Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paroaria gularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACATTGGCACCCTGTACCTGATTTTCGGCGCATGAGCCGGAATGGTCGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACGTGGAGCCCTCCTAGGAGATGACCAAGTCTACAACGTGGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTTCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGAGTTGGCACAGGCTGAACAGTATACCCCCCACTAGCCGGCAACCTAGCTCACGCCGGAGCCTCGGTCGACCTCGCAATCTTCTCCCTCCACCTAGCTGGAATCTCCTCAATCCTAGGTGCAATCAACTTTATCACAACAGCCATCAACATAAAACCTCCTGCCCTCTCACAATACCAAACCCCTCTATTTGTGTGATCAGTCCTAATCACCGCAGTCCTACTCCTACTATCCTTACCAGTCCTAGCCGCAGGAATCACAATACTCCTAACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCTGTCCTGTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Paroaria gularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-capped cardinal

The red-capped cardinal (Paroaria gularis) is a small South American bird. It belongs to Paroaria, a genus of red-headed cardinal-tanagers.

Taxonomy[edit]

The genus Paroaria is classified in the family Thraupidae, unlike the cardinals proper which are in the Cardinalidae. They were long believed to be closer to American sparrows and placed in the Emberizidae.[2]

The masked cardinal was formerly considered conspecific with the red-capped cardinal. The masked cardinal markedly differs from the red-capped cardinal by the black ear-coverts and the red (not black) lower throat and upper chest. Additionally, its lower mandible is typically whitish, but this is not entirely consistent, as it occasionally is pale flesh-coloured. This distinctive taxon was determined a different species, as suggested by the lack of hybridization with P. g. gularis in the limited area of overlap in southern Venezuela.[3]

Subspecies[edit]

Description[edit]

The adult red-capped cardinal is 16.5 cm (6.5 in) long and weighs about 22 g. (0.78 oz). The nominate subspecies has a crimson head, blackish lores and ocular region, and shiny black upperparts, apart from a white partial collar extending up the neck sides from the white underparts. The throat is black, extending to a point on the upper chest. The upper mandible is black, while the lower is pale flesh-coloured. The legs are dark grey (almost black) and the iris is brownish-orange. In pattern the juvenile resemble the adults, but the upperparts are dusky-brown, the head is deep brownish-buff (darker on the cap), the bill is entirely black and the iris is pale, dull creamy-yellow.

The song is a variable, often repeated series of suweet-chu notes, and the call is a sharp chep.

Distribution[edit]

It occurs in lowlands of the Guianas, Venezuela, eastern Colombia, eastern Ecuador, eastern Peru, northern and eastern Bolivia and the Amazon basin in Brazil. In Brazil it is, except for populations in the relatively open lowlands of north-eastern Roraima and along the Branco River and lower Rio Negro, apparently largely absent from the regions north of the northern bank of the Amazon River, but these regions are generally very poorly known and its presence cannot be discounted, especially in the section between the lower Rio Negro and Rio Jari (the river on the border between Pará and Amapá).

Habitat[edit]

This is a bird of swamps, mangrove, várzea and other semi-open areas near water. It is generally common, and even occurs in lightly wooded wet habitats in towns or cities (e.g. Manaus and Puerto Maldonado).

Ecology[edit]

The red-capped cardinal feeds on insects, rice and fruit. It is usually found in conspicuous pairs or family groups. If there is a well-marked breeding season, it extends over much of the year. The red-capped cardinal has been recorded to breed at least from June to September in northern South America but at Sacha Lodge at the Napo River (Ecuador) an adult was seen feeding a fledgling shiny cowbird (a brood parasite) in late March. This suggests that breeding can also occur as early as February/March. There is no indication for a difference in breeding seasons between the red-capped and the masked cardinals.[4]

They build a shallow open cup nest, some 9–10 cm wide and 7 cm high outside with a 7 cm wide by 4 cm deep cup, in a tree or some other secure spot.[5] For nest material, it uses rootlets, thin twigs, and ferns.[6] The clutch is two or three eggs. These have a background colour varying between whitish and dull olive and have dense dark brown flecks and blotches, heavier at the blunt end. They measure about 21-22 by 16 mm. This species is parasitised by the shiny cowbird (Molothrus bonariensis).[4]

Footnotes[edit]

  1. ^ BirdLife International (2013). "Paroaria gularis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ IOC World Bird Names VERSION 2.11.
  3. ^ Restall et al. (2006).
  4. ^ a b Greeney et al. (2004), Greeney & Merino M. (2006)
  5. ^ In Ecuador, a nest in the Cuyabeno Faunistic Reserve was built in the roots of a Macrolobium sp. standing in water (Greeney & Merino M. 2006), while one at Sacha Lodge was 4 metres above ground in a tree (Greeney et al. 2004)
  6. ^ E.g. Microgramma (Greeney & Merino M. 2006)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!