Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Petrochelidon pyrrhonota

A medium-sized (5-6 inches) swallow, the Cliff Swallow is most easily identified by its dark wings, pale breast, and buff-brown rump. Other field marks include a squared-off tail, pale forehead, and black throat patch. Male and female Cliff Swallows are similar to one another in all seasons. The Cliff Swallow breeds across Alaska, Canada, and much of the United States outside of the desert southwest and southeast. In winter, this species migrates south to southern South America. Small numbers are sometimes seen in late fall in southern California and the Gulf Coast, but this species does not normally spend the winter in these areas. As this species’ name suggests, Cliff Swallows typically breed in areas where cliff faces provided a suitable location for nesting sites. More recently, this species has adapted to building nests on man-made structures, such as overpasses and tall buildings, a fact which has allowed Cliff Swallows to expand their range east and south into areas where cliff faces are less common. During the winter, this species is found in open grasslands, fields, and marshes. Cliff Swallows exclusively eat flying insects. As is the case with most swallow species, it is possible to observe Cliff Swallows feeding on insects while in flight. Birdwatchers in this species’ breeding range may want to pay special attention to bridges or the eaves of buildings, as a careful search of these structures may reveal a nesting colony. Cliff Swallows are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from western and central Alaska, northern Yukon, northern Mackenzie, Saskatchewan, northern Manitoba, Ontario, southern Quebec, New Brunswick, and Nova Scotia south to Baja California and central Mexico, western Texas, Arkansas, Tennessee, western Virginia, southeastern Pennsylvania, western Connecticut and northeastern Massachusetts (Brown and Brown 1995). Accidental records from coastal Siberia, southern Greenland, and the British Isles (Brown and Brown 1995). During the nonbreeding season, the range extends from from southern Brazil and possibly southeastern Paraguay south to southcentral Argentina, with several records as far south as Tierra del Fuego and Falkland Islands (Brown and Brown 1995), and occasionally north at least to Costa Rica.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 14 cm

Weight: 22 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Hirundo pyrrhonota pyrrhonota
Catalog Number: USNM 195055
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): E. Preble
Year Collected: 1904
Locality: Fort Norman, Mackenzie, Northwest Territories, Canada, North America
  • Type: Oberholser. January 3, 1920. Canadian Field-Naturalist. 33 (5): 95.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Cliff swallows inhabit open to semiwooded habitat, cliffs, canyons, and farm country, generally near meadows, marshes, and water. They build bottle-shaped mud nest in colonies on cliffs, under eaves of buildings, under bridges, and similar sites sheltered by an overhang. Many return to same nesting area in successive years, but colonies tend to switch nesting sites between seasons, evidently due to a buildup of insect parasites in the nests. Cliff swallow commonly repair and use old nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Cliff swallows arrive in the southern United Staes in February or March. They reach the northern United States usually sometime in April (May in Alaska). Southward migration in the contiguous United States is mainly in August and early September.

Rare migrant in the West Indies (Raffaele 1983). Migrates through Costa Rica late August or early September to late October and early March to late May (Stiles and Skutch 1989). Uncommon and sporatic fall transient in Colombia, mainly early September to mid-October; fewer records of migrants in spring (April-May) (Hilty and Brown 1986). Present in South America mainly September-April (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Primarily insectivorous; feeds on beetles, flying ants, wasps, grasshoppers, mosquitoes, etc. Feeds often on small swarming insects. Sometimes eats berries (e.g., of junipers). Forages usually within 0.5 km of colony, but sometimes up to several km away.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Global population estimate is 89,000,000 birds (Rich et al. 2004). Breeding population is difficult to census accurately by transect methods because species concentrates in colony areas which may be occupied erratically from year to year. North American Breeding Bird Survey (BBS) estimated a relative abundance of 16.99 birds/survey route (n = 2066) from 1966 to 2004 throughout the North American survey area (Sauer et al. 2005a).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious at all seasons. Periodically populations may decline drastically due to prolonged spring or summer rains and reduced food availability (Terres 1980). Parasitic swallow bug (Oeciacus vicarius) sometimes is abundant enough to reduce reproductive success in large colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.8 years (wild) Observations: Annual adult survival has been estimated at 0.57 (http://bna.birds.cornell.edu/). In the wild, these animals may live up to 11.8 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Completely new nests of cliff swallows are built over a period of 3 to 27 days (often a week or two). Egg laying may occur as early as early April in Texas and California, early May in Nebraska and Idaho, late May in Illinois, Massachusetts, and Pennsylvania, and early June in Arizona. At higer elevations in the mountains, most egg laying probably occurs in June. In southern Arizona, most eggs are laid in July with the onset of the summer monsoon. The peak of laying in Nebraska is in late May and early June. Clutch size is 2-6 (usually 3-5). Incubation lasts an average of 13-14 days. Young are tended by both parents, can fly at 20-26 days, may return to nest for the first 2-3 days after fledging. In most populations, the young have fledged by the end of July or slightly later in the mountains and southern Arizona. Young are dependent on parents for food for 3-5 days after fledging, after which they may be fed occasionally for several additional days.

Cliff swallows usually produce one brood per year, a few have a second brood (Turner and Rose 1989; Gauthier and Thomas 1993a. Breeding activity within a colony is closely synchronized (Silver 1995). Prolonged rains or dry weather may reduce breeding success or postpone nesting.

Nesting occurs in colonies of up to 1,000+ pairs (average is a few hundred).

Researchers in Nebraska found that cliff swallow residents within a colony frequently lay eggs in neighboring nests. Sometimes cliff swallows move eggs laid in their own nest to a nearby nest (by carrying the egg in the bill).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Optimizing nest spacing aids survival: cliff swallow
 

Populations of cliff swallows survive in areas with limited breeding sites thanks to their colonial nesting behavior.

   
  "Also of importance in the evolution of colonial nesting are the spatial restrictions which narrowly specialized behavioral characteristics impose on a species. The specialization, whether inherent or traditional, which restricts nesting gulls and alcids to small islands so limits the number of usable breeding sites that procreation of the species depends on maximum utilization of the available space. A similar situation applies in the Cliff Swallow. The special environmental requirements for nesting in this bird include importantly a protected overhanging cliff, or cliff substitute, a source of mud of suitable quality for nest building, and an open foraging area. Sites containing all these essential features in close proximity were decidedly rare in North America before European settlement, and if each adequate site because of extensive territorial requirements could support only one pair of swallows, the dispersion would have been dangerously sparse for procreation and survival of the species. Any behavioral mutations which served to reduce the size of the defended territory around the nest and thus permit colonialism would, under such conditions, have survival value and be perpetuated." (Emlen 1952:196)

  Learn more about this functional adaptation.
  • Emlen, John T., Jr. 1952. Social Behavior in Nesting Cliff Swallows. The Condor. 54(4): 177-199.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petrochelidon pyrrhonota

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNCTAATCTTCGGCGCATGAGCCGGAATAGTAGGCACCTCACTCAGTCTCCTAATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTCGGAGATGACCAAATCTACAACGTAATCGTTACAGCTCACGCCTTTGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGGGGATTCGGAAACTGACTAGTCCCACTAATAATTGGTGCGCCCGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGATTACTCCCACCATCATTTCTACTGCTCCTAGCCTCCTCTACAGTAGAAGCTGGGGTAGGAACCGGCTGAACCGTATACCCACCCCTAGCTGGAAACCTAGCCCACGCCGGAGCCTCCGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGAATCTCCTCAATCCTAGGTGCAATCAACTTTATCACCACAGCAATCAACATAAAACCCCCCGCCCTATCACAATACCAAACACCCCTGTTCGTCTGATCCGTACTAATCACTGCAGTACTACTTCTTCTTTCACTCCCCGTACTAGCTGCCGGTATTACTATACTCCTAACAGACCGCAACCTAAACACCACCTTCTTCGACCCAGCTGGAGGAGGAGACCCAGTACTTTATCAACACCTATTCTGATTCTTCGGCCATCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Petrochelidon pyrrhonota

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Secure: widespread and abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Breeding Bird Survey (BBS) data indicate significant population increases throughout North America in the last four decades (Sauer et al. 2005a,b). Between 1980 and 2005 a positive trend of 0.4% per year (P<0.38, n=1930) was observed survey-wide (Sauer et al. 2005a). However, even statistically significant trends in BBS data should be interpreted with caution because erratic abandonment/colonization of nesting sites along survey routes may bias abundance and trend estimates (Brown and Brown 1995). Numbers have increased in some areas and range has expanded into the southeastern United States due to availability of new sites for nesting (such as dams, highways, bridges; Brown and Brown 1996). The species is regarded as stable or increasing throughout the range, except in some northeastern states (e.g., Massachusetts, New Hampshire; Silver 1995, Sauer et al. 2005a,b).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: On a range-wide scale, no major threats are known. Locally, as in portions of the northeastern United States, threats include competition with House Sparrows for nesting sites and possibly a decrease in the amount of agricultural and open land, which may result in fewer mud sources for nest building (Silver 1995). Additionally, nestling mortality from swallow bug infestations may be considerable in some large colonies, especially for late-starting nests or colonies (Brown and Brown 1995, 1996). Infestations of swallow bugs and mites reduce nestling growth rates and can result in death of up to half of all nestlings (Gorenzel and Salmon 1994). This species is sensitive to cold and dependent on active flying insects for food; weather-related starvation is likely the most important cause of adult mortality during the breeding season (Bent 1942, Brown and Brown 1995). Sometimes cliff swallows are considered a nuisance because they nest in colonies on buildings and other structures; pest management control programs that target this species aim to prevent or stop nesting on buildings by blocking vertical surfaces with netting, wire or other deterrents; occasionally vertical surfaces are covered with toxic or sticky substances as deterrents, which reduces nesting habitat (Gorenzel and Salmon 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: In North Dakota, large population increases occurred after house sparrows were removed (Krapu 1986). In Massachusetts, breeding population increased with removal of house sparrows, installation of nest ledges, and provision of an appropriate mud supply (Silver 1995).

Biological Research Needs: Research has focused on nominate race, H. p. pyrrhonta; southwestern and Mexican birds (subspecies achina and melanogaster) are poorly studied; substantial variation among populations in social behavior and life history are suspected (Brown and Brown 1995). Range and behavior during migration and winter are poorly known. A better understanding of habitat requirements and identification of key habitats throughout range is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American Cliff Swallow

The American cliff swallow (Petrochelidon pyrrhonota) is a member of the passerine bird family Hirundinidae — the swallows and martins.

It breeds in North America and is migratory, wintering in western South America from Venezuela southwards to northeast Argentina. This species is a very rare vagrant to western Europe.

Description[edit]

Collecting mud at a puddle, Prince Edward Point, Ontario

This bird averages 13 cm (5 inches) long with a tiny bill. The adult cliff swallow has an iridescent blue back and crown, brown wings and tail, and buff rump. The nape and forehead are white. The underparts are white except for a red face. The tail is square-ended.

Young birds are essentially brown above and whitish below, except for the buff rump and dark face. The only confusion species is the closely related cave swallow, which is richer in colour and has a cinnamon rump and forehead.

Like all swallows and martins, cliff swallows subsist primarily on a diet of insects which are caught in flight.

Nesting[edit]

Juvenile
Nesting under a bridge in California, USA
Cliff swallow egg

American cliff swallows breed in large colonies. They build conical mud nests and lay 3-6 eggs. The natural nest sites are on cliffs, preferably beneath overhangs, but as with the Eurasian house martin, man-made structures are now the principal locations for breeding. Female American cliff swallows are known to lay eggs in and move previously laid eggs into the nests of other birds within the colony.

This species has always been plentiful in the west of North America, where there are many natural sites, but the abundance in the east has varied.

European settlement provided many new nest sites on buildings, but the population declined in the late nineteenth and early twentieth centuries as the supply of unpainted barns declined. There has been a subsequent revival as dams and bridges have provided suitable sites.

California nesting[edit]

These are the famous swallows whose return from Villa Ventana, Argentina every year to the Mission San Juan Capistrano in California on (or around) March 19 is celebrated with a festival. In recent years, the swallows have failed to return to the mission.[2]

The "Capistrano swallows" are now nesting in the Chino Hills of Southern California, north of San Juan Capistrano. Thousands of the small birds, up from "wintering" in Argentina, have built their mud nests in the eaves of the Vellano Country Club, with community buildings situated around a golf course in the Chino Hills.[3]

References[edit]

  1. ^ BirdLife International (2012). "Petrochelidon pyrrhonota". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Esquivel, Paloma (25 March 2009). "Another year without swallows. Festival goes on without birds at historic mission". The Boston Globe. Retrieved 10 August 2009. 
  3. ^ Gowen, Samantha (6 June 2010). "Swallows bypass O.C., alight in Chino Hills". Orange County Register. Retrieved 14 November 2013. 

Books[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was placed in the genus Hirundo along with the cave swallow Petrochelidon fulva and barn swallow Hirundo rustica, based on hybridization between cave and barn swallows in Texas (Brown and Brown 1996). The species was transferred back to original designation of Petrochelidon by AOU (1998) based on phylogenetics of the genus. Phillips (1986) used the specific name albifrons for this species. Banks and Browning (1995) concluded that the name pyrrhonota has precedence over either lunifrons or albifrons. See Sheldon and Winkler (1993) for information on intergeneric phylogenetic relationships of Hirundininae based on DNA-DNA hybridization.

Five subspecies are currently recognized, although only four are likely valid (hypopolia indistinct from pyrrhonota; Brown and Brown 1995). P. p. pyrrhonota is the most widespread, breeding in eastern North America west to the Rocky Mountains and southwestern British Columbia south to northwestern Baja California. P. p. hypopolia is the largest and most northerly subspecies, breeding from Alaska south to California and east to Wyoming. P. p. ganieri breeds from west-central Tennessee to central and south Texas. P. p. melanogaster breeds in southern Arizona and Mexico. P. p. tachina breeds from southwestern Utah, lower Colorado River valley to Baja California east to southwestern Texas (Brown and Brown 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!