Chamaepetes unicolor — Details

Black Guan learn more about names for this taxon

Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range

Learn more about this article

Montane forests of Costa Rica and w Panama.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

Chamaepetes unicolor is rare to locally fairly common throughout the highlands of Costa Rica and in Chiriquí, Bocas del Toro, Veraguas (Calovévora and Sante Fe) and west Coclé, west Panama5,6. It is common (estimated density of 7.4 birds/km2) in the Monteverde Cloud Forest Preserve, Costa Rica2, and large areas of suitable habitat are protected in La Amistad International Park and the Cordillera de Guanacaste7. This suggests that the 1994 population estimate of 800-1,000 birds in Costa Rica8 is too low. In Panama, it was reported as locally common in the 1930s, uncommon and local in 19714, and rare to locally fairly common (e.g. in Fortuna Forest Reserve) in the 1980s5. The species was found to be fairly common at Cerro Pena Blanca, west of El Cope, in 200110.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
This frugivore inhabits montane cloud forest, preferring steep terrain with ridges and ravines5,6,9. It typically occurs at elevations of 900-2,250 m but has been recorded to 450 m 5. In Panama, young birds have been seen in February and June, and pairing has been observed to begin in March in Costa Rica, with both very young chicks and almost full-grown young seen in July4. It lays 2-3 eggs4.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chamaepetes unicolor

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATTTTTGGCACATGAGCAGGCATAGTAGGCACCGCACTAAGCCTGTTAATTCGCGCAGAACTCGGCCAACCAGGAACCCTGCTAGGAGACGACCAAATCTACAATGTAATTGTCACGGCCCATGCCTTCGTCATAATCTTCTTCATAGTAATACCAATCATAATCGGCGGCTTCGGAAACTGACTAGTCCCTCTCATGATCGGCGCACCTGACATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTTCTCCTCCTACTAGCCTCATCCACCGTAGAAGCTGGGGCCGGGACAGGATGAACCGTCTATCCCCCCCTGGCAGGCAACTTAGCCCACGCTGGTGCCTCAGTAGACCTAGCCATCTTCTCTCTTCACCTGGCAGGTGTCTCCTCCATCTCAGGGGCAATCAACTTTATTACTACCGCCATTAACATAAAACCCCCAGCCCTCTCACAATATCAAACCCCCCTATTCGTATGATCAGTCCTTATCACTGCCATCCTGCTCTTATTATCCCTTCCTGTTCTAGCAGCTGGCATCACCATGCTCCTCACCGACCGTAATCTTAATACCACATTCTTTGACCCAGCCGGAGGCGGAGACCCAGTTCTATATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Chamaepetes unicolor

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Taylor, J., Butchart, S.

Contributor/s
Brooks, D., Stiles, F., Angehr, G., Adsett, W.

Justification
This species is listed as Near Threatened because it occupies a small range, in which it is threatened by hunting and limited habitat loss and degradation. The proliferation of protected areas in Costa Rica and Panama is likely to have reduced the threats to this species's habitat. However, if these threats prove to be serious, the species may be uplisted to a higher threat category.

History
  • 2004
    Near Threatened
  • 1988
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population

Learn more about this article

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Major Threats
This species is much hunted for food4. Highland forests have suffered burning, logging and conversion to intensive agriculture3, and in east Chiriquí only isolated patches of forest remain above 1,000 m 1. However, the extent of fragmentation is less than in lowland areas and, where not hunted for food, it persists in forest edge and secondary growth adjacent to undisturbed forest5,7,8. In Panama a belt of nearly continuous forest remains along the cordillera from the Costa Rican border to just east of El Cope, although continuity may be lost in future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
Conservation Actions Underway
This species occurs in numerous protected areas, including private reserves.

Conservation Actions Proposed
Conduct surveys to obtain an up-to-date total population estimate. Monitor population trends through regular surveys. Monitor rates of habitat loss and degradation across its range. Assess whether hunting is still a serious threat, and in which areas it is most severe. Protect remaining substantial tracts of cloud forest. Encourage the restoration of cloud forests, especially to link remaining fragments.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Black Guan

Learn more about this article

The Black Guan (Chamaepetes unicolor) is a species of bird in the Cracidae family. It is found in Costa Rica and Panama. Its natural habitat is subtropical or tropical moist montane forests. It is threatened by habitat loss. This species is listed as Near Threatened because it occupies a small range, in which it is threatened by hunting and limited habitat loss and degradation.

Monteverde, Costa Rica

References

Wikimedia Commons has media related to: Chamaepetes unicolor
Wikispecies has information related to: Chamaepetes unicolor
Stub iconThis Galliformes article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!