple martins have to compete for nesting sites with house sparrows and European starlings. Starlings often corner purple martins in their own nest cavities where fighting results and often ends in death. This competition is particularly unfortunate, as both house sparrows and European starlings are invasive species in the United States and often out-compete native purple martins for nesting habitat.

Commensal/Parasitic Species:

  • Moss, W., J. Camin. 1970. Nest Parasitism, Productivity, and Clutch Size in Purple Martins. Science, 168/3934: "1000-1003".
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The most common predators for purple martins are owls and snakes which prey on both adults and juveniles. Owls attack while the birds are inside the nest. Owls grab the nest and shake it, which disorientates the purple martin. The bird then tries to slip out of the entrance hole where the owl grabs it with its claw. Humans can help prevent these owl attacks by attaching curved rods over nest entrances so that owls cannot perch atop the martin houses. Owls have also been known to reach their claws into martin houses to grab any unfortunate purple martin.

Predators like snakes or raccoons are able to climb the bird house poles and make their way to the entrance cavities. They pull out any adult birds and then proceed to eat the eggs. The snakes that tend to prey on purple martins are usually non-poisonous and often climb up the poles and eat both the eggs and young. Rat snakes are the most common snake predators. Hawks and blue herons are the only two predators that prey on purple martins in the air. Domestic cats prey on purple martins when they are on the ground in search of nesting material. Squirrels also prey on purple martins by climbing up the nest and entering the cavity. The squirrel then kills the young, breaks up all the eggs and can even occupy the nest to raise its own young.

One anti-predation behavior shown by purple martins is vigilant nest cleaning. Purple martin parents will eat fecal sacs and encourage juvenile birds to defecate by poking at their cloacal region. The feces will be either consumed or removed from the nest by dropping them outside. The elimination of feces and fecal sacs allows for protection, since the scent trails would be removed.

Purple martins respond to predator attacks by sending the 'zweet' call. 'Zweet' calls are used to warn other purple martins of the threat or to encourage them to fly away. Purple martins often dive bomb their attacker. Purple martin colonies have no coordinated response to predators. They do not all attack the predator but do assemble as a crowd to confuse predators and make it difficult to focus on one bird. The only birds that do attack the predator are the owners of a threatened nest. Purple martins will generally stay out of the predator’s way unless the predator comes within a few meters of their nest and young. Then purple martin adults have been known to attack the predator. Purple martins benefit from living in large colonies, because it adds to their protection and stability. Large colonies are able to detect predators faster, thereby decreasing predation.

Known Predators:

  • Davis, J., C. Brown. 1999. Costs Of Coloniality And The Effect Of Colony Size On Reproductive Success In Purple Martins. The Condor, 101/4: "737-745". Accessed September 16, 2010 at http://www.jstor.org/stable/1370060.
  • Kostka, K. 2000. Owl Guards for Gourds: A Way to Protect Martin Gourds from Aerial Predators. Purple Martin Update, 9/4: "1".
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

During spring and summer populations periodically decimated due to prolonged cold, wet weather, and lack of insect food. Often local in distribution. Forms large roosting flocks at night after nesting season and before southward migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Progne subis communicates vocally and visually. Purple martins have eleven identified vocalizations that they use for different occasions like mating, warning, and teaching the young during fledging. Male purple martins use singing and visual displays to attract potential female mates. Juvenile purple martins resort to ‘choo-choo’ calls to attract their parents’ attention if protection is needed. Parents use juvenile 'choo-choo' calls to assemble their broods and return them safely to the nest. Female purple martins use the ‘choo’ call to lead their young to and from groupings areas during the fledging period. Purple martins only resort to ‘zwarck’ calls when they need to send a high intensity alarm, and it is often accompanied by the birds diving straight down towards the invader. Male purple martins use ‘hee-hee’ vocalizations to fight off intruders. ‘Zweet’ calls are used to show intraspecific excitement, as well as send an alarm to warn other purple martins of a potential threat and to encourage them to fly away. Purple martins use ‘cher’ calls to communicate daily and will use ‘chortle’ calls in high excitement situations. Males attract females by singing ‘croak songs’ as well as to warn off unmated males from entering their territory. During courtship males make a clicking sound by snapping their lower and upper mandibles together. The last vocalization male purple martins use are ‘subsongs’ and are heard during feeding and pre-migratory periods. ‘Subsongs’ are used to communicate with other purple martins while socializing together. Purple martin males that are part of a stable colony often perform a 'dawnsong' which include a variety of sounds early in the morning.

Communication Channels: visual ; acoustic

Other Communication Modes: duets ; choruses

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
165 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The longevity of purple martins range from 0 to 13 years and nine months. Purple martin mortality is often the result of severe weather. Three to four days of severe weather can lead to insect numbers drastically declining. If there is a lack of food, purple martins cannot survive and this often results in population decline. Another hindrance to long life expectancy is often body parasites. Purple martins host a protozoan blood parasite Haemoproteus prognei. This parasite can have disastrous effects on the surviving rate of first year birds during the winter and migration period.

Range lifespan

Status: wild:
13.75 (high) years.

Average lifespan

Status: wild:
165 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In southern Arizona, eggs are laid in July (Stutchbury 1991). Mating system involves monogamous pairing with extrapair fertilizations by older males. Clutch size is 3-8 (usually 4-5). Incubation lasts 15-16 days, by female. Male guards nest when females goes off to feed. Young are tended by both adults, leave nest 24-28 days after hatching (Harrison 1978), return to nest to roost for a few days after fledging. Usually 1, sometimes 2 broods per season (also reported as only 1 nesting per year). Depending on the location, a few or many of the breeding males are one-year-olds. Most individuals breed for 2-3 seasons. Usually nests in colonies in east and midwest. In natural sites, breeds in single pairs or small groups.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Purple Martins are colonial nesters and are very dependent on man-made nest houses. Once established at a nest location, martins usually come back every year to the same site. The Purple Martin only nests in cavities, often in abandoned woodpecker holes, but today most of the birds use man-made nest boxes. Martins are now entirely dependent on human supplied housing east of the Rockies. Although birds in colonies face increased risk of parasites, and increased competition for resources, reproductive success is not highly dependent on colony size. Males compete for nest sites within the colony. Although there is a lot of physical contact during fights, birds are rarely injured severely. Females are also known to fight over nest sites. The larger the colony, the more the birds fight over territory. After a nest site is chosen and the birds have formed pairs, the male religiously follows the female everywhere. The pair bond is monogamous and both parents build the nest out of grass, twigs and mud. Average clutch size is two to seven eggs and the female incubates them for fifteen days. Both parents feed the young for about one month. The young remain dependent for a few more weeks after fledging during which time they learn to forage by following the parents.

(PMCA 2001, Copley et al. 1999, Davis and Brown 1999, Russell and Gauthreaux 1999)

Average time to hatching: 15 days.

Average eggs per season: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Purple martins are socially monogamous, but form a pair bond that rarely extends to subsequent seasons. In Texas, 5% of purple martins that occupied more than one nest practiced polygamy. Males arrive at the breeding grounds first and will select nest cavities where he will display to potential mates. The male often selects two nest sites for females to choose from. Males are very territorial and will aggressively defend nest sites from other males. Unpaired males will perform an aerial display to any nearby female. This display begins with the male flying out from his nest in a wide arc, then swooping back into the cavity, popping out his head and singing. Research has suggested that despite these efforts, females are more interested in the quality of a nest site than a male's displaying ability. Once a pair has formed, the male defends the nest cavity as well as his mate. Although the pair is aggressive towards foreign intruders, they tolerate each other and will continue to tolerate each other in subsequent years even when they are paired with other mates.

Mating System: monogamous

Generally purple martins spend their winters in South America just past the Andes, and start returning to their northern breeding grounds as early as January 1. They slowly move northwards progressing generally 3 to 5 degrees latitude (330 to to 550 km) every half a month and they reach their northern limits around May 1. Adult males often return first, followed shortly by adult females while sub-adults return a couple weeks after. This general breeding pattern has been found to be true for a generalized population, except the non-colonial Saguaro desert broods. These purple martins arrive early May, which is about two and a half months later than any other colony at the same latitude. Reasons for the difference in arrival patterns have not yet been discovered.

After a pair bond is formed, the martins can start building a nest. Nest building starts about a month before the pair intends to lay the eggs. Common materials used to build nests are green leaves, grass, sticks, paper, mud, and feathers. The use of green leaves as nesting materials is poorly understood, but there are currently many hypotheses. The female performs most of the construction, while the male gathers materials and defends the cavity from other martins. Historically, purple martins used natural cavities to nest in but due to deforestation and the removal of dead snags, these birds mostly nest within man-made "martin houses" that support their colonial lifestyle.

The breeding season for Progne subis starts in May and will last until June. A purple martin nest can have anywhere from 3 to 8 white, oval eggs but the average amount of eggs laid is 5. These eggs are usually about 2.4 by 1.7 cm in size and are then incubated for 15 to 18 days. The chicks fledge after 26 to 31 days and travel in a family group. The group returns to sleep at the nest for several days. At 7 to 10 days after fledging the young are able to survive on their own and will disperse. Young purple martins can reproduce in the first subsequent breeding season.

Breeding interval: Purple martins generally breed once yearly.

Breeding season: Purple martin breeding season occurs during the months of May and June.

Range eggs per season: 3 to 8.

Average eggs per season: 4 to 5.

Range time to hatching: 15 to 18 days.

Range birth mass: 2.8 (low) g.

Range fledging age: 26 to 31 days.

Range time to independence: 33 to 41 days.

Average age at sexual or reproductive maturity (female): <1 years.

Average age at sexual or reproductive maturity (male): <1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

After the eggs are laid, the female is the primary incubator. Incubation lasts from 15 to 18 days. When the female leaves the nest, the male will proceed in incubating the eggs himself but this happens infrequently. As soon as the chicks hatch, brooding begins and usually lasts until the tenth day. The female alone broods the young. Purple martin chicks are altricial and are completely dependent upon the parents for survival.

The young are fed within hours of hatching and will continue to be fed for 5 to 7 days after the young fledge. Both the male and female feed the brood. Feeding occurs by regurgitating food and transferring it into the mouths of the young one by one. As the brood gets older the feeding sessions become more frequent and reaches its peak when the young start gaining the most weight, which occurs around days 17 to 21. The feeding becomes so regular that it may occur every 30 seconds. Parents ensure that the food is the proper size to be swallowed and if the pieces are too large and swallowing does not occur instantly, the food is removed from their mouths. After two weeks of development the female purple martin will cease to sleep in the same compartment as the nestlings, because less frequent night brooding is necessary.

Parents also play an important role in keeping the nest clean. The parents will eat the fecal sacs and will encourage the young to defecate by poking at their cloacal region.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Alsop III, F. 2002. Purple Martin. Pp. "464" in R Greenberg, J Hamilton, eds. Birds of Canada, Vol. I, 1st Edition. Toronto Ont.: Southern lights Custom Publishing.
  • Brauning, D. 1992. Atlas of Breeding Birds in Pennsylvania. Pittsburgh: University of Pittsburgh Press.
  • Brown, C. 1978. Post-Fledging Behavior of Purple Martins. The Wilson Bulletin, 90/3: "376-385". Accessed November 01, 2010 at http://www.jstor.org/stable/4161087.
  • Brown, C. 1980. Sleeping Behavior of Purple Martins. The Condor, 82/2: "170-175". Accessed November 01, 2010 at http://www.jstor.org/stable/1367472.
  • Brown, C. 1979. Territoriality in the Purple Martin. The Wilson Bulletin, 91/4: "583-593". Accessed November 01, 2010 at http://www.jstor.org/stable/4161272.
  • Brown, C. 1997. Birds Of North America. Philadelphia, PA: The American Ornithologists/ Union and The Academy of Natural Sciences.
  • Johnston, R., J. Hardy. 1962. Behavior of the Purple Martin. The Wilson Bulletin, Vol 64, No. 3: "243-262". Accessed September 25, 2010 at http://www.jstor.org/stable/4159068.
  • Layton, R. 1972. The Purple Martin. Jackson, Missisippi: Nature Books Publishers.
  • Morton, E., K. Derrickson. 1990. The Biological Significance Of Age-specific Return Schedules In Breeding Purple Martins. The Condor, 92: "1040-1050". Accessed September 25, 2010 at http://www.jstor.org/pss/1368740.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Progne subis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTAACCGATGATTATTCTCAACAAACCACAAAGATATCGGAACCCTATACCTAATTTTCGGCGCATGAGCAGGAATAGTGGGAACCTCACTCAGCCTCCTCATCCGAGCAGAACTAGGCCAGCCCGGCGCCCTCCTTGGTGACGACCAAATCTACAACGTAATCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATTGGGGGGTTCGGAAACTGACTAGTCCCCCTAATGATCGGTGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTTCTCCTAGCCTCCTCCACAGTAGAAGCAGGGGTAGGAACCGGCTGAACCGTCTACCCACCCCTAGCCGGGAACCTCGCCCACGCCGGCGCTTCCGTAGACCTAGCTATTTTCTCCCTACATCTAGCAGGGATCTCCTCAATCCTGGGGGCAATCAACTTCATCACCACAGCAATCAACATAAAACCCCCCGCCCTGTCACAATACCAAACCCCACTGTTCGTCTGATCAGTACTAATCACTGCAGTACTACTCCTTCTCTCACTCCCTGTACTAGCCGCCGGCATCACCATGCTACTAACAGACCGTAACCTTAACACCACCTTCTTCGACCCAGCCGGAGGAGGAGATCCAGTACTCTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTTCCAGGATTCGGAATCATCTCACATGTAGTAGCCTACTACGCCGGAAAGAAGGAGCCTTTTGGCTACATGGGGATAGTCTGAGCGATGCTCTCAATCGGCTTCCTAGGATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Progne subis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of Purple Martins have declined in many areas for two main reasons. One is the reduction of natural cavities due to logging and snag cutting. The second is competition from the English Sparrow and the European Starling, two invasive species who also nest in cavities. Over 1 million people in the United States have erected nest boxes with intentions of attracting Purple Martins, but most are unsuccessful. To successfully attract Martins, the nest box must be placed in an open area and periodically checked for invasive species. Because purple martins nest later than most other bird species, it has been suggested that martin houses are erected late in the season (timing dependent on latitude) so that these man-made cavities become available when they begin nesting. This also reduces the likelihood that martins would be competing with other species for these cavities at that time. Many people enjoy watching the spectacular agility of martins in flight, as well as listening to their pleasant song. Insect control benefits also prompt landowners to erect nest sites for Purple Martins.

(PMCA 2001, Copley et al. 1999)

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The IUCN Red List has listed Progne subis as least concern. The United States Federal list has enlisted Progne Subis as being a species of concern. Currently several groups are working on conserving the natural habitat of purple martins. Under the Michigan Special Animal list, Progne subis is under no danger. Overall, purple martins have stable population numbers and inhabit a wide geographical range. In Canada, purple martin populations have seen some decline, and are currently considered at risk in British Columbia. Local populations have suffered greatly from weather related mortalities in the northern edges of the breeding range. Purple martins are also declining due to the competition for nesting sites. Purple martins compete with invasive house sparrows and European starlings for nesting sites. Currently in British Columbia they are setting up special nesting boxes in the hope of sustaining the remaining population.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Fraser, D., C. Siddle, D. Copley, E. Walters. 1997. The Return of the Purple Martin in British Columbia. Wildlife Branch, British Columbia Ministry of Environment, Lands and Parks, 1: "279-282". Accessed November 07, 2010 at http://www.env.gov.bc.ca/wld/documents/ce07fraser2.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Populations have augmented by provision of nest boxes in some areas. See Mitchell (1988) for specifications for the construction and placement of nest boxes. See Bowditch (1990) for a description of predator guards (hardware cloth and PVC pipe) that deter crow and owl predation at martin houses. See Ginaven (1990) for information on using decoys to attract martins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of purple martins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans benefit largely from the insectivorous food habits of purple martins. Purple martins consume large quantities of pest species including flies, stink bugs, clover weevil beetles, and mosquitoes.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Purple martin

The purple martin (Progne subis) is the largest North American swallow. These aerial acrobats have speed and agility in flight, and when approaching their housing, will dive from the sky at great speeds with their wings tucked.

Description and taxonomy[edit]

Purple martins are a kind of swallow, of the genus Progne. Like other members of this genus, they are larger than most of the other swallows. The average length from bill to tail is 20 cm (7.9 in). Adults have a slightly forked tail. Adult males are entirely black with glossy steel blue sheen, the only swallow in North America with such coloration. Adult females are dark on top with some steel blue sheen, and lighter underparts. Subadult females look similar to adult females minus the steel blue sheen and browner on the back. Subadult males look very much like females, but solid black feathers emerge on their chest in a blotchy, random pattern as they molt to their adult plumage.[2]

This species was first described by Linnaeus in his Systema naturae in 1758 as Hirundo subis.[3] The species of this genus are very closely related, and some view the purple martin, gray-breasted martin, snowy-bellied martin, and southern martin, as a superspecies.[4]

Subspecies[edit]

  • P. s. subis, is the nominate form, with the typical features of the species, breeds in eastern and mid-western North America.
  • P. s. hesperia of the Mexico and the southwestern United States, is distinguished primarily by its nesting habits.
  • P. s. arboricola of western mountains is large with females paler on underparts.

Distribution and habitat[edit]

Fledglings in Oklahoma, United States

Purple martins' breeding range is throughout temperate North America. Their breeding habitat is open areas across eastern North America, and also some locations on the west coast from British Columbia to Mexico.[5] Martins make their nests in cavities, either natural or artificial. In many places, humans put up real or artificial hollow gourds, or houses for martins, especially in the east, where purple martins are almost entirely dependent on such structures. As a result, this subspecies typically breeds in colonies located in proximity to people, even within cities and towns. This makes their distribution patchy, as they are usually absent from areas where no nest sites are provided. Western birds often make use of natural cavities such as old woodpecker holes in trees or saguaro cacti.[2][4]

The purple martin migrates to the Amazon basin in winter. Its winter range extends into Ecuador[6] but does not seem to ascend far up the Andean foothills.

The first record of this species in Europe was a single bird on Lewis, Scotland, on 5–6 September 2004, and the second was on the Azores on 6 September 2004.

Conservation status[edit]

Adults around gourds and nest boxes in a garden in Tulsa, Oklahoma, United States
Nest boxes at Nepean Sailing Club in Nepean, Ontario, Canada

Purple martins suffered a severe population crash in the 20th century widely linked to the release and spread of European starlings in North America. Starlings and house sparrows compete with martins for nest cavities. Where purple martins once gathered by the thousands, by the 1980s they had all but disappeared. [7]

Relationship with humans[edit]

The population of eastern purple martins (nominate form P. s. subis) is dependent on artificial martin houses of wood or aluminum and fake plastic gourds, supplied by individuals and organizations fond of the bird. This tradition was in place even before the population crash; Native Americans are said to have hollowed out gourds and erected them for this purpose. The situation requires ongoing maintenance, as European starlings and house sparrows compete with martins as cavity-nesters, and will fight with martins over nest sites. Starlings have even been known to kill purple martins, especially nestling young, and house sparrows have been known to evict purple martins from their nests. Thus, unmonitored purple martin houses are often overtaken by more aggressive, non-native species.[2] Purple martin proponents are motivated by the concern that the purple martin would likely vanish from eastern North America were it not for this assistance.[8]

Behavior[edit]

Migration[edit]

Wintering in South America, purple martins migrate to North America in spring to breed. Spring migration is somewhat staggered, with arrivals in southern areas such as Florida and Texas in January, but showing up in the northern United States in April and in Canada as late as May. Males usually arrive at a site before females.[2]

Fall migration is also staggered, as birds head south when the breeding season is over. Some birds leave as early as July and others stay as late as October. Martins generally migrate over land, through Mexico and Central America. When not breeding, martins form large flocks and roost together in great numbers. This behavior begins just prior to the southern migration and continues on the wintering grounds.[2]

Breeding[edit]

Eggs and small chicks in a nest box in Oklahoma, United States

Males arrive in breeding sites before females, and establish their territory. A territory can consist of several potential nest sites. After forming a pair, both the male and female inspect available nest sites. This process is complicated by the fact that artificial nest sites could be houses with many rooms, clustered gourds, or single gourds. The nest is made inside the cavity of such artificial structures and retains a somewhat flat appearance. The nest is a structure of primarily three levels: the first level acts as a foundation and is usually made up of twigs, mud, small pebbles and in at least a few reported cases, small river mollusk shells were used; the second level of the nest is made up of grasses,finer smaller twigs; the third level of construction composing the nest, is a small compression usually lined with fresh green leaves where the eggs are laid. Three to six eggs are laid, and the female is the main incubator, with some help from the male. Purple martins are generally known to raise only a single brood. Fledging, when the young leave the nest, occurs at about one month, after which the parent continue to feed the fledgling young.[2]

Diet[edit]

Purple martins are aerial insectivores, meaning that they catch insects from the air. The birds are agile hunters and eat a variety of winged insects. Rarely, they will come to the ground to eat insects. They usually fly relatively high, so, contrary to popular opinion, mosquitoes do not form a large part of their diet.[2]

Vocalization[edit]

Purple martins are fairly noisy, chirping and making sounds that have been described as chortles, rattles, and croaks.[4] The various calls are said to be "throaty and rich" and can be rendered as tchew-wew, pew pew, choo, cher, zweet and zwrack. The males have a gurgling and guttural courtship song, a dawn song, and even a subsong used at the end of the breeding season.[4][9] Tapes of purple martin song are sold to attract martins to newly established birdhouses.


Problems playing this file? See media help.

Problems playing this file? See media help.

See also[edit]

  • Tree swallow - many similar characteristics
  • Barn swallow - these swallows may be attracted to "purple martin houses" and thus confused with purple martins

Footnotes[edit]

  1. ^ BirdLife International (2012). "Progne subis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g Brown, Charles R. "Purple Martin (Progne subis), The Birds of North America Online (A. Poole, Ed.).". Ithaca: Cornell Lab of Ornithology. Retrieved 1 November 2009. 
  3. ^ Linnaeus (1758
  4. ^ a b c d Turner, Angela K.; Rose, Chris (1989). Swallows & Martins. Boston: Houghton Mifflin. pp. 7, 123–126. ISBN 0-395-51174-7. 
  5. ^ See AOU (2000) for details.
  6. ^ Guayas and Orellana Provinces: Cisneros-Heredia (2006).
  7. ^ Hunn, Eugene S. (1982). Birding in Seattle and King County. Seattle Audubon Society. pp. 107–108. ISBN 0914516051. 
  8. ^ http://purplemartin.org/main/history.html
  9. ^ Peterson (1980): p.202

References[edit]

  • American Ornithologists' Union (AOU) (2000): Forty-second supplement to the American Ornithologists' Union Check-list of North American Birds. Auk 117(3): 847–858. DOI: 10.1642/0004-8038(2000)117[0847:FSSTTA]2.0.CO;2
  • (Latin) Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 192. 
  • Cisneros-Heredia, Diego F. (2006): Información sobre la distribución de algunas especies de aves de Ecuador. ["Information on the distribution of some species of birds of Ecuador"]. Boletín de la Sociedad Antioqueña de Ornitología 16(1): 7-16. [Spanish with English abstract] PDF fulltext
  • Doughty, Robin and Rob Fergus (2002): The Purple Martin. University of Texas Press. ISBN 978-0-292-71615-5
  • Peterson, Roger Tory (1980): A Completely New Guide to All the Birds of Eastern and Central North America (4th ed.). Houghton Mifflin, Boston. ISBN 999751436X
  • Stokes, Donald and Lillian & Brown, Justin L. (1997): Stokes Purple Martin Book. Little, Brown & Co (Canada) Limited. ISBN 978-0-316-81702-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 5.0 of 5

Names and Taxonomy

Taxonomy

Comments: Species limits in this complex are uncertain. Constitutes a superspecies with P. cryptoleuca, P. dominicensis, P. sinaloae, P. chalybea, and P. modesta (including P. elegans) (AOU 1998). See Sheldon and Winkler (1993) for information on intergeneric phylogenetic relationships of Hirundininae based on DNA-DNA hybridization.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!