Overview

Brief Summary

Biology

The blue-billed curassow feeds mainly on the ground (5), consuming fruit, shoots, invertebrates and perhaps even carrion (2). All cracids are largely monogamous and live in pairs, although some males have been observed with two or three mates (6). Breeding occurs in the dry season, with nesting extending from December to March, and parties of adults and chicks have been observed from March to August (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The blue-billed curassow is the most threatened cracid species in the world and amongst the most endangered of all birds (4). This large, mainly black species is the only curassow with a distinctive blue cere and wattles, earning the bird its common name (2) (5). The male is black with a white vent and tip to the tail, and the feathers on the crest are distinctively curled. Females are black with black-and-white crest feathers, and fine white barring on the wings and tail (2). A rare barred variety of females has been recorded on the northern slope of the Santa Marta Mountains, which also has black-and-white barring on its breast and upper belly, as well as more white plumage on its crest (5). The lower belly and undertail of females are a rufous colour (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species historically occurred in northern Colombia, from the base of the Sierra Nevada de Santa Marta west to the Sin valley and south in the Magdalena valley to northern Tolima. Two of the few large lowland forest areas remaining in its range have produced relatively recent records: two sites on the west slope of the Serrana de San Lucas, Antioquia (Cuervo and Salaman 1999, A. Cuervo in litt. 1999, L. Dvalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000) and the Serrana de las Quinchas, Boyac (Stiles et al. 1999). Few individuals are thought to remain at Serrana de San Lucas (D. Caro in litt. 2009), and surveys conducted in 2003 suggest that the latter area holds the population stronghold of this species which contributed to the establishment of El Paujl Bird Reserve (Quevedo et al. 2005). Numbers within this reserve have increased and the density of individuals has increased from 2.1 individuals/km2 to 4.7 individuals/km2 in 2009 (D. Caro in litt. 2009) but remains far below the projected carrying capacity of 1 in 10 acres. Anecdotal observations in 2009 are also indicative of a continued localised increase (Fundacin ProAves 2009). Additional records have been made in the Sierra Nevada de Santa Marta in recent years where the species has been confirmed at 17 sites (Strewe et al. 2010), and a density of 1.1 individuals/km2 was found in the Besotes Eco-Park, on the southeastern slope, in 2006-2007 (Mendoza et al. 2008). In 1993, sightings were reported at La Terretera near Alto Sin and in the Serrana de San Jacinto, Bolvar (R. S. R. Williams in litt. 1999). Records were also obtained in 2009 from the northern end of the Western Cordillera on the Serrana de San Jernimo, within the buffer zone of the Paramillo National Park (Mayorquin 2010). The population in the El Paujl Bird Reserve was estimated at 254 individuals in 2009, and based on the same density estimate the population in the surrounding area (including the reserve) is thought to be 509 individuals (D. Caro in litt. 2009). Local reports indicate that there has been a recent and rapid decline throughout its range (Cuervo and Salaman 1999, A. Cuervo in litt. 1999, L. Dvalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000, D. Caro in litt. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Humid forests of n Colombia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Confined to a few remnant forest patches of Northern Colombia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits humid forest up to 1,200 m, but there is at least one record from tropical dry forest(Strewe et al. 2010). It breeds in the dry season, nesting in December-March, with parties of adults and chicks observed in March-August (Cuervo and Salaman 1999, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). Two breeding seasons have been recorded in the El Paujl Bird Reserve, one from December to March and another from July to September(Uruea 2008b). It feeds on fruit, shoots, invertebrates, and perhaps even carrion(Cuervo and Salaman 1999, Quevedo et al. 2005, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). One recent survey recorded the consumption of seeds from a total of 15 different plant species. A terrestrial crab was also consumed. The species forages directly on the forest floor, and has never been observed foraging in a tree(Uruea 2008a). Roost sites, situated in foliage in trees, are near feeding areas and are used for several days (Hirschfeld 2008).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humid tropical forests in lowlands, foothills and lower mountain slopes, up to 1,200 m above sea level, but more commonly below 600 m (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crax alberti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGACTATTCTCAACTAACCACAAAGACATTGGCACCCTCTACTTAATTTTTGGCGCATGAGCAGGCATAGTAGGTACCGCACTAAGCCTGCTAATTCGTGCAGAACTCGGCCAACCAGGAACCTTGCTAGGAGAT---GACCAAATCTATAACGTAATTGTCACGGCCCATGCCTTCGTCATGATCTTCTTCATAGTAATACCAATCATAATCGGCGGTTTTGGGAACTGACTAGTCCCTCTCATAATTGGCGCGCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCTCCATCCTTTCTCCTCCTACTAGCCTCATCCACCGTAGAAGCTGGAGCTGGAACAGGATGAACCGTCTACCCACCCCTAGCAGGCAATCTAGCCCATGCTGGTGCTTCAGTGGACCTGGCCATCTTCTCCCTCCATCTAGCAGGTATTTCCTCCATCCTGGGAGCAATTAACTTTATTACCACTGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACTCCTCTGTTTGTATGATCAGTCCTCATTACTGCCATCCTACTCTTACTATCCCTACCAGTCCTGGCAGCTGGCATCACCATGCTCCTCACCGATCGTAACCTTAACACTACATTCTTCGACCCAGCTGGGGGTGGAGACCCAGTTCTATATCAACACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATTCTTATTCTCCCTGGCTTCGGAATCATTTCCCACGTAGTAGCATACTACGCCGGCAAAAAGGAACCGTTCGGCTACATAGGAATAGTATGAGCAATATTATCAATCGGATTCCTCGGCTTCATCGTATGGGCCCACCACATATTTACAGTCGGCATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crax alberti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A3bcd

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Cuervo, A., Dvalos, L., Gonzlez, J., Ochoa, J., Olarte, L., Renjifo, L., Salaman, P., Williams, R. & Olaciregui , C.

Justification
The rate of deforestation in this species's range has been very rapid over the past decade, such that little habitat remains. It is projected that it could undergo an extremely rapid population reduction given increased access and hunting, and therefore qualifies as Critically Endangered.


History
  • 2012
    Critically Endangered (CR)
  • Critically Endangered (CR)
  • Critically Endangered (CR)
  • Critically Endangered (CR)
  • Critically Endangered (CR)
  • Critically Endangered (CR)
  • Critically Endangered (CR)
  • Critically Endangered (CR)
  • Threatened (T)