Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Zebra finches are native to Australia and inhabit most regions of the continent. They have become naturalized in parts of Indonesia and occur in captivity as domesticated animals throughout much of the world.

Biogeographic Regions: oriental (Introduced ); australian (Native )

  • Fischer, R. 1997. Guide to Owning a Zebra Finch. New Jersey: T.F.H. Publications Inc.
  • International Union for Conservation of Nature and Natural Resources. 2006. "Taeniopygia guttata" (On-line). Accessed October 14, 2006 at http://www.iucnredlist.org/search/details.php/53323/all.
  • Slater, P., P. Slater, R. Slater. 1993. The Slater Field Guide to Australian Birds. Sydney: Lansdowne.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Lesser Sundas (Lombok and Sumba to Timor and Sermata).
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Zebra finches are relatively small, with a length of only 10 to 11 cm and a mass of about 12 grams. They are said to be dimorphic because male and female birds differ in coloration. Males are more distinctly marked, with gray heads and backs, striped white and black tails, striped throats, and patches of orange on the cheeks. They also have a spotted chestnut coloration to their sides. The females are less distinctive, having only gray coloration on the entire body. Beaks of zebra finches also vary according to sex. Males tend to have a red colored beak, whereas the beaks of females are orange in color. The eyes of wild finches are also red.  Before reaching maturity, young finches often look like females but with a black beak. Dimorphic coloration appears by the time these finches are 90 days old.

Average mass: 12 g.

Range length: 10 to 11 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 12 g.

  • Roy Beckham/eFinch.com. 2005. "Zebra Finch - Taeniopygia guttata castanotis" (On-line). Accessed October 13, 2006 at http://www.efinch.com/species/zebra.htm.
  • Vriends, M. 1997. The Zebra Finch. New York: Howell Book House.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Zebra finches live exclusively in savanna and subtropical dry habitats, specifically in broad expanses of non-vegetated terrain or areas with scattered shrubs and small trees. They have, however, adapted to many human disturbances, including water holes and land that has been cleared of vegetation for commercial purposes. Zebra finches are also widely domesticated and are frequently kept in captivity by humans.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Zebra finches eat primarily various types of seeds. Their beaks are well adapted for dehusking seeds. Although they prefer a diet of seeds, they also eat a variety of fruits, vegetables, and live food such as insects. A diet that varies in nutritional content is important for the overall health and well being of a finch. Eating insects during breeding is especially important to ensure healthy young.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Zebra finches perform a minor role as seed dispersers in the ecosystems they inhabit and act as prey for small predators.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Red mites (Dermanyssus avium)
  • feather mites (Acari)
  • feather lice (Anoplura)
  • shaft mites (Acari)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Many small mammals are common predators of zebra finch eggs. In their native habitats it is likely that they are preyed on by small dasyurids, birds of prey, and snakes. Outside of their native range they are also preyed on by mice.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Zebra finches use vocalization and body movement to communicate. They are well known for their complex and unique songs. Individual finches sing alone and in groups. Zebra finches use a variety of calls to communicate with others in their group. Male mating calls are often described as soft and trilling, whereas warning calls are said to be more urgent and powerful. These latter calls are used when dangers are perceived near the nesting territory. Both sexes produce a nasal 'tang' call but male zebra finches use more vocal communication than do females. The chicks also produce a chirping and scratching noise to stimulate the feeding response of the parents.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The expected lifespan of zebra finches in the wild is 2 to 3 years depending on availability of resources and presence or absence of desired living conditions. The expected lifespan in captivity, on the other hand, is 5 to 7 years.

Average lifespan

Status: wild:
4.5 years.

Average lifespan

Status: captivity:
12 years.

Typical lifespan

Status: wild:
2 to 3 years.

Typical lifespan

Status: captivity:
5 to 7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (captivity) Observations: There have been few detailed studies of ageing in this species. One specimen kept as a pet was at least 14.5 years of age when it died (website feedback), which is a plausible anecdote. Anecdotal reports also suggest these animals exhibit signs of ageing such as decreased activity with age as well as overgrown nails and beak, but more detailed studies are necessary. One study reported neuronal changes with age (Wang et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The breeding season for zebra finches is variable. They can mate at any time of the year following substantial amounts of rainfall. Zebra finches are monogamous and pair bond for life.

The songs of the finches play an important role in the mating process. Females do not sing, but males have a truly original song, incorporating sounds of their relatives and their surroundings into their tunes. They also produce a hissing noise when protecting their territory and mates. Along with song, males also perform a courtship dance as part of the mating ritual.

An increase in the gathering of materials and resources to build nests can indicate the time of mating. Nests are usually built of grasses and lined with feathers or even wool. They can be found in many different places ranging from trees, bushes, and animal burrows, to cavities and ledges of commercial buildings.

Although zebra finches are monogamous and maintain a pair bond for life, DNA fingerprinting shows that infidelity often occurs within the species. DNA fingerprinting is a method used to determine the biological mother and father of an offspring. Both male and female finches engage in extra-pair mating.

Mating System: monogamous

Breeding flocks contain approximately 50 finches, whereas non-breeding flocks are about twice the size. Since finches breed after large amounts of rainfall, the breeding season is not specific, but once they breed, nest building will begin about a week before laying starts. During the period of nest construction, the pair will spend the nights in the nest together.

The average number off eggs in one laying may be from four to six over a period of a few days. Both males and females incubate the eggs until hatching, which occurs after about two weeks, according to laying time of each egg. During this time, males are extremely protective of females and will not allow any intruders near the nest. After hatching, both parents take turns sitting on the nest and gathering food for the young. After about three weeks, the chicks are able to leave the nest and often perch with the parents, but often return to the nest at night. Approximately two weeks after fledging, the chicks will become independent of the parents. At this time, many parent finches may be ready to rear another clutch of eggs.

Breeding interval: Zebra finches breed after periods of heavy rainfall, at any time of the year.

Breeding season: Zebra finches can breed continuously as long as conditions are appropriate, with each clutch taking approximately 2 months to rear.

Range eggs per season: 4 to 6.

Average time to hatching: 2 weeks.

Average fledging age: 3 weeks.

Average time to independence: 5 weeks.

Range age at sexual or reproductive maturity (female): 2.5 to 3 months.

Range age at sexual or reproductive maturity (male): 2.5 to 3 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both males and females invest a large amount of time in parental care. During the period of nest construction, both sexes contribute to gathering materials, but focus their individual building efforts on different areas. While males focus on gathering most of the materials and general construction of the nest, females focus on the inner nest architecture. Once the eggs are produced, most incubation is carried out by females, while males protect the nest. Both sexes, however, stay in the nest at night. Once the eggs hatch, females primarily incubate and brood the young, but males gather most of the food.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Kin-recognition using olfactory cues

Most birds are thought to have severely reduced sense of smell comparated to other vertebrates.  Recent experiments, however, suggest that both Humboldt Penguins and Zebra Finches can distinguish the odors of their relatives from those of non-relatives. In the penguin experiment (Coffin et al. 2011), birds preferred the scent of familiar non-relatives such as nest mates.  Young finches, on the other hand, prefer the scent of their genetic parents even when raised in foster nests (Krause et al. 2012).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Cyndy Parr

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taeniopygia guttata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATCGGAACCCTATACCTAATCTTCGGCGCCTGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAATTAGGCCAACCTGGAGCCCTCCTAGGAGAC---GACCAAGTATACAACGTCGTCGTCACGGCCCATGCTTTTGTGATAATCTTCTTCATAGTTATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTACCTCTGATGATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCCTTCCTCCTACTACTAGCATCCTCAACAGTTGAAGCAGGAGTGGGAACAGGATGAACAGTGTATCCCCCACTAGCCGGAAACCTAGCCCATGCCGGAGCTTCAGTAGACCTAGCTATCTTCTCCCTGCACTTGGCAGGCATTTCCTCAATCCTAGGGGCAATCAATTTCATCACAACAGCAATCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTACTAATCACTGCAGTCCTGCTTCTACTATCACTTCCAGTCCTAGCTGCTGGAATCACAATGCTCCTTACAGACCGTAACCTAAACACAACATTCTTTGACCCAGCAGGTGGAGGAGACCCAGTACTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTTTACATCCTAATCCTACCAGGTTTCGGCATCATCTCCCACGTCGTAACCTACTATTCAGGTAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCTATGCTATCCATCGGATTCCTAGGATTCATCGTATGAGCCCACCACATGTTTACAGTAGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Taeniopygia guttata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Zebra finches are described as abundant and populations are not declining. Consequently, this species is listed by the IUCN as of least concern of becoming threatened or endangered.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common or locally abundant (Clement 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Zebra finches may be considered pests when nests are built on commercial structures or other buildings.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zebra finches are widely domesticated around the world. They can be tamed from a young age and become familiar with humans, sometimes even eating directly from the hand. Zebra finches are desired for their sociable behavior, beautiful songs, and colorful markings. Zebra finches are also important model organisms for studying pair bonds, mate choice, and the complex song structures of birds. They are also desirable study organisms because of their rapid and reliable breeding.

Positive Impacts: pet trade ; research and education

  • Crook, J. 1970. Social Behaviour in Birds and Mammals. New York: Academic Press Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!