Overview

Brief Summary

Biology

The blue-billed curassow feeds mainly on the ground (5), consuming fruit, shoots, invertebrates and perhaps even carrion (2). All cracids are largely monogamous and live in pairs, although some males have been observed with two or three mates (6). Breeding occurs in the dry season, with nesting extending from December to March, and parties of adults and chicks have been observed from March to August (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The blue-billed curassow is the most threatened cracid species in the world and amongst the most endangered of all birds (4). This large, mainly black species is the only curassow with a distinctive blue cere and wattles, earning the bird its common name (2) (5). The male is black with a white vent and tip to the tail, and the feathers on the crest are distinctively curled. Females are black with black-and-white crest feathers, and fine white barring on the wings and tail (2). A rare barred variety of females has been recorded on the northern slope of the Santa Marta Mountains, which also has black-and-white barring on its breast and upper belly, as well as more white plumage on its crest (5). The lower belly and undertail of females are a rufous colour (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species historically occurred in northern Colombia, from the base of the Sierra Nevada de Santa Marta west to the Sinú valley and south in the Magdalena valley to northern Tolima. Two of the few large lowland forest areas remaining in its range have produced relatively recent records: two sites on the west slope of the Serranía de San Lucas, Antioquia (Cuervo and Salaman 1999, A. Cuervo in litt. 1999, L. Dávalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000) and the Serranía de las Quinchas, Boyacá (Stiles et al. 1999). Few individuals are thought to remain at Serranía de San Lucas (D. Caro in litt. 2009), and surveys conducted in 2003 suggest that the latter area holds the population stronghold of this species which contributed to the establishment of El Paujíl Bird Reserve (Quevedo et al. 2005). Numbers within this reserve have increased and the density of individuals has increased from 2.1 individuals/km2 to 4.7 individuals/km2 in 2009 (D. Caro in litt. 2009) but remains far below the projected carrying capacity of 1 in 10 acres. Anecdotal observations in 2009 are also indicative of a continued localised increase (Fundación ProAves 2009). Additional records have been made in the Sierra Nevada de Santa Marta in recent years where the species has been confirmed at 17 sites (Strewe et al. 2010), and a density of 1.1 individuals/km2 was found in the Besotes Eco-Park, on the southeastern slope, in 2006-2007 (Mendoza et al. 2008). In 1993, sightings were reported at La Terretera near Alto Sinú and in the Serranía de San Jacinto, Bolívar (R. S. R. Williams in litt. 1999). Records were also obtained in 2009 from the northern end of the Western Cordillera on the Serranía de San Jerónimo, within the buffer zone of the Paramillo National Park (Mayorquin 2010). The population in the El Paujíl Bird Reserve was estimated at 254 individuals in 2009, and based on the same density estimate the population in the surrounding area (including the reserve) is thought to be 509 individuals (D. Caro in litt. 2009). Local reports indicate that there has been a recent and rapid decline throughout its range (Cuervo and Salaman 1999, A. Cuervo in litt. 1999, L. Dávalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000, D. Caro in litt. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Humid forests of n Colombia.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Confined to a few remnant forest patches of Northern Colombia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits humid forest up to 1,200 m, but there is at least one record from tropical dry forest(Strewe et al. 2010). It breeds in the dry season, nesting in December-March, with parties of adults and chicks observed in March-August (Cuervo and Salaman 1999, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). Two breeding seasons have been recorded in the El Paujíl Bird Reserve, one from December to March and another from July to September(Urueña 2008b). It feeds on fruit, shoots, invertebrates, and perhaps even carrion(Cuervo and Salaman 1999, Quevedo et al. 2005, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). One recent survey recorded the consumption of seeds from a total of 15 different plant species. A terrestrial crab was also consumed. The species forages directly on the forest floor, and has never been observed foraging in a tree(Urueña 2008a). Roost sites, situated in foliage in trees, are near feeding areas and are used for several days (Hirschfeld 2008).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Humid tropical forests in lowlands, foothills and lower mountain slopes, up to 1,200 m above sea level, but more commonly below 600 m (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Crax alberti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Crax alberti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGACTATTCTCAACTAACCACAAAGACATTGGCACCCTCTACTTAATTTTTGGCGCATGAGCAGGCATAGTAGGTACCGCACTAAGCCTGCTAATTCGTGCAGAACTCGGCCAACCAGGAACCTTGCTAGGAGAT---GACCAAATCTATAACGTAATTGTCACGGCCCATGCCTTCGTCATGATCTTCTTCATAGTAATACCAATCATAATCGGCGGTTTTGGGAACTGACTAGTCCCTCTCATAATTGGCGCGCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCTCCATCCTTTCTCCTCCTACTAGCCTCATCCACCGTAGAAGCTGGAGCTGGAACAGGATGAACCGTCTACCCACCCCTAGCAGGCAATCTAGCCCATGCTGGTGCTTCAGTGGACCTGGCCATCTTCTCCCTCCATCTAGCAGGTATTTCCTCCATCCTGGGAGCAATTAACTTTATTACCACTGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACTCCTCTGTTTGTATGATCAGTCCTCATTACTGCCATCCTACTCTTACTATCCCTACCAGTCCTGGCAGCTGGCATCACCATGCTCCTCACCGATCGTAACCTTAACACTACATTCTTCGACCCAGCTGGGGGTGGAGACCCAGTTCTATATCAACACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATTCTTATTCTCCCTGGCTTCGGAATCATTTCCCACGTAGTAGCATACTACGCCGGCAAAAAGGAACCGTTCGGCTACATAGGAATAGTATGAGCAATATTATCAATCGGATTCCTCGGCTTCATCGTATGGGCCCACCACATATTTACAGTCGGCATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A3bcd

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Cuervo, A., Dávalos, L., González, J., Ochoa, J., Olarte, L., Renjifo, L., Salaman, P., Williams, R. & Olaciregui , C.

Justification
The rate of deforestation in this species's range has been very rapid over the past decade, such that little habitat remains. It is projected that it could undergo an extremely rapid population reduction given increased access and hunting, and therefore qualifies as Critically Endangered.


History
  • 2012
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Proposed Endangered
Date Listed:
Lead Region: Foreign (Region 10) 
Where Listed:


For most current information and documents related to the conservation status and management of Crax alberti, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR A3bcd) on the IUCN Red List 2004 (1), and listed under Appendix III of CITES in Colombia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population in the El Paujíl Bird Reserve was estimated a maximum of 254 individuals in 2009, whilst surrounding area (including the reserve) may hold up to 509 individuals. There are several populations elsewhere, but these are thought to be severely declining or already locally extinct (D. Caro in litt. 2010), hence a populations band of 250-999 individuals is appropriate. This equates to 167-666 mature individuals, rounded here to 150-700 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species may be tolerant of low levels of habitat degradation (Strewe et al. 2010); however, its range is affected by outright habitat loss and severe degradation. Vast areas of forest have been cleared since the 17th century, and are used for livestock-farming, arable cultivation, cotton and illegal drug plantations, oil extraction and mining (Dinerstein et al. 1995, Cuervo and Salaman 1999, Stiles et al. 1999, Strewe et al. 2010, L. G. Olarte in litt. 1993, L. M. Renjifo in litt. 1993, A. Cuervo in litt. 1999, L. Dávalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000, J. D. González in litt. 2005, J. M. Ochoa in litt. 2005). Deforestation outside of the El Paujíl Bird Reserve is accelerating at an annual rate of 2.1-7%; Machado and Salaman 2008/2009). Cultivation (notably of coffee), logging and marijuana-plantation expansion and subsequent government spraying with non-specific herbicides affect the Sierra Nevada de Santa Marta (Dinerstein et al. 1995, Strewe et al. 2010, L. G. Olarte in litt. 1993, L. M. Renjifo in litt. 1993). Colonisation and deforestation for coca farming are the principal threats acting around the El Paujíl Bird Reserve (Quevedo et al. 2005). In 1996, there was a gold rush in the Serranía de San Lucas and most of the eastern slopes have since been settled, logged and converted to agriculture and coca production (A. Cuervo in litt. 1999, L. Dávalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). Few individuals are thought to remain in this area due to hunting (D. Caro in litt. 2009). Hunting and egg-collecting for food have contributed to past and present declines, and a recent survey of villages surrounding the Paramillo National Park suggests these activities will continue into the future unless the economic situation of the villagers improves (Cabarcas et al. 2008, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). The species is also threatened by infrastructure development, as exemplified by the Santa Marta-Riohacha Highway, which acts as a barrier between populations in Tayrona National Park and the foothills of the Sierra Marta de Santa Marta (Strewe et al. 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The blue-billed curassow has been dramatically impacted by the rapid rate of deforestation across its range due to the expansion of agriculture, cattle farming, mining activities, logging operations and human population growth (2) (6). The loss of habitat has been so extensive that little now remains (2). Additionally, this species is prized by hunters, and is particularly vulnerable during the breeding season because of the conspicuous vocalisations performed by the males, making them easy to locate. At this time, the eggs are also taken from the nests to incubate and rear for trade and consumption (6). Sadly, loss and fragmentation of habitat only serves to facilitate easier access to the bird for poachers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
El Paujíl Bird Reserve was established in 2004, covering 848 ha in the Magdelena Valley, Serranía de las Quinchas, and local authorities have introduced penalties for shooting or trapping the species (R. S. R. Williams in litt. 1999). Fundación ProAves continue to purchase land to expand the reserve and are also engaging in habitat restoration within its boundaries (D. Caro in litt. 2009). ProAves aims to expand the reserve to c.6,000 ha in the next two years (Machado and Salaman 2008/2009). Paramillo National Park is vast and holds this species, but no protective measures have been implemented (P. G. W. Salaman in litt. 1999, 2000). The large Bajo Cauca-Nechí Regional Reserve probably holds the species (A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). Los Colorados Sanctuary protects part of the Serranía de San Jacinto (R. S. R. Williams in litt. 1999). It occurs in Sierra Nevada de Santa Marta and Tayrona National Parks (Fundación ProAves 2009), and potentially in the Cañon del Río Alicante and Los Besotes reserves (Quevedo et al. 2006). Of all of the reserves listed above, only El Paujíl Bird Reserve is thought to receive adequate protection to safeguard this species (Quevedo et al. 2006). Since 2006, ProAves has been engaged in a variety of awareness-raising initiatives in three villages within the Serranía de las Quinchas buffer zone, including training courses on bird monitoring and for park rangers and the annual Paujil Festival (Urueña et al. undated, Quevedo et al. 2008). Studies of population density and structure, as well as habitat use and behaviour of the species have been ongoing at the El Paujíl Bird Reserve since 2004 (Urueña et al. undated). Further surveys are planned in the south-western limits of the species's range in order to delimit additional IBAs for its conservation. Fundación ALPEC is working to create a habitat corridor to connect protected areas in the lowlands to the foothills of the Sierra Nevada de Santa Marta through a network of private reserves (Strewe et al. 2010). A reintroduction programme was initiated in 2011 with the intention that when captive breeding is successful individuals will be reintroduced (Fundacion ProAves 2011).

Conservation Actions Proposed
Determine its population and distribution more accurately and confirm its persistence in the serranías de San Jacinto and de las Quinchas, and the upper Sinú drainage (Cuervo and Salaman 1999, Stiles et al. 1999, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000. Protect forests on the serranías de San Lucas and de las Quinchas (Stiles et al. 1999, A. Cuervo in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). Implement effective conservation measures in existing protected areas (L. Dávalos in litt. 1999, P. G. W. Salaman in litt. 1999, 2000). Initiate educational campaigns to limit hunting, and provide resources to replace the need for habitat conversion (A. Cuervo in litt. 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

South America's newest nature reserve, Reserva Natural El Paujil, was established in 2004 by the Colombian bird conservation NGO, Fundación ProAves (2) (7). It is in the Serranía de las Quinchas, the sole surviving block of Magdalena Valley Humid Forest. The reserve, which is named after the local name for this species, El Paujil, is a major refuge for threatened endemic species and is thought to contain the most significant surviving population of the blue-billed curassow (7). Penalties have been introduced here for shooting or trapping species (2), and ProAves is planning to purchase a further 5,000 ha of forest adjoining the reserve (7). Other reserves also exist, such as the Bajo Cauca-Nechí Regional Reserve, which has been recently declared and probably holds this species, and the vast Paramillo National Park, but no protective measures have been implemented here (2). A captive breeding programme has been established by Fundación Ecolombia in the Wildlife Rehabilitation Centre Los Farallones, although this has so far been unsuccessful. Thus, artificial insemination is being considered as an option for improving results (8). Breeding in captivity has been successful in collections elsewhere (5), however, and certainly provides a viable method of conserving this critically endangered species, with the hope that such birds can someday be released back into their newly protected habitat in the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-billed curassow

The blue-billed curassow (Crax alberti) or blue-knobbed curassow is a species of bird in the Cracidae family, which includes the chachalacas, guans, and curassows.

It is found only in Colombia; areas of its range in the south and east are bordered by the Magdalena River. Its natural habitat is subtropical or tropical moist lowland forests. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!