Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Overview

The Black Guan (Chamaepetes unicolor) is a species of bird in the Cracidae family. It is found in Costa Rica and Panama. Its natural habitat is subtropical or tropical moist montane forests.

Read more...

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia Editors and contributors

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Chamaepetes unicolor is rare to locally fairly common throughout the highlands of Costa Rica and in Chiriquí, Bocas del Toro, Veraguas (Calovévora and Sante Fe) and west Coclé, west Panama (Ridgely and Gwynne 1989, Stiles and Skutch 1989). It is common (estimated density of 7.4 birds/km2) in the Monteverde Cloud Forest Preserve, Costa Rica (D. Brooks in litt. 2000), and large areas of suitable habitat are protected in La Amistad International Park and the Cordillera de Guanacaste (F. G. Stiles in litt. 1999). This suggests that the 1994 population estimate of 800-1,000 birds in Costa Rica (Strahl et al. 1994) is too low. In Panama, it was reported as locally common in the 1930s, uncommon and local in 1971 (del Hoyo 1994), and rare to locally fairly common (e.g. in Fortuna Forest Reserve) in the 1980s (Ridgely and Gwynne 1989). The species was found to be fairly common at Cerro Pena Blanca, west of El Cope, in 2001 (G. Angehr in litt. 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Montane forests of Costa Rica and w Panama.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Talamancan Montane Forests Habitat

This taxon occurs in the Talamancan montane forests, an ecoregion situated along the mountainous spine of the Cordillera Talamanca within Costa Rica and Panama. These forests represent one of Central America’s most intact habitats. The steep slopes, remoteness and relatively cool temperatures have limited the impact of agriculture and human development in most of this area.

This region exhibits considerable floral and faunal species diversity, many of which taxa are endemic. Over 30 percent of the ecoregion's flora, including over 10,000  vascular and 4000 non-vascular plant species, are endemic to this area, as are a number of fauna species. Nearly 75 percent of original forest cover remains intact, with forty percent protected by national and international parks.

The rainfall and temperature in this area of Central America is a direct result of the elevation and orientation north or south side of the mountain range. The average temperature and rainfall for this part of Costa Rica varies from 25°C and 2000 millimetres (mm) at the Caribbean Sea level to –8° C and >6000 mm at the highest peaks including Cerro Chirripo, the highest point in southern Central America at 3820 m. The high humidity and precipitation (which averages between 2500 and 6500 mm annually), steep slopes, and cool temperatures have limited agricultural and urban development, making these highland moist forests one of Central America's most intact ecosystems.

The forest habitats of this ecoregion include Atlantic slope "aseasonal" rainforest, Pacific slope seasonally dry but mostly evergreen forest, and "perpetually dripping cloud forest" on the mountain tops, above approximately 1500 m. The high annual rainfall, wind-blown mist, and frequent presence of clouds, probably the most outstanding characteristic of these montane forests, produce a lush, dense forest with a broken canopy and high species diversity. Abundant epiphytes cover tree branches, and tree ferns are common. Dominant tree groups include the Lauraceae family, especially in the northern section of the ecoregion, and endemic oaks (Quercus spp.), especially in the south. The unique oak forest stands in this ecoregion are characterized by majestic, tall trees (up to 50 m tall), heavily dominated by two species: Quercus costaricensis and Q. copeyensis, while Magnolia, Drymis, and Weinmannia are also important tree elements. The understory is characterized by the presence of several species of dwarf bamboo (Chusquea). Higher peaks and ridges exposed to moisture-laden trade winds support an elfin, or dwarf forest characterized by thick mats of bryophytes covering short, dense gnarled trees.

Seismically induced phenomena, volcanism, and landslides (triggered by torrential rains or earthquakes) are the major natural disturbances influencing the montane forest units within the Talamancan Range. The resulting steep slopes and nutrient-deficient soils insure that this ecoregion harbors some of the most intact in Central America. The La Amistad International Park, one of the largest reserves in Central America, consists of over 400,000 hectares of relatively intact montane forest. These larger blocks of intact forest are essential for preserving remnant populations of harpy eagles (Harpia harpyja) and they protect breeding grounds of threatened and endangered birds endemic to the highland forests of this ecoregion, such as: resplendent quetzal (Pharomacrus mocinno), three-wattled bellbird (Procnias tricarunculata), bare-necked umbrellabird (Cephalopterus glabricollis), and black guan (Chamaepetes unicolor). The first three of these birds migrate seasonally to lower elevations, demonstrating the importance of not only maintaining intact highland habitats but also connecting them to neighboring intact middle and lower elevations. In fact, over 65 (or over ten percent) of the bird species found here migrate altitudinally.

The Atlantic middle elevations also contain some of the most rare species of  butterflies Central America, as well as some of the world's highest butterfly species richness. Populations of crested eagle and painted parakeet were recently discovered in Cerro Hoya on the Azuero Peninsula.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
This frugivore inhabits montane cloud forest, preferring steep terrain with ridges and ravines (Wheelwright et al. 1984, Ridgely and Gwynne 1989, Stiles and Skutch 1989). It typically occurs at elevations of 900-2,250 m but has been recorded to 450 m (Ridgely and Gwynne 1989). In Panama, young birds have been seen in February and June, and pairing has been observed to begin in March in Costa Rica, with both very young chicks and almost full-grown young seen in July (del Hoyo 1994). It lays 2-3 eggs (del Hoyo 1994).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chamaepetes unicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATTTTTGGCACATGAGCAGGCATAGTAGGCACCGCACTAAGCCTGTTAATTCGCGCAGAACTCGGCCAACCAGGAACCCTGCTAGGAGACGACCAAATCTACAATGTAATTGTCACGGCCCATGCCTTCGTCATAATCTTCTTCATAGTAATACCAATCATAATCGGCGGCTTCGGAAACTGACTAGTCCCTCTCATGATCGGCGCACCTGACATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTTCTCCTCCTACTAGCCTCATCCACCGTAGAAGCTGGGGCCGGGACAGGATGAACCGTCTATCCCCCCCTGGCAGGCAACTTAGCCCACGCTGGTGCCTCAGTAGACCTAGCCATCTTCTCTCTTCACCTGGCAGGTGTCTCCTCCATCTCAGGGGCAATCAACTTTATTACTACCGCCATTAACATAAAACCCCCAGCCCTCTCACAATATCAAACCCCCCTATTCGTATGATCAGTCCTTATCACTGCCATCCTGCTCTTATTATCCCTTCCTGTTCTAGCAGCTGGCATCACCATGCTCCTCACCGACCGTAATCTTAATACCACATTCTTTGACCCAGCCGGAGGCGGAGACCCAGTTCTATATCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chamaepetes unicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Adsett, W., Angehr, G., Brooks, D. & Stiles, F.

Justification
This species is listed as Near Threatened because it occupies a small range, in which it is threatened by hunting and limited habitat loss and degradation. The proliferation of protected areas in Costa Rica and Panama is likely to have reduced the threats to this species's habitat. However, if these threats prove to be serious, the species may be uplisted to a higher threat category.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is much hunted for food (del Hoyo 1994). Highland forests have suffered burning, logging and conversion to intensive agriculture (Dinerstein et al. 1995), and in east Chiriquí only isolated patches of forest remain above 1,000 m (W. J. Adsett in litt. 1993). However, the extent of fragmentation is less than in lowland areas and, where not hunted for food, it persists in forest edge and secondary growth adjacent to undisturbed forest (Ridgely and Gwynne 1989, Strahl et al. 1994, F. G. Stiles in litt. 1999). In Panama a belt of nearly continuous forest remains along the cordillera from the Costa Rican border to just east of El Cope, although continuity may be lost in future.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
This species occurs in numerous protected areas, including private reserves.

Conservation Actions Proposed
Conduct surveys to obtain an up-to-date total population estimate. Monitor population trends through regular surveys. Monitor rates of habitat loss and degradation across its range. Assess whether hunting is still a serious threat, and in which areas it is most severe. Protect remaining substantial tracts of cloud forest. Encourage the restoration of cloud forests, especially to link remaining fragments.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!