Overview

Distribution

Range

Lesser Sundas (Lombok and Sumba to Timor and Sermata).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Zebra finches are native to Australia and inhabit most regions of the continent. They have become naturalized in parts of Indonesia and occur in captivity as domesticated animals throughout much of the world.

Biogeographic Regions: oriental (Introduced ); australian (Native )

  • Slater, P., P. Slater, R. Slater. 1993. The Slater Field Guide to Australian Birds. Sydney: Lansdowne.
  • Fischer, R. 1997. Guide to Owning a Zebra Finch. New Jersey: T.F.H. Publications Inc.
  • International Union for Conservation of Nature and Natural Resources. 2006. "Taeniopygia guttata" (On-line). Accessed October 14, 2006 at http://www.iucnredlist.org/search/details.php/53323/all.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Zebra finches are relatively small, with a length of only 10 to 11 cm and a mass of about 12 grams. They are said to be dimorphic because male and female birds differ in coloration. Males are more distinctly marked, with gray heads and backs, striped white and black tails, striped throats, and patches of orange on the cheeks. They also have a spotted chestnut coloration to their sides. The females are less distinctive, having only gray coloration on the entire body. Beaks of zebra finches also vary according to sex. Males tend to have a red colored beak, whereas the beaks of females are orange in color. The eyes of wild finches are also red.  Before reaching maturity, young finches often look like females but with a black beak. Dimorphic coloration appears by the time these finches are 90 days old.

Average mass: 12 g.

Range length: 10 to 11 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 12 g.

  • Vriends, M. 1997. The Zebra Finch. New York: Howell Book House.
  • Roy Beckham/eFinch.com. 2005. "Zebra Finch - Taeniopygia guttata castanotis" (On-line). Accessed October 13, 2006 at http://www.efinch.com/species/zebra.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zebra finches live exclusively in savanna and subtropical dry habitats, specifically in broad expanses of non-vegetated terrain or areas with scattered shrubs and small trees. They have, however, adapted to many human disturbances, including water holes and land that has been cleared of vegetation for commercial purposes. Zebra finches are also widely domesticated and are frequently kept in captivity by humans.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Zebra finches eat primarily various types of seeds. Their beaks are well adapted for dehusking seeds. Although they prefer a diet of seeds, they also eat a variety of fruits, vegetables, and live food such as insects. A diet that varies in nutritional content is important for the overall health and well being of a finch. Eating insects during breeding is especially important to ensure healthy young.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Zebra finches perform a minor role as seed dispersers in the ecosystems they inhabit and act as prey for small predators.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Red mites (Dermanyssus avium)
  • feather mites (Acari)
  • feather lice (Anoplura)
  • shaft mites (Acari)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many small mammals are common predators of zebra finch eggs. In their native habitats it is likely that they are preyed on by small dasyurids, birds of prey, and snakes. Outside of their native range they are also preyed on by mice.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Zebra finches use vocalization and body movement to communicate. They are well known for their complex and unique songs. Individual finches sing alone and in groups. Zebra finches use a variety of calls to communicate with others in their group. Male mating calls are often described as soft and trilling, whereas warning calls are said to be more urgent and powerful. These latter calls are used when dangers are perceived near the nesting territory. Both sexes produce a nasal 'tang' call but male zebra finches use more vocal communication than do females. The chicks also produce a chirping and scratching noise to stimulate the feeding response of the parents.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The expected lifespan of zebra finches in the wild is 2 to 3 years depending on availability of resources and presence or absence of desired living conditions. The expected lifespan in captivity, on the other hand, is 5 to 7 years.

Average lifespan

Status: wild:
4.5 years.

Average lifespan

Status: captivity:
12 years.

Typical lifespan

Status: wild:
2 to 3 years.

Typical lifespan

Status: captivity:
5 to 7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (captivity) Observations: There have been few detailed studies of ageing in this species. One specimen kept as a pet was at least 14.5 years of age when it died (website feedback), which is a plausible anecdote. Anecdotal reports also suggest these animals exhibit signs of ageing such as decreased activity with age as well as overgrown nails and beak, but more detailed studies are necessary. One study reported neuronal changes with age (Wang et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The breeding season for zebra finches is variable. They can mate at any time of the year following substantial amounts of rainfall. Zebra finches are monogamous and pair bond for life.

The songs of the finches play an important role in the mating process. Females do not sing, but males have a truly original song, incorporating sounds of their relatives and their surroundings into their tunes. They also produce a hissing noise when protecting their territory and mates. Along with song, males also perform a courtship dance as part of the mating ritual.

An increase in the gathering of materials and resources to build nests can indicate the time of mating. Nests are usually built of grasses and lined with feathers or even wool. They can be found in many different places ranging from trees, bushes, and animal burrows, to cavities and ledges of commercial buildings.

Although zebra finches are monogamous and maintain a pair bond for life, DNA fingerprinting shows that infidelity often occurs within the species. DNA fingerprinting is a method used to determine the biological mother and father of an offspring. Both male and female finches engage in extra-pair mating.

Mating System: monogamous

Breeding flocks contain approximately 50 finches, whereas non-breeding flocks are about twice the size. Since finches breed after large amounts of rainfall, the breeding season is not specific, but once they breed, nest building will begin about a week before laying starts. During the period of nest construction, the pair will spend the nights in the nest together.

The average number off eggs in one laying may be from four to six over a period of a few days. Both males and females incubate the eggs until hatching, which occurs after about two weeks, according to laying time of each egg. During this time, males are extremely protective of females and will not allow any intruders near the nest. After hatching, both parents take turns sitting on the nest and gathering food for the young. After about three weeks, the chicks are able to leave the nest and often perch with the parents, but often return to the nest at night. Approximately two weeks after fledging, the chicks will become independent of the parents. At this time, many parent finches may be ready to rear another clutch of eggs.

Breeding interval: Zebra finches breed after periods of heavy rainfall, at any time of the year.

Breeding season: Zebra finches can breed continuously as long as conditions are appropriate, with each clutch taking approximately 2 months to rear.

Range eggs per season: 4 to 6.

Average time to hatching: 2 weeks.

Average fledging age: 3 weeks.

Average time to independence: 5 weeks.

Range age at sexual or reproductive maturity (female): 2.5 to 3 months.

Range age at sexual or reproductive maturity (male): 2.5 to 3 months.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both males and females invest a large amount of time in parental care. During the period of nest construction, both sexes contribute to gathering materials, but focus their individual building efforts on different areas. While males focus on gathering most of the materials and general construction of the nest, females focus on the inner nest architecture. Once the eggs are produced, most incubation is carried out by females, while males protect the nest. Both sexes, however, stay in the nest at night. Once the eggs hatch, females primarily incubate and brood the young, but males gather most of the food.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Kin-recognition using olfactory cues

Most birds are thought to have severely reduced sense of smell comparated to other vertebrates.  Recent experiments, however, suggest that both Humboldt Penguins and Zebra Finches can distinguish the odors of their relatives from those of non-relatives. In the penguin experiment (Coffin et al. 2011), birds preferred the scent of familiar non-relatives such as nest mates.  Young finches, on the other hand, prefer the scent of their genetic parents even when raised in foster nests (Krause et al. 2012).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Cyndy Parr

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taeniopygia guttata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATCGGAACCCTATACCTAATCTTCGGCGCCTGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAATTAGGCCAACCTGGAGCCCTCCTAGGAGAC---GACCAAGTATACAACGTCGTCGTCACGGCCCATGCTTTTGTGATAATCTTCTTCATAGTTATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTACCTCTGATGATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCCTTCCTCCTACTACTAGCATCCTCAACAGTTGAAGCAGGAGTGGGAACAGGATGAACAGTGTATCCCCCACTAGCCGGAAACCTAGCCCATGCCGGAGCTTCAGTAGACCTAGCTATCTTCTCCCTGCACTTGGCAGGCATTTCCTCAATCCTAGGGGCAATCAATTTCATCACAACAGCAATCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTACTAATCACTGCAGTCCTGCTTCTACTATCACTTCCAGTCCTAGCTGCTGGAATCACAATGCTCCTTACAGACCGTAACCTAAACACAACATTCTTTGACCCAGCAGGTGGAGGAGACCCAGTACTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTTTACATCCTAATCCTACCAGGTTTCGGCATCATCTCCCACGTCGTAACCTACTATTCAGGTAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCTATGCTATCCATCGGATTCCTAGGATTCATCGTATGAGCCCACCACATGTTTACAGTAGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Taeniopygia guttata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zebra finches are described as abundant and populations are not declining. Consequently, this species is listed by the IUCN as of least concern of becoming threatened or endangered.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common or locally abundant (Clement 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Zebra finches may be considered pests when nests are built on commercial structures or other buildings.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Zebra finches are widely domesticated around the world. They can be tamed from a young age and become familiar with humans, sometimes even eating directly from the hand. Zebra finches are desired for their sociable behavior, beautiful songs, and colorful markings. Zebra finches are also important model organisms for studying pair bonds, mate choice, and the complex song structures of birds. They are also desirable study organisms because of their rapid and reliable breeding.

Positive Impacts: pet trade ; research and education

  • Crook, J. 1970. Social Behaviour in Birds and Mammals. New York: Academic Press Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zebra Finch

The Zebra Finch, Taeniopygia guttata (formerly Poephila guttata),[2] is the most common and familiar estrildid finch of Central Australia and ranges over most of the continent, avoiding only the cool moist south and the tropical far north. It also can be found natively in Indonesia and East Timor. The bird has been introduced to Puerto Rico, Portugal, Brazil and the United States.

The ground-dwelling Zebra Finch grows to a size of about 10 centimetres (3.9 in) long and usually eats grass seeds and spray millet.[3] This species' vocalizations consist mostly of chattering trills and calls.

Contents

Habitat

Adult male at Dundee Wildlife Park, Murray Bridge, South Australia
Domesticated Zebra Finch, southern France
Captive Zebra Finch (male)
Captive Zebra Finch (female)
Male in Western Australia, Australia

Zebra Finches inhabit a wide range of grasslands and forests, usually close to water.[3] They are typically found in open steppes with scattered bushes and trees, but have adapted to human disturbances, taking advantage of human-made watering holes and large patches of deforested land. Zebra Finches — including many human-bred variants to the species — are widely kept by genetic researchers, breeding hobbyists and pet owners.

The Zebra Finch breeds after substantial rains in its native habitat, which can occur at any time of the year. Birds in captivity are ready to breed year-round. Wild birds are adaptable and varied in their nesting habits, with nests being found in cavities, scrub, low trees, bushes, on the ground, in termite hills, rabbit burrows, nests of other birds, and in the cracks, crevices, and ledges of human structures. Outside of the breeding time, brood nests are constructed for sleeping in.

Lifecycle

The life expectancy of a Zebra Finch is highly variable because of genetic and environmental factors. The Zebra Finch may reach up to five years in its natural environment. If they are kept caged, they normally live for 5 to 7 years; if they are well looked after and happy, they may live up to 12 years,[4] with the exceptional case of 14.5 years reported for a caged specimen.[5] The greatest threats to the survival of the species are predation by cats and loss of natural food.[3]

Subspecies

The two subspecies are:

The Australian race is sometimes split as Chestnut-eared Finch (Gould, 1837), Taeniopygia castanotis.

The morphological differences between the subspecies include differences in size. T. g. guttata is smaller than T. g. castanotis. In addition, the T.g. guttata males do not have the fine barring found on the throat and upper breast of T.g. castanotis, as well as having small breast bands.

Origin

Zebra Finches are distributed over much of Australia, Tasmania and Flores Islands (northwest of Australia).

Song and other vocalizations

Zebra Finches are loud and boisterous singers. Their calls can be a loud "beep", "meep", "oi!" or "a-ha!". Their song is a few small beeps, leading up to a rhythmic song of varying complexity in males. Each male's song is different, although birds of the same bloodline will exhibit similarities, and all finches will overlay their own uniqueness onto a common rhythmic framework. Sons generally learn the song of their fathers with little variation. Songs may change during puberty, but afterwards they are locked in for the life of the bird.[6] Scientific research at Japan's RIKEN institute has suggested that singing to females is an emotionally rewarding experience for male Zebra Finches.[7]

Male Zebra Finches begin to sing at puberty, while females lack a singing ability.[4] This is due to a developmental difference, where in the embryo, the male Zebra Finch produces estrogen, which is transformed into a testosterone-like hormone in the brain, which in turn leads to the development of the nervous system for a song system. Their songs begin as a few disjointed sounds, but as they experiment, they match what they sing to the memory of their fathers' song, and they rapidly mature into full-fledged songs. During these formative times, they will incorporate sounds from their surroundings into their songs, also using the songs of other nearby males for inspiration.

Male finches use their songs, in part, as a mating call. The mating act is usually accompanied by a high-pitched whining sound. They will also exhibit a hissing sound when protecting their territories.

Because Zebra Finch males learn their songs, they are often used as avian model organisms to investigate the neural bases of learning, memory, and sensorimotor integration. The Zebra Finch genome was the second bird genome to be sequenced, in 2008, after that of the chicken.[8] Their popularity as model organisms is also related to their prolific breeding, an adaptation to their usually dry environment. This ability also makes them popular as pet songbirds.

Diet

Zebra Finches, like most estrildid finches, are primarily seed-eating birds, as their beaks are adapted for dehusking small seeds. They prefer millet, but will consume many other kinds of seeds, as well. While they prefer seeds, captives will also eat egg food. They also readily consume fresh foods, such as small bits of chopped lettuce, apples, and grapes. They are particularly fond of spray millet, and one or two of these small birds will eat a spray millet stalk within a few days. Zebra Finches are messy and voracious eaters, typically dropping seed everywhere. This behavior spreads seed around, aiding in plant reproduction. The availability of water is important to this bird's survival, therefore the Zebra Finch will drink often when water is available and enjoys taking bird baths in a small, shallow bowl. A typical Zebra Finch may be plump, because it eats quite often throughout the day, but an overweight bird needs more exercise, not less food. Finches should always have access to fresh food and water.[3]

Breeding

Female with two juveniles in New South Wales, Australia
Juvenile Zebra Finch pair

In the Zebra Finch, sudden bursts of gathering behaviors signal that a pair is ready to nest.[4] The pair will pull strings or plant leaves they can reach, and if no materials are available to gather, they will use feathers and bits of seed husks. Alfalfa or timothy hay is an acceptable nesting material, as it is closest to what is readily available in the wild. Any item they can use to build a nest will be deposited in a corner of the cage floor, or in their food dish. When these behaviors are noticed, a mating pair should be provided with a sturdy wicker nest about the size of a large apple or orange. This nest should always be placed in the highest possible corner of the cage, opposite the food dish, but near the normal night perch. Nesting finches will abandon a perch if it is across the cage, with the male showing he prefers to sit atop the nest while the female lays. During the nest building, however, both will spend the night cuddling inside the nest.[4]

When they accept the nest shell and begin using it each night, they should be provided with an ample supply of very soft bits of short string and leaves. They prefer items only a couple of inches long and will use nearly any type and color of soft material; longer bits of string or nesting material can tangle around the finches or nestlings and cause distress that will lead to strangulation or even death. The nest shell will be packed with everything they can reach for at least a week before laying begins.[4]

The number of eggs ranges from two to seven eggs per clutch, with five being the most common number.[9] In captivity, some birds lay larger clutches.

Males and females are very similar in size, but are easily distinguished from one another, as the males usually have bright orange cheek feathers, red beaks (as opposed to the orange beaks of females), and generally more striking black and white patterns.[3] The beak is sometimes the only way to tell the gender of a Zebra Finch, as sometimes the orange cheek coloring is faded or nonexistent. Offspring from a similarly colored nesting pair may sometimes vary from the parents' coloration, with nestlings varying from plain grey to completely white. These variations are usually due to mixed breeding between finch types somewhere down the family line, especially in pet store birds. However, the orange cheeks are a stubborn indication that a young Zebra Finch is indeed a male and the cheeks begin to appear when the young are about two months old. Young Zebra Finches will also have black beaks, with the coloring coming in at puberty, though it begins changing at age one month.

The chicks will hatch according to the laying time of each egg. It is common to have one or two eggs remaining unhatched as the parents begin the task of feeding the nestlings. Though it is preferable to leave nests alone after the egg-laying begins, once hatching begins, a breeder might find it useful to make daily 'checks' into the nest to correct problems early, such as larger chicks sitting on and smothering smaller ones, thus increasing the number of chicks that eventually fledge. The time from laying until a fledgling adventures outside will vary with each clutch, but generally good eggs will hatch within 14 to 16 days of laying and young will begin to venture out within about three or four weeks of hatching, and will look full-grown in about three months. Breeding age is eight or more months. Zebra Finches are usually excellent parents and will readily take turns sitting on the nest and bringing food to the young.

While the female is laying, only her mate will be allowed in the nest. Allowing the pair to start a new family while the first clutch is still in the cage will overly stress all the birds in the family. The male of the breeding pair will not allow any other birds near the nest while eggs are being laid. It is advised the newly fledged birds be removed and placed into a separate enclosure to prevent aggressive actions of the adult male who will likely try to beat up younger birds as seen as competition for the females attention.

References

  1. ^ BirdLife International (2012). "Taeniopygia guttata". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106008678. Retrieved 16 July 2012.
  2. ^ Clayton, N.S.; Birkhead, T. (1989). "Consistency in the Scientific Name of the Zebra Finch". Auk 106: 750–750. 
  3. ^ a b c d e Haddon, Frank (1985). The Golden Book of Australian birds and mammals. Golden Press. p. 44. ISBN 0-7302-0011-6. 
  4. ^ a b c d e White, R. and Fraser, A. (2007). "Taeniopygia guttata". Animal Diversity Web. University of Michigan. http://animaldiversity.ummz.umich.edu/site/accounts/information/Taeniopygia_guttata.html. Retrieved July 22, 2009.
  5. ^ "AnAge entry for Taeniopygia guttata". Genomics.senescence.info. http://genomics.senescence.info/species/entry.php?species=Taeniopygia_guttata. Retrieved 2011-01-25.
  6. ^ Williams, H (2001). "Choreography of song, dance, and beak movements in the zebra finch (Taeniopygia guttata)". Journal of Experimental Biology 204 (20): 3497–3506. PMID 11707499. 
  7. ^ "Singing To Females Makes Male Birds' Brains Happy". Medical News Today. 2008-10-02. http://www.medicalnewstoday.com/articles/123994.php. Retrieved 2008-10-03.
  8. ^ Taeniopygia guttata Research Status. Washington University in St. Louis
  9. ^ Zann, Richard A. (1996). The Zebra Finch - A synthesis of field and laboratory studies. Oxford University Press. p. 335. ISBN 0-19-854079-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!