Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Zenaida macroura

A medium-sized (12 inches) dove, the Mourning Dove is most easily identified by its grayish-tan body, speckled back, black “ear” patch behind the eye, and long pointed tail. This species may be distinguished from the similar White-winged Dove (Zenaida asiatica) by that species’ blue eye-stripes, rounded tail, and white wing patches. Male and female Mourning Doves are similar to one another in all seasons. The Mourning Dove breeds across much of the North American continent south of southern Canada. Northerly-breeding populations migrate south to southern Mexico and Central America during the winter, whereas populations breeding further south in the U.S.and Mexico are non-migratory. Other non-migratory populations exist in the West Indies and at scattered locations in Central America. Mourning Doves inhabit a number of habitats across this species’ wide range, including woodland edges, bushy fields, meadows, and scrubland. This species has also adapted to living near humans, and visits agricultural fields as well as urban and suburban areas where food is available. Mourning Doves almost exclusively eat seeds and grains. Throughout the North American continent, Mourning Doves may be seen foraging for food on the ground or perched on trees limbs, fence posts, and power lines. This species’ call, a melancholy “COO-coo, coo, coo,” and the whistle made by the wings of these birds as they fly, are an integral part of the avian soundscape across most of North America. This is also one of the most common backyard birds, known for regularly visiting bird feeders and building its nest on porch lights and inside hanging plants. Mourning Doves are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The mourning dove is widely distributed across North and Central America where it is common in urban areas and farmlands. These doves can often be seen feeding in pairs or small groups on the ground. Their diet consists of seeds of annual weeds and grains.

This is a mid-sized, slender dove with a small head. The plumage is mostly greyish-brown with a few large dark spots on the upperwings. The long, pointed tail with white outer edges gives this species its scientific name: Greek makros (great) and oura (tail). The English name derives from its soft, plaintive call. Mourning doves also produce a characteristic whistle sound with their wings when they take flight.

  • Phillips, A., J. Marshal, and G. Monson. 1964. The Birds of Arizona. University of Arizona Press, Tucson.
  • Rappole, J. 2000. Birds of the Southwest: Arizona, New Mexico, Southern California, and Southern Nevada. Texas A&M University Press, College Station.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from southern Canada (southwestern and east-central British Columbia to soutern Quebec and Nova Scotia) south to Panama and West Indies. Winter range includes almost all of the breeding range (except notably populations in the north-central portion) and extends south to southern Baja California and throughout the remainder of Mexico (Howell and Webb 1995), and mainly along the Pacific slope of Central America south to Costa Rica and southwestern Panama (Stiles and Skutch 1989, Ridgely and Gwynne 1989).

Introduced (1960s) and established in Hawaii (near Puu Waa Waa, Hawaii).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mourning doves are only native to the Nearctic region. They live from southern Canada, throughout the United States, and south to Panama. Mourning doves are found year-round throughout most of their range but northern populations migrate south during the winter.

Biogeographic Regions: nearctic (Native )

  • Basket, , Sayre, Tomlins, Sayre. 1993. Ecology and management of the Mourning Dove. Pennsylvania: Stackpole Books.
  • Mirarchi, R., T. Baskett. 1994. Mourning dove (Zenaida macroura. The Birds of North America, 117: 1-20.
  • U.S. Department of Agriculture, F. 2007. "Zenaida macroura" (On-line). Fire Effects Information System. Accessed April 09, 2007 at http://www.fs.fed.us/database/feis/animals/bird/zema/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The mourning dove breeds in all of the lower 48 states.  Its range
extends north into Canada and Alaska and south into Mexico [6,7,12,18].
Most mourning doves migrate and spend the winter in the southern United
States, Mexico, Central America, or the West Indies [6].
  • 7.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 6.  Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986.        Inventory and monitoring of wildlife habitat. Denver, CO: U.S.        Department of the Interior, Bureau of Land Management, Service Center.        858 p.  [3441]
  • 12.  Geissler, Paul H.; Dolton, David D.; Field, Rebecca; [and others]
  • 18.  Soutiere, Edward C.; Bolen, Eric G. 1973. Role of fire in mourning dove        nesting ecology. In: Komarek, Edwin V., Sr., technical coordinator.        Proceedings Annual Tall Timbers Fire Ecology Conference; 1972 June 8-9;        Lubbock, TX. Number 12. Tallahassee, FL: Tall Timbers Research Station:        277-288.  [8471]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ CA CO CT DE FL GA ID
IL IN IA KS KY LA ME MD MA MI
MN MS MO MT NE NV NH NJ NM NY
NC ND OH OK OR PA RI SC SD TN
TX UT VT VA WA WV WI WY DC


AB BC MB NB NF NT NS ON PE PQ
SK YK


MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mourning doves are only native to the Nearctic region. They live from southern Canada, throughout the United States, and south to Panama. Mourning doves are found year-round throughout most of their range but northern populations migrate south during the winter.

Biogeographic Regions: nearctic (Native )

  • Basket, , Sayre, Tomlins, Sayre. 1993. Ecology and management of the Mourning Dove. Pennsylvania: Stackpole Books.
  • Mirarchi, R., T. Baskett. 1994. Mourning dove (Zenaida macroura. The Birds of North America, 117: 1-20.
  • U.S. Department of Agriculture, F. 2007. "Zenaida macroura" (On-line). Fire Effects Information System. Accessed April 09, 2007 at http://www.fs.fed.us/database/feis/animals/bird/zema/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mourning doves are medium-sized birds in the Columbidae family. Their size, weight, and specific coloration vary across their range. They have a stream-lined appearance, with a relatively small head and a long, pointed tail. They are overall grayish blue to grayish brown on their backs with black spots on their wings and behind their eyes. There are white tips on the tail. They have a small, black bill and red legs and feet. Males are larger than females and are slightly brighter in color, males have a bluish crown and a rosy breast.

Range mass: 96.0 to 170.0 g.

Range length: 22.5 to 36.0 cm.

Range wingspan: 142.0 to 150.0 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average basal metabolic rate: 0.736 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mourning doves are medium-sized birds in the pigeon family. Their size, weight, and specific coloration vary across their range. They have a stream-lined appearance, with a relatively small head and a long, pointed tail. They are overall grayish blue to grayish brown on their backs with black spots on their wings and behind their eyes. There are white tips on the tail. They have a small, black bill and red legs and feet. Males are larger than females and are slightly brighter in color, males have a bluish crown and a rosy breast.

Range mass: 96.0 to 170.0 g.

Range length: 22.5 to 36.0 cm.

Range wingspan: 142.0 to 150.0 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average basal metabolic rate: 0.736 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 31 cm

Weight: 123 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Habitats include open woodland, forest edge, cultivated lands with scattered trees and bushes, parks and suburban areas, arid and desert country (generally near water), and second growth (Tropical to Temperate zones). Nests are in trees or shrubs, sometimes on stumps or rocks or on building ledges, or on the ground. Individuals may nest in an old nest of another species or build its own platform of twigs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mourning doves are highly adaptable birds and are found in a wide variety of habitats. They are more common in open woodlands and forest edges near grasslands and fields. They are most abundant in agricultural and suburban areas where humans have created large areas of suitable habitat.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, litter

Most ground-nesting mourning doves prefer open cover with large amounts
of bare soil and little litter, with vertical cover at least on one side
of the nest.  Trees with forks and large branches provide security cover
for nests.  Mourning doves prefer to collect nest material from areas
with sparse cover [18].
  • 18.  Soutiere, Edward C.; Bolen, Eric G. 1973. Role of fire in mourning dove        nesting ecology. In: Komarek, Edwin V., Sr., technical coordinator.        Proceedings Annual Tall Timbers Fire Ecology Conference; 1972 June 8-9;        Lubbock, TX. Number 12. Tallahassee, FL: Tall Timbers Research Station:        277-288.  [8471]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, shrubs, tree

The mourning dove primarily inhabits woodland-grassland edge, prairies,
and open forests but avoids densely forested regions [22,23].
Agricultural areas are often heavily used by these doves during feeding
[5].  They are also common in suburbs and cities [6,7].

Mourning doves generally nest on horizontal branches of shrubs and
trees, especially conifers 10 to 25 feet (3-8 m) above the ground [5,7].
They exhibit a strong preference for stands with low canopy cover [22].
Although tree nests are most common, mourning doves will readily nest on
the ground in the absence of trees or shrubs [6,7]. In Arizona, mourning
doves that inhabit riverbottoms show a preference for mesquite trees
(Prosopis spp.) over saltcedar (Tamarix spp.) as nest trees [5].
  • 7.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 5.  Brown, David E. 1989. Arizona game birds. Tucson, AZ: The University of        Arizona Press. 307 p.  [19900]
  • 6.  Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986.        Inventory and monitoring of wildlife habitat. Denver, CO: U.S.        Department of the Interior, Bureau of Land Management, Service Center.        858 p.  [3441]
  • 22.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]
  • 23.  Wells, Reginald; Kraft, Virginia M. 1955. Upland game birds. Sports        Illustrated. Oct: 22-34.  [17365]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

     1  Jack pine
     5  Balsam fir
    14  Northern pin oak
    15  Red pine
    16  Aspen
    17  Pin cherry
    18  Paper birch
    19  Gray birch - red maple
    20  White pine - northern red oak - red maple
    21  Eastern white pine
    22  White pine - hemlock
    23  Eastern hemlock
    24  Hemlock - yellow birch
    25  Sugar maple - beech - yellow birch
    26  Sugar maple - basswood
    27  Sugar maple
    28  Black cherry - maple
    30  Red spruce - yellow birch
    31  Red spruce - sugar maple - beech
    32  Red spruce
    33  Red spruce - balsam fir
    34  Red spruce - Fraser fir
    35  Paper birch - red spruce - balsam fir
    37  Northern white-cedar
    38  Tamarack
    39  Black ash - American elm - red maple
    40  Post oak - blackjack oak
    42  Bur oak
    43  Bear oak
    44  Chestnut oak
    45  Pitch pine
    50  Black locust
    51  White pine - chestnut oak
    52  White oak - black oak - northern red oak
    53  White oak
    55  Northern red oak
    57  Yellow-poplar
    58  Yellow-poplar - eastern hemlock
    59  Yellow-poplar - white oak - northern red oak
    60  Beech - sugar maple
    61  River birch - sycamore
    62  Silver maple - American elm
    63  Cottonwood
    64  Sassafras - persimmon
    65  Pin oak - sweetgum
    67  Mohrs ("shin") oak
    68  Mesquite
    69  Sand pine
    70  Longleaf pine
    71  Longleaf pine - scrub oak
    72  Southern scrub oak
    73  Southern redcedar
    75  Shortleaf pine
    76  Shortleaf pine - oak
    78  Virginia pine - oak
    79  Virginia pine
    80  Loblolly pine - shortleaf pine
    81  Loblolly pine
    83  Longleaf pine - slash pine
    84  Slash pine
    85  Slash pine - hardwood
    88  Willow oak - water oak - diamondleaf oak
    89  Live oak
    91  Swamp chestnut oak - cherrybark oak
    92  Sweetgum - willow oak
    93  Sugarberry - American elm - green ash
    94  Sycamore - sweetgum - American elm
    95  Black willow
    96  Overcup oak - water hickory
    98  Pond pine
   107  White spruce
   108  Red maple
   109  Hawthorn
   110  Black oak
   201  White spruce
   202  White spruce - paper birch
   203  Balsam poplar
   209  Bristlecone pine
   210  Interior Douglas-fir
   217  Aspen
   220  Rocky Mountain juniper
   221  Red alder
   222  Black cottonwood - willow
  

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: cactus, shrub

   K005  Mixed conifer forest
   K009  Pine - cypress forest
   K010  Ponderosa shrub forest
   K011  Western ponderosa forest
   K012  Douglas-fir forest
   K016  Eastern ponderosa forest
   K017  Black Hills pine forest
   K018  Pine - Douglas-fir forest
   K019  Arizona pine forest
   K020  Spruce - fir - Douglas-fir forest
   K021  Southwestern spruce - fir forest
   K022  Great Basin pine forest
   K023  Juniper - pinyon woodland
   K024  Juniper steppe woodland
   K025  Alder - ash forest
   K026  Oregon oakwoods
   K027  Mesquite bosque
   K028  Mosaic of K002 and K026
   K029  California mixed evergreen forest
   K030  California oakwoods
   K031  Oak - juniper woodlands
   K032  Transition between K031 and K037
   K033  Chaparral
   K034  Montane chaparral
   K035  Coastal sagebrush
   K036  Mosaic of K030 and K035
   K037  Mountain-mahogany - oak scrub
   K038  Great Basin sagebrush
   K039  Blackbrush
   K040  Saltbush - greasewood
   K041  Creosotebush
   K042  Creosotebush - bursage
   K043  Paloverde - cactus shrub
   K044  Creosotebush - tarbush
   K045  Ceniza shrub
   K046  Desert: vegetation largely lacking
   K047  Fescue - oatgrass
   K048  California steppe
   K049  Tule marshes
   K050  Fescue - wheatgrass
   K051  Wheatgrass - bluegrass
   K053  Grama - galleta steppe
   K054  Grama - tobosa prairie
   K055  Sagebrush steppe
   K056  Wheatgrass - needlegrass shrubsteppe
   K057  Galleta - three-awn shrubsteppe
   K058  Grama - tobosa shrubsteppe
   K059  Trans-Pecos shrub savanna
   K060  Mesquite savanna
   K061  Mesquite - acacia savanna
   K062  Mesquite - live oak savanna
   K063  Foothills prairie
   K064  Grama - needlegrass - wheatgrass
   K065  Grama - buffalograss
   K066  Wheatgrass - needlegrass
   K067  Wheatgrass - bluestem - needlegrass
   K068  Wheatgrass - grama - buffalograss
   K069  Bluestem - grama prairie
   K070  Sandsage - bluestem prairie
   K071  Shinnery
   K072  Sea oats prairie
   K073  Northern cordgrass prairie
   K074  Bluestem prairie
   K075  Nebraska Sandhills prairie
   K076  Blackland prairie
   K077  Bluestem - sacahuista prairie
   K078  Southern cordgrass prairie
   K079  Palmetto prairie
   K081  Oak savanna
   K082  Mosaic of K074 and K100
   K083  Cedar glades
   K084  Cross Timbers
   K085  Mesquite - buffalograss
   K086  Juniper - oak savanna
   K087  Mesquite - oak savanna
   K088  Fayette prairie
   K089  Black Belt
   K090  Live oak - sea oats
   K091  Cypress savanna
   K092  Everglades
   K098  Northern floodplain forest
   K099  Maple - basswood forest
   K100  Oak - hickory forest
   K101  Elm - ash forest
   K102  Beech - maple forest
   K103  Mixed mesophytic forest
   K104  Appalachian oak forest
   K106  Northern hardwoods
   K107  Northern hardwoods - fir forest
   K108  Northern hardwoods - spruce forest
   K109  Transition between K104 and K106
   K110  Northeastern oak - pine forest
   K112  Southern mixed forest
   K113  Southern floodplain forest
   K114  Pocosin
   K115  Sand pine scrub
   K116  Subtropical pine forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

The mourning dove occupies a broad range of plant communities including
desert areas, open mixed woodlands and wood edges, farm and ranchlands,
shelterbelts, and grasslands [6,7,18].  They are often attracted to
disturbed areas supporting annual weedy plant species [16].  In
California, mourning doves breed from the blue oak (Quercus douglasii)
to the Jeffery pine (Pinus jeffreyi) zone [22].
  • 7.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 6.  Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986.        Inventory and monitoring of wildlife habitat. Denver, CO: U.S.        Department of the Interior, Bureau of Land Management, Service Center.        858 p.  [3441]
  • 16.  Mason, Robert B. 1981. Response of birds and rodents to controlled        burning in pinyon-juniper woodlands. Reno, NV: University of Nevada. 55        p. Thesis.  [1545]
  • 18.  Soutiere, Edward C.; Bolen, Eric G. 1973. Role of fire in mourning dove        nesting ecology. In: Komarek, Edwin V., Sr., technical coordinator.        Proceedings Annual Tall Timbers Fire Ecology Conference; 1972 June 8-9;        Lubbock, TX. Number 12. Tallahassee, FL: Tall Timbers Research Station:        277-288.  [8471]
  • 22.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mourning doves are highly adaptable birds and are found in a wide variety of habitats. They are more common in open woodlands and forest edges near grasslands and fields. They are most abundant in agricultural and suburban areas where humans have created large areas of suitable habitat.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 15.249 - 16.999
  Nitrate (umol/L): 0.119 - 0.733
  Salinity (PPS): 33.442 - 33.476
  Oxygen (ml/l): 5.554 - 5.880
  Phosphate (umol/l): 0.355 - 0.419
  Silicate (umol/l): 2.321 - 3.287

Graphical representation

Temperature range (°C): 15.249 - 16.999

Nitrate (umol/L): 0.119 - 0.733

Salinity (PPS): 33.442 - 33.476

Oxygen (ml/l): 5.554 - 5.880

Phosphate (umol/l): 0.355 - 0.419

Silicate (umol/l): 2.321 - 3.287
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations arrive in breeding areas in March-April, depart by around mid-September (Terres 1980). Peak southward migration occurs in August in central U.S. Resident populations in south are augmented in northern winter by migrants from northern temperate zone.

Doves banded west of the Continental Divide in Montana, Wyoming, Colorado, and New Mexico were recovered primarily south and west of banding areas (34% in Mexico), and recoveries west of the Divide came primarily from bandings west of the main north-south mountain ranges; the cordilleras forming the Divide appear to be impediments to east-west migration (Braun 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: About 98% of diet is seeds (Terres 1980). Diet includes a wide variety of wild seeds as well as waste grain (wheat, corn, rye, oats, etc), also some insects. Individuals may fly long distances to water. Feeding occurs mostly on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mourning doves eat a wide variety of seeds, waste grain, fruit, and insects. They prefer seeds that rest on the gound. Occasionally they eat in trees and bushes when ground foods are scarce. Their diet is typically 95% seeds or plant parts. Mourning doves eat agricultural crops, especially cereal grains such as corn, millet, rye, barley, and oats. On rare occasions mourning doves can be seen preying on Orthoptera, Formicidae, Coleoptera, and Gastropoda.

Animal Foods: insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mourning doves are ground foragers.  They feed almost entirely on seeds
of grasses, weeds, and cultivated grains.  Mourning doves also eat
insects, fruits, nuts, acorns, and pine seeds [4,7,8,21].  Snails are
important in their diet in the spring before and during egg laying [22].
One study in a longleaf pine (Pinus palustris) community found that
mourning doves heavily consumed longleaf pine seeds [17].  In Arizona,
favorite cereal grains of mourning doves include barley, wheat, and
corn.  In the higher elevations, pine seed (Pinus spp.), turkeymullein
(Eremocarpus setigerus), and wild sunflower (Helianthus spp.) are the
most common food items [5].
  • 7.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 4.  Borell, A. E. 1971. Russian-olive for wildlife and other conservation        uses. Leaflet 292. Washington, DC: U.S. Department of Agriculture. 8 p.        [6997]
  • 5.  Brown, David E. 1989. Arizona game birds. Tucson, AZ: The University of        Arizona Press. 307 p.  [19900]
  • 8.  Eastman, William R., Jr. 1960. Eating of tree seeds by birds in central        Oregon. Res. Note 42. Corvallis, OR: Oregon Forest Research Center,        Forest Lands Research. 24 p.  [8284]
  • 17.  Smith, Clarence F.; Aldous, Shaler E. 1947. The influence of mammals and        birds in retarding artificial and natural reseeding of coniferous        forests in the United States. Journal of Forestry. 45: 361-369.  [19308]
  • 21.  Van Dersal, William R. 1940. Utilization of oaks by birds and mammals.        Journal of Wildlife Management. 4(4): 404-428.  [11983]
  • 22.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mourning doves eat a wide variety of seeds, waste grain, fruit, and insects. They prefer seeds that rest on the gound. Occasionally they eat in trees and bushes when ground foods are scarce. Their diet is typically 95% seeds or plant parts. Mourning doves eat agricultural crops, especially cereal grains such as corn, millet, rye, barley, and oats. On rare occasions mourning doves can be seen preying on grasshoppers, ants, beetles, and snails.

Animal Foods: insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Mourning doves consume large quantities of grains, seeds, and fruits. This has a significant impact on the plant communities in which they live. They may act as seed dispersers for certain fruiting plants that they feed upon.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mourning doves are swift and maneuverable in flight, so can escape most predators if they are aware of their presence. The exception to this are falcons, such as Falco peregrinus and Falco mexicanus. Adult mourning doves will try to lure predators away from their nests by pretending to be injured. This is called the "broken-wing feign." They flutter about on the ground in front of the predator, as if they had a broken wing, and lure them away from the area of their nest.

Known Predators:

  • Falconidae
  • Accipitridae
  • Procyon lotor
  • Felis silvestris
  • Canis lupus familiaris
  • Elaphe obsoleta

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Mourning dove predators include humans, hawks (Accipitridae), owls
(Stringidae and Tytonidae), cats (Felidae), dogs (Canidae), blue jays
(Cyanocitta cristata), and squirrels [19].
  • 19.  Southeastern Association of Game and Fish Commissioners. 1957. Mourning        dove investigations: 1948-1956. Columbia, SC. 166 p.  [19911]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Mourning doves consume large quantities of grains, seeds, and fruits. This has a significant impact on the plant communities in which they live. They may act as seed dispersers for certain fruiting plants that they feed upon.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mourning doves are swift and maneuverable in flight, so can escape most predators if they are aware of their presence. The exception to this are falcons, such as peregrine falcons and prairie falcons. Adult mourning doves will try to lure predators away from their nests by pretending to be injured. This is called the "broken-wing feign." They flutter about on the ground in front of the predator, as if they had a broken wing, and lure them away from the area of their nest.

Known Predators:

  • falcons
  • hawks
  • raccoons
  • domestic cats
  • domestic dogs
  • black rat snakes

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

I often hear the mourning dove call in movies as a cue that the scene is taking place in a suburban area. One early morning scene in the Pixar animation Toy Story stands out.

  • Toy Story, 1995.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Sara Bremen

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total population size is unknown but certainly exceeds 100,000,000. Rich et al. (2004) estimated population size at 130,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

This species forms small to large flocks in the nonbreeding season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, litter, low-severity fire

Fires may affect mourning dove nesting habitat by destroying nest trees
and therefore increasing the occurrence of ground nesting.  In Texas, a
2-year study of mourning dove nesting on a grassland infested with woody
vegetation showed that a low-severity fire had little effect on either
mesquite trees or their use as nesting sites by mourning doves.
However, on a similar area earlier treated with herbicides and burned in
late March, the loss of the larger mesquite trees as nest sites was
followed by the occurrence of more ground nesting [18].

Soutiere and Bolen [18] found that current year burns provided better
ground-nesting habitat than did older burns except under drought
conditions.  The highest densities of ground nesting pairs were found in
the current year's burn and decreased each successive year thereafter.
The degree of ground cover became less attractive to ground-nesting
doves as the proportion of cover approached the unburned condition.
Also, burning reduced the amount of available litter but added to the
suitability of the area by increasing the amount of open space where
doves might collect nest materials.

The effects of fire in a drought year could be disastrous to mourning
dove nesting.  Spring fires in a drought year may delay the development
of suitable ground-nesting habitat [18].
  • 18.  Soutiere, Edward C.; Bolen, Eric G. 1973. Role of fire in mourning dove        nesting ecology. In: Komarek, Edwin V., Sr., technical coordinator.        Proceedings Annual Tall Timbers Fire Ecology Conference; 1972 June 8-9;        Lubbock, TX. Number 12. Tallahassee, FL: Tall Timbers Research Station:        277-288.  [8471]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Nesting - Mourning doves generally nest between mid-March and
mid-September [12,22].

Clutch size, incubation and fledging - Mourning doves almost always lay
two eggs, though one to three have been reported [5,22].  They raise
multiple broods within a year.  In Arizona, up to seven nests per pair
have been recorded in a single nesting season.  Incubation takes 14 to
15 days and is shared by both parents.  Growth and development is rapid
and squabs fledge 12 to 14 days after hatching [5].

Migration - A southward migration of mourning doves occurs annually
beginning in late August.  In general most doves in the northern half of
the breeding range, and many in the southern part, winter in the
southern United States, Mexico, Central America, or the West Indies
[20].  Mourning doves from the central and western United States
generally arrive in Arizona and California by mid-September.  The peak
period for fall arrival in Mexico is October 11 to 20.  Spring departure
from Mexico begins in late March, and migration is in full progress by
mid-April [12].  Some populations of mourning doves that breed in the
wintering range appear to be nonmigratory [20].
  • 5.  Brown, David E. 1989. Arizona game birds. Tucson, AZ: The University of        Arizona Press. 307 p.  [19900]
  • 12.  Geissler, Paul H.; Dolton, David D.; Field, Rebecca; [and others]
  • 20.  Tomlinson, Roy E.; Dolton, David D.; Reeves, Henry M.; [and others]
  • 22.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mourning doves use a variety of body displays to scare away intruders, threaten invading males, and attract potential mates. Mourning doves also use a suite of songs and calls to communicate with other mourning doves. The male's song to attract a mate is often heard throughout the warm months of the year. It is a simple call, sounding like: 'coo oo, OO, OO, OO. Mourning doves also make some non-vocal sounds in flight, they make a whistling noise while flying and sometimes make sharp flapping noises with their wings. The purpose of these sounds is unknown.

When young mourning doves tap on their parent's bills it stimulates regurgitation of crop milk.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Mourning doves use a variety of body displays to scare away intruders, threaten invading males, and attract potential mates. Mourning doves also use a suite of songs and calls to communicate with other mourning doves. The male's song to attract a mate is often heard throughout the warm months of the year. It is a simple call, sounding like: 'coo oo, OO, OO, OO. Mourning doves also make some non-vocal sounds in flight, they make a whistling noise while flying and sometimes make sharp flapping noises with their wings. The purpose of these sounds is unknown.

When young mourning doves tap on their parent's bills it stimulates regurgitation of crop milk.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Adult mourning doves usually live to about 1.5 years old in the wild, but one wild mourning dove lived to 19.3 years old. Some areas of the United States allow hunting of mourning doves, in these areas average lifespan is lower than in areas where hunting is not allowed.

Range lifespan

Status: wild:
19.3 (high) years.

Average lifespan

Status: wild:
1.5 years.

Average lifespan

Status: wild:
376 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Adult mourning doves usually live to about 1.5 years old in the wild, but one wild mourning dove lived to 19.3 years old. Some areas of the United States allow hunting of mourning doves, in these areas average lifespan is lower than in areas where hunting is not allowed.

Range lifespan

Status: wild:
19.3 (high) years.

Average lifespan

Status: wild:
1.5 years.

Average lifespan

Status: wild:
376 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 31.3 years (wild) Observations: Annual adult mortality is about 55% (John Terres 1980). In the wild, record longevity from banding studies us 31.3 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm). Like for some other doves, the breeding patterns of these animals depend on latitude with animals along the Gulf Coast being able to breed throughout the year (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Protracted breeding season. Clutch size is usually 2. Incubation lasts 13-15 days, by both sexes (male diurnally). Young are fed by at least one parent for 27 days (mainly by male after 16 days). Individual pairs may raise 2-5 broods/year. Pair bond usually is life-long.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mourning doves are monogamous, some pairs stay together through the winter. Males perform a number of displays, along with a courtship "coo", on a display perch. They will drive other males away from their display perch but do not otherwise establish a territory until after mating. Females land near the male on his display perch, causing the male to begin an elaborate series of courtship maneuvers. If a pair bond is formed, the male and female remain together for a few days before starting to build a nest. After finding a mate, males begin selecting a nest site. Nest construction takes over ten hours and covers a span of three to four days.

Mating System: monogamous

Female mourning doves generally lay two small, white eggs in an open nest. The young leave the nest about 15 days after hatching but remain nearby until they are more accomplished at flying, usually at about 30 days old. Young are able to breed by 85 days old.  Mourning doves have the longest breeding season of all North American birds.

Breeding interval: Mourning doves may breed several times in a breeding season, depending on food availability.

Breeding season: February through October

Average eggs per season: 2.0.

Range time to hatching: 15.0 (high) days.

Average time to hatching: 14.0 days.

Average fledging age: 15.0 days.

Average time to independence: 30 days.

Average age at sexual or reproductive maturity (female): 85.0 days.

Average age at sexual or reproductive maturity (male): 85.0 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 2.

Both male and female mourning doves share in incubating and feeding their young. Incubation lasts 14 to 15 days. Young mourning doves are fed regurgitated food by both parents. For the first 3 to 4 days after hatching the young are fed only crop milk, an energy rich substance that is produced in the crops of both male and female parents. After that time, parents begin to add more seeds to the regurgitated food until they are fed only regurgitated seeds by the time the young leave the nest. Female mourning doves feed the young most during the first 15 days after hatching but after that males take over the responsibility for feeding the young. The young continue to stay near the nest and beg for food after they have fledged, but can survive on their own after 21 days old if there is food nearby.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Basket, , Sayre, Tomlins, Sayre. 1993. Ecology and management of the Mourning Dove. Pennsylvania: Stackpole Books.
  • Mirarchi, R., T. Baskett. 1994. Mourning dove (Zenaida macroura. The Birds of North America, 117: 1-20.
  • U.S. Department of Agriculture, F. 2007. "Zenaida macroura" (On-line). Fire Effects Information System. Accessed April 09, 2007 at http://www.fs.fed.us/database/feis/animals/bird/zema/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mourning doves are monogamous, some pairs stay together through the winter. Males perform a number of displays, along with a courtship "coo", on a display perch. They will drive other males away from their display perch but do not otherwise establish a territory until after mating. Females land near the male on his display perch, causing the male to begin an elaborate series of courtship maneuvers. If a pair bond is formed, the male and female remain together for a few days before starting to build a nest. After finding a mate, males begin selecting a nest site. Nest construction takes over ten hours and covers a span of three to four days.

Mating System: monogamous

Female mourning doves generally lay two small, white eggs in an open nest. The young leave the nest about 15 days after hatching but remain nearby until they are more accomplished at flying, usually at about 30 days old. Young are able to breed by 85 days old.  Mourning doves have the longest breeding season of all North American birds.

Breeding interval: Mourning doves may breed several times in a breeding season, depending on food availability.

Breeding season: February through October

Average eggs per season: 2.0.

Range time to hatching: 15.0 (high) days.

Average time to hatching: 14.0 days.

Average fledging age: 15.0 days.

Average time to independence: 30 days.

Average age at sexual or reproductive maturity (female): 85.0 days.

Average age at sexual or reproductive maturity (male): 85.0 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 2.

Both male and female mourning doves share in incubating and feeding their young. Incubation lasts 14 to 15 days. Young mourning doves are fed regurgitated food by both parents. For the first 3 to 4 days after hatching the young are fed only crop milk, an energy rich substance that is produced in the crops of both male and female parents. After that time, parents begin to add more seeds to the regurgitated food until they are fed only regurgitated seeds by the time the young leave the nest. Female mourning doves feed the young most during the first 15 days after hatching but after that males take over the responsibility for feeding the young. The young continue to stay near the nest and beg for food after they have fledged, but can survive on their own after 21 days old if there is food nearby.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Basket, , Sayre, Tomlins, Sayre. 1993. Ecology and management of the Mourning Dove. Pennsylvania: Stackpole Books.
  • Mirarchi, R., T. Baskett. 1994. Mourning dove (Zenaida macroura. The Birds of North America, 117: 1-20.
  • U.S. Department of Agriculture, F. 2007. "Zenaida macroura" (On-line). Fire Effects Information System. Accessed April 09, 2007 at http://www.fs.fed.us/database/feis/animals/bird/zema/all.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Zenaida macroura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Zenaida macroura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTATACCTAATCTTCGGCGCATGAGCCGGTATAGTTGGAACCGCACTTAGTCTCCTCATCCGTGCAGAACTCGGACAACCCGGCACCCTCCTAGGAGACGACCAAATCTATAATGTAGTAGTTACAGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATGCCTATCATAATTGGAGGCTTCGGAAACTGACTAGTACCGCTCATAATTGGAGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTGCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCCACGGTTGAAGCCGGTGCAGGCACAGGATGAACCGTATACCCCCCACTAGCTGGTAACCTCGCCCACGCCGGAGCCTCCGTAGACTTGGCCATCTTCTCCCTCCATCTTGCAGGTGTCTCCTCCATCTTAGGGGCCATCAACTTTATTACAACGGCCATTAACATAAAACCTCCAGCCCTCTCACAATACCAAACCCCACTATTTGTATGATCAGTCCTCATCACCGCCGTTCTCCTCCTTCTATCCCTCCCAGTCCTCGCCGCCGGCATCACCATACTACTTACAGACCGAAACCTAAACACCACCTTCTTCGACCCCGCTGGCGGAGGCGACCCAGTACTATATCAGCACCTCTTCTGATTCTTTGGTCACCCCGAAGTNTACATTTTAATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North and Central America and West Indies; very large population size and number of occurrences; a major game species; relatively stable population; no major threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mourning doves are widespread and abundant, they are not threatened currently.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mourning doves are widespread and abundant, they are not threatened currently.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Unknown

Comments: Trend over past 200 years is unknown. Range and abundance increased is some areas (e.g., southern Canada, northeastern United States, West Indies).

Breeding Bird Survey (BBS) for 1966-2007 and for 1980-2007 indicate a stable trend.

Mourning Dove Call Count surveys for 1966-2006 suggest a stable or slightly decreasing trend in the Eastern Management Unit (EMU) and a decreasing trend in the Central Management Unit (CMU) and Western Management Unit (WMU), with the greatest decline in the WMU (Dolton and Rau 2006). During the past 10 years of this data set, WMU trend was stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Baskett et al. (1993) for information on research and management techniques. Geissler et al. (1987) found that September hunting had no substantial effect on recruitment of fledglings into the population (see also Olson and Braun, 1984, J. Wildl. Manage. 48:1035-1041). Response to burning: more common on burned plots in breeding season in Arizona (Finch et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the term: litter

Mourning doves generally will not scratch in litter for seeds and will
avoid areas with dense vegetation when feeding [15].  For these reasons
mourning doves commonly forage on newly burned areas.  Mason [16] found
that mourning doves often foraged in 2-year-old burns on a (Pinus
monophylla-Juniperus osteosperma) woodland site burned in winter or
fall.  The burns provided weedy areas for foraging, snags for perching,
and open areas for loafing.

An extensive body of research has been published on fire effects on animals
in semidesert grassland, oak savanna, and Madrean oak woodlands of southeastern
Arizona, including the response of mourning dove to fire. See the Research Project Summary of this work for more information on
mourning dove and more than 100 additional species of birds, small
mammals, grasshoppers, and herbaceous and woody plant species.
  • 15.  Landers, J. Larry. 1987. Prescribed burning for managing wildlife in        southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene,        eds. Managing southern forests for wildlife and fish: a proceedings;        [Date of conference unknown]
  • 16.  Mason, Robert B. 1981. Response of birds and rodents to controlled        burning in pinyon-juniper woodlands. Reno, NV: University of Nevada. 55        p. Thesis.  [1545]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the term: cover

The mourning dove is one of the most abundant birds in the United
States.  Fall populations have ranged from 350 to 600 million doves.
Dove hunting is a popular recreation for about two million people [12].

The mourning dove has been able to adapt to human activities more than
most other native bird species.  Clearing large areas of deciduous
forests in the East and planting trees on prairies have enhanced the
dove population.  The conversion of large tracts of treeless prairie to
domestic grainfields and farmsteads has created an excellent combination
of food (waste grains) and nesting cover for mourning doves.
Additionally, intensive grazing on many rangelands has encouraged exotic
plant species that often produce more seeds than native grasses [6].

Mourning doves may play a role in the dispersal of weeds such as leafy
spurge (Euphorbia esula) in areas where they nest on the ground [3].

Mourning doves are susceptible to a number of parasites and diseases
including mites, intestinal roundworms, bird malaria, fowlpox, and
trichomoniasis. Occasionally the improper use of pesticides has been a
significant cause of dove mortality.  This species is susceptible to
aldrein, dieldrin, and other chlorinated hydrocarbons [5].
  • 3.  Blockstein, David E.; Maxwell, Bruce D.; Fay, Peter K. 1987. Dispersal        of leafy spurge seeds (Euhorbia esula) by mourning doves (Zenaida        macroura). Weed Science. 35: 160-162; 1987.  [475]
  • 5.  Brown, David E. 1989. Arizona game birds. Tucson, AZ: The University of        Arizona Press. 307 p.  [19900]
  • 6.  Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986.        Inventory and monitoring of wildlife habitat. Denver, CO: U.S.        Department of the Interior, Bureau of Land Management, Service Center.        858 p.  [3441]
  • 12.  Geissler, Paul H.; Dolton, David D.; Field, Rebecca; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because they eat cereal grains, mourning doves can occasionally become pests of crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mourning doves are the leading game birds in North America, providing more than 1.9 million recreational hunting trips each year.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Because they eat cereal grains, mourning doves can occasionally become pests of crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mourning doves are the leading game birds in North America, providing more than 1.9 million recreational hunting trips each year.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mourning dove

For the Native American author of the same name, see Mourning Dove (author)

The mourning dove (Zenaida macroura) is a member of the dove family (Columbidae). The bird is also called the turtle dove or the American mourning dove or rain dove, and formerly was known as the Carolina pigeon or Carolina turtledove.[2] It is one of the most abundant and widespread of all North American birds. It is also the leading gamebird, with more than 20 million birds (up to 70 million in some years) shot annually in the U.S., both for sport and for meat. Its ability to sustain its population under such pressure stems from its prolific breeding: in warm areas, one pair may raise up to six broods a year. Its plaintive woo-OO-oo-oo-oo call gives the bird its name. The wings can make an unusual whistling sound upon take-off and landing. The bird is a strong flier, capable of speeds up to 88 km/h (55 mph).[3]

Mourning doves are light grey and brown and generally muted in color. Males and females are similar in appearance. The species is generally monogamous, with two squabs (young) per brood. Both parents incubate and care for the young. Mourning doves eat almost exclusively seeds, but the young are fed crop milk by their parents.

Taxonomy[edit]

The mourning dove is closely related to the eared dove (Zenaida auriculata) and the Socorro dove (Zenaida graysoni). Some authorities describe them as forming a superspecies and these three birds are sometimes classified in the separate genus Zenaidura,[4] but the current classification has them as separate species in the genus Zenaida. In addition, the Socorro dove has at times been considered conspecific with the mourning dove, although several differences in behavior, call, and appearance justify separation as two different species.[5] While the three species do form a subgroup of Zenaida, using a separate genus would interfere with the monophyly of Zenaida by making it paraphyletic.[4]

There are five subspecies of mourning dove:

  • Eastern Z. m. carolinensis (Linnaeus, 1766)
  • Clarion Island Z. m. clarionensis (C.H.Townsend, 1890)
  • West Indian Z. m. macroura (Linnaeus, 1758)
  • Western Z. m. marginella (Woodhouse, 1852)
  • Panama Z. m. turturilla Wetmore, 1956

The ranges of most of the subspecies overlap a little, with three in the United States or Canada.[6] The West Indian subspecies is found throughout the Greater Antilles.[7] It has recently invaded the Florida Keys.[6] The eastern subspecies is found mainly in eastern North America, as well as Bermuda and the Bahamas. The western subspecies is found in western North America, including parts of Mexico. The Panamanian subspecies is located in Central America. The Clarion Island subspecies is found only on Clarion Island, just off the Pacific coast of Mexico.[7]

The mourning dove is sometimes called the American mourning dove to distinguish it from the distantly related mourning collared dove (Streptopelia decipiens).[4] It was also formerly known as the Carolina turtledove or Carolina pigeon.[8] The species' scientific name was bestowed in 1838 by French zoologist Charles L. Bonaparte in honor of his wife, Princess Zénaide.[9] The "mourning" part of its common name comes from its call.[10] It was thought to be the passenger pigeon's closest living relative, based on morphological grounds.[11][12] The mourning dove was even suggested to belong to the same genus, Ectopistes, and was listed by some authors as E. carolinensis.[13]

Distribution[edit]

In Hermosillo, Sonora, Mexico

The mourning dove has a large range of nearly 11,000,000 km2 (4,200,000 sq mi).[14] The species is resident throughout the Greater Antilles, most of Mexico, the Continental United States, and southern Canada. Much of the Canadian prairies sees these birds in summer only, and southern Central America sees them in winter only.[15] The species is a vagrant in northern Canada, Alaska,[16] and South America.[4] It has been spotted as an accidental at least seven times in the Western Palearctic with records from the British Isles (5), the Azores (1) and Iceland (1).[6] In 1963, the mourning dove was introduced to Hawaii, and in 1998 there was still a small population in North Kona.[17] The mourning dove also appeared on Socorro Island, off the Western coast of Mexico, in 1988, sixteen years after the Socorro dove was extirpated from that island.[5]

Description[edit]

The mourning dove is a medium-sized, slender dove approximately 31 cm (12 in) in length. Mourning doves weigh 112–170 g (4.0–6.0 oz), usually closer to 128 g (4.5 oz).[18] The elliptical wings are broad, and the head is rounded. Its tail is long and tapered ("macroura" comes from the Greek words for "large" and "tail"[19]). Mourning doves have perching feet, with three toes forward and one reversed. The legs are short and reddish colored. The beak is short and dark, usually a brown-black hue.[6]

The plumage is generally light gray-brown and lighter and pinkish below. The wings have black spotting, and the outer tail feathers are white, contrasting with the black inners. Below the eye is a distinctive crescent-shaped area of dark feathers. The eyes are dark, with light skin surrounding them.[6] The adult male has bright purple-pink patches on the neck sides, with light pink coloring reaching the breast. The crown of the adult male is a distinctly bluish-grey color. Females are similar in appearance, but with more brown coloring overall and a little smaller than the male. The iridescent feather patches on the neck above the shoulders are nearly absent, but can be quite vivid on males. Juvenile birds have a scaly appearance, and are generally darker.[6]

All five subspecies of the mourning dove look similar and are not easily distinguishable.[6] The nominate subspecies possesses shorter wings, and is darker and more buff-colored than the "average" mourning dove. Z. m. carolinensis has longer wings and toes, a shorter beak, and is darker in color. The western subspecies has longer wings, a longer beak, shorter toes, and is more muted and lighter in color. The Panama mourning dove has shorter wings and legs, a longer beak, and is grayer in color. The Clarion Island subspecies possesses larger feet, a larger beak, and is darker brown in color.[7]

Habitat[edit]

The mourning dove occupies a wide variety of open and semi-open habitats, such as urban areas, farms, prairie, grassland, and lightly wooded areas. It avoids swamps and thick forest.[16] The species has adapted well to areas altered by humans. It commonly nests in trees in cities or near farmsteads.

Adult and squabs in cactus-protected nest, High Desert (California)

Migration[edit]

Most mourning doves migrate along flyways over land. On rare occasions, mourning doves have been seen flying over the Gulf of Mexico, but this is exceptional. Spring migration north runs from March to May. Fall migration south runs from September to November, with immatures moving first, followed by adult females and then by adult males.[15] Migration is usually during the day, in flocks, and at low altitudes.[16] However, not all individuals migrate. Even in Canada some mourning doves remain through winter, sustained by the presence of bird feeders.

Sounds[edit]

This species' call is a distinctive, plaintive cooOOoo-woo-woo-woooo, uttered by males to attract females, and may be mistaken for the call of an owl at first. (Close up, a grating or throat-rattling sound may be heard preceding the first coo.) Other sounds include a nest call (cooOOoo) by paired males to attract their mates to the nest sites, a greeting call (a soft ork) by males upon rejoining their mates, and an alarm call (a short roo-oo) by either male or female when threatened. In flight, the wings make a fluttery whistling sound that is hard to hear. The wing whistle is much louder and more noticeable upon take-off and landing.[6]

Reproduction[edit]

Adult

Courtship begins with a noisy flight by the male, followed by a graceful, circular glide with outstretched wings and head down. After landing, the male will approach the female with a puffed out breast, bobbing head, and loud calls. Mated pairs will often preen each other's feathers.[16]

The male then leads the female to potential nest sites, and the female will choose one. The female dove builds the nest. The male will fly about, gather material, and bring it to her. The male will stand on the female's back and give the material to the female, who then builds it into the nest.[20] The nest is constructed of twigs, conifer needles, or grass blades, and is of flimsy construction.[7] Mourning doves will sometimes requisition the unused nests of other mourning doves, other birds, or arboreal mammals such as squirrels.[21]

Most nests are in trees, both deciduous and coniferous. Sometimes, they can be found in shrubs, vines, or on artificial constructs like buildings,[7] or hanging flower pots.[20] When there is no suitable elevated object, mourning doves will nest on the ground.[7]

See link below for: courtship dance and mating.

The clutch size is almost always two eggs.[20] Occasionally, however, a female will lay her eggs in the nest of another pair, leading to three or four eggs in the nest.[22] The eggs are white, 6.6 ml (0.23 imp fl oz; 0.22 US fl oz), 2.57–2.96 cm (1.01–1.17 in) long, 2.06–2.30 cm (0.81–0.91 in) wide, 6–7 g (0.21–0.25 oz) at laying (5–6% of female body mass). Both sexes incubate, the male from morning to afternoon, and the female the rest of the day and at night. Mourning doves are devoted parents; nests are very rarely left unattended by the adults.[20] When flushed from the nest, an incubating parent may perform a nest-distraction display, or a broken-wing display, fluttering on the ground as if injured, then flying away when the predator approaches it.

Hatching and growth
Mourning Dove Egg.JPGMourning Dove Nesting 20060630.JPGMourning Dove Chicks 20060701.JPGZenaida macroura2.jpg
Egg in nestNesting in progressSquabsA juvenile

Incubation takes two weeks. The hatched young, called squabs, are strongly altricial, being helpless at hatching and covered with down.[20] Both parents feed the squabs pigeon's milk (dove's milk) for the first 3–4 days of life. Thereafter, the crop milk is gradually augmented by seeds. Fledging takes place in about 11–15 days, before the squabs are fully grown but after they are capable of digesting adult food.[21] They stay nearby to be fed by their father for up to two weeks after fledging.[16]

Mourning doves are prolific breeders. In warmer areas, these birds may raise up to six broods in a season.[16] This fast breeding is essential because mortality is high. Each year, mortality can reach 58% a year for adults and 69% for the young.[22]

The mourning dove is monogamous and forms strong pair bonds.[22] Pairs typically reconvene in the same area the following breeding season, and sometimes may remain together throughout the winter. However, lone doves will find new partners if necessary.

Ecology[edit]

Parent and two chicks in Arizona

Mourning doves eat almost exclusively seeds, which make up more than 99% of their diet. Rarely, they will eat snails or insects. Mourning doves generally eat enough to fill their crops and then fly away to digest while resting. They often swallow grit such as fine gravel or sand to assist with digestion. The species usually forages on the ground, walking but not hopping.[16] At bird feeders, mourning doves are attracted to one of the largest ranges of seed types of any North American bird, with a preference for canola, corn, millet, safflower, and sunflower seeds. Mourning doves do not dig or scratch for seeds, instead eating what is readily visible.[7] They will sometimes perch on plants and eat from there.[16]

Mourning doves show a preference for the seeds of certain species of plant over others. Foods taken in preference to others include pine nuts, sweetgum seeds, and the seeds of pokeberry, amaranth, canary grass, corn, sesame, and wheat.[7] When their favorite foods are absent, mourning doves will eat the seeds of other plants, including buckwheat, rye, goosegrass and smartweed.[7]

Mourning doves can be afflicted with several different parasites and diseases, including tapeworms, nematodes, mites, and lice. The mouth-dwelling parasite Trichomonas gallinae is particularly severe. While a mourning dove will sometimes host it without symptoms, it will often cause yellowish growth in the mouth and esophagus that will eventually starve the host to death. Avian pox is a common, insect-vectored disease.[23]

The primary predators of this species are diurnal birds of prey, such as falcons and hawks. During nesting, corvids, grackles, housecats, or rat snakes will prey on their eggs.[22] Cowbirds rarely parasitize mourning dove nests. Mourning doves reject slightly under a third of cowbird eggs in such nests, and the mourning dove's vegetarian diet is unsuitable for cowbirds.[24]

Behavior[edit]

Like other columbids, the mourning dove drinks by suction, without lifting or tilting its head. It often gathers at drinking spots around dawn and dusk.

Mourning doves sunbathe or rainbathe by lying on the ground or on a flat tree limb, leaning over, stretching one wing, and keeping this posture for up to twenty minutes. These birds can also waterbathe in shallow pools or bird baths. Dustbathing is common as well.

Pair of doves in late winter in Minnesota

Outside the breeding season, mourning doves roost communally in dense deciduous trees or in conifers. During sleep, the head rests between the shoulders, close to the body; it is not tucked under the shoulder feathers as in many other species. During the winter in Canada, roosting flights to the roosts in the evening, and out of the roosts in the morning, are delayed on colder days.[25]

Conservation status[edit]

Audubon's Carolina pigeon

The number of individual mourning doves is estimated to be approximately 475 million.[26] The large population and its vast range explain why the mourning dove is considered to be of least concern, meaning that the species is not at immediate risk.[14] As a gamebird, the mourning dove is well-managed, with more than 20 million (and up to 40–70 million) shot by hunters each year.[27]

As a symbol and in the arts[edit]

The eastern mourning dove (Z. m. carolinensis) is Wisconsin's official symbol of peace.[28] The bird is also Michigan's state bird of peace.[29]

The mourning dove appears as the Carolina turtle-dove on plate 286 of Audubon's Birds of America.[8]

References to mourning doves appear frequently in Native American literature. Mourning dove imagery also turns up in contemporary American and Canadian poetry in the work of poets as diverse as Robert Bly, Jared Carter,[30] Lorine Niedecker,[31] and Charles Wright.[32]

Musical artist Prince has also referenced the mourning dove in his song "When Doves Cry."

Closest related species[edit]

The mourning dove is a related species to the passenger pigeon (Ectopistes migratorius), which was hunted to extinction in the early 1900s.[33][34][35] For this reason, the possibility of using mourning doves for cloning the passenger pigeon has been discussed.[36]

References[edit]

  1. ^ BirdLife International (2012). "Zenaida macroura". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Torres, J.K. (1982) The Audubon Society Encyclopedia of North American Birds, Alfred A. Knopf, New York, p. 730, ISBN 0517032880
  3. ^ Bastin, E.W. (1952). "Flight-speed of the mourning dove". Wilson Bulletin 64 (1): 47. 
  4. ^ a b c d South American Classification Committee American Ornithologists' Union. "Part 3. Columbiformes to Caprimulgiformes". A classification of the bird species of South America. Retrieved 2006-10-11. 
  5. ^ a b "Check-list of North American Birds" (PDF). American Ornithologists' Union. 1998. p. 225. Retrieved 2007-06-29. 
  6. ^ a b c d e f g h Jonathan Alderfer (ed.). National Geographic Complete Birds of North America. p. 303. ISBN 0-7922-4175-4. 
  7. ^ a b c d e f g h i NRCS p3
  8. ^ a b Audubon, John James. "Plate CCLXXXVVI". Birds of America. ISBN 1-55859-128-1. Retrieved 2006-10-18. 
  9. ^ "100 Birds and How They Got Their Names, by Diana Wells (Algonquin Books of Chapel Hill, 2002) p.193)
  10. ^ "Pigeon". Encarta Online. Microsoft. Archived from the original on 2009-11-01. Retrieved 2007-02-17. 
  11. ^ Blockstein 2002, p. 4
  12. ^ Wilmer J., Miller (16 January 1969). "The Biology and Natural History of the Mourning Dove". Should Doves be Hunted in Iowa?. Ames, IA: Ames Audubon Society. Retrieved 23 April 2013. 
  13. ^ Brewer 1840, p. 717
  14. ^ a b Birdlife International. "Mourning Dove – BirdLife Species Factsheet". Retrieved 2006-10-08. 
  15. ^ a b "Mourning Dove (Zenaida macroura)" (PDF). Fish and Wildlife Habitat Management leaflet 31. National Resources Conservation Services (NRCS). February 2006. p. 2. Retrieved 2006-10-08. 
  16. ^ a b c d e f g h Kaufman, Kenn (1996). Lives of North American Birds. Houghton Mifflin. p. 293. ISBN 0-395-77017-3. 
  17. ^ "Check-list of North American Birds" (PDF). American Ornithologists' Union. 1998. p. 224. Retrieved 2007-06-29. 
  18. ^ Miller, Wilmer J. (1969-01-16). "The biology and Natural History of the Mourning Dove". Retrieved 2008-04-14. "Mourning doves weigh 4–6 ounces, usually close to the lesser weight." 
  19. ^ Borror, D.J. (1960). Dictionary of Word Roots and Combining Forms. Palo Alto: National Press Books. ISBN 0-87484-053-8. 
  20. ^ a b c d e "Mourning Dove". Cornell Lab of Ornithology. Retrieved 2006-10-18. 
  21. ^ a b NRCS p. 4
  22. ^ a b c d NRCS p. 1
  23. ^ NRCS p. 6
  24. ^ Peer, Brian and Bollinger, Eric (1998). "Rejection of Cowbird eggs by Mourning Doves: A manifestation of nest usurpation?" (PDF). The Auk 115 (4): 1057–1062. doi:10.2307/4089523. 
  25. ^ Doucette, D.R., and Reebs, S.G. (1994). "Influence of temperature and other factors on the daily roosting times of Mourning Doves in winter". Canadian Journal of Zoology 72 (7): 1287–1290. doi:10.1139/z94-171. 
  26. ^ Mirarchi, R.E., and Baskett, T.S. 1994. Mourning Dove (Zenaida macroura). In The Birds of North America, No. 117 (A. Poole and F. Gill, eds.). Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
  27. ^ Sadler, K.C. (1993) Mourning Dove harvest. In Ecology and management of the Mourning Dove (T.S. Baskett, M.W. Sayre, R.E. Tomlinson, and R.E. Mirarchi, eds.) Harrisburg, PA: Stackpole Books, ISBN 0811719405.
  28. ^ Wisconsin Historical Society. "Wisconsin State Symbols". Retrieved 2014-07-30. 
  29. ^ Audi, Tamara (2006-10-16). "Dove hunting finds place on Mich. ballot". USA Today. Retrieved 2006-10-25. 
  30. ^ Carter, Jared (1993) "Mourning Doves", in After the Rain, Cleveland State Univ Poetry Center, ISBN 0914946978
  31. ^ "Poetry". Friends of Lorine Niedecker. Retrieved 25 November 2012. 
  32. ^ Meditation on Song and Structure from Negative Blue: Selected Later Poems by Charles Wright
  33. ^ Facts. Save The Doves. Retrieved on 2013-03-23.
  34. ^ The Biology and natural history of the Mourning Dove. Ringneckdove.com. Retrieved on 2013-03-23.
  35. ^ The Mourning Dove in Missouri. the Conservation Commission of the State of Missouri (1990) mdc.mo.gov
  36. ^ Cloning Extinct Species, Part II. Tiger_spot.mapache.org. Retrieved on 2013-03-23.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Throughout North America, this species exhibits little mtDNA polymorphism and a shallow phylogeographic structure (Ball and Avise 1992). Zenaida graysoni and Z. macroura are considered conspecific by some authors (AOU 1983, but see Baptista et al. 1983). Zenaida macroura and Z. auriculata constitute a superspecies (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

mourning dove
turtle dove
wild dove
Carolina dove

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for the mourning dove is Zenaida
macroura (Linnaeus) [5,6,7,22,25]. Two subspecies breed in the United
States. Zenaida macroura ssp. carolinensis (Linnaeus) occurs east of
the Mississippi River,, and Z. macroura ssp. marginella (Woodhouse)
occurs in the western two-thirds of the United States [20,22,24]. The
western race is slightly smaller and paler than its eastern counterpart
[5]. A zone of overlap from Michigan through eastern Texas contains an
intermediate form of the two subspecies [20].
  • 7.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 5.  Brown, David E. 1989. Arizona game birds. Tucson, AZ: The University of        Arizona Press. 307 p.  [19900]
  • 6.  Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986.        Inventory and monitoring of wildlife habitat. Denver, CO: U.S.        Department of the Interior, Bureau of Land Management, Service Center.        858 p.  [3441]
  • 20.  Tomlinson, Roy E.; Dolton, David D.; Reeves, Henry M.; [and others]
  • 22.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]
  • 24.  American Ornithologists' Union. 1957. Checklist of North American birds.        5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p.  [21235]
  • 25.  Donohoe, Robert W. 1974. American hornbeam  Carpinus caroliniana Walt.        In: Gill, John D.; Healy, William M., eds. Shrubs and vines for        northeastern wildlife. Gen. Tech. Rep. NE-9. Upper Darby, PA: U.S.        Department of Agriculture, Forest Service, Northeastern Forest        Experiment Station: 86-88.  [13714]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!