Articles on this page are available in 1 other language: Spanish (20) (learn more)

Overview

Comprehensive Description

Penelope purpurascens (crested guan) is endemic to Central America, specifically ranging from southern Mexico to Venezuela and Ecuador (Chaves-Campos, 2003). They populate tropical and subtropical moist lowland to midland forest (about 1850 m in elevation) (Chaves-Campos, 2003).

Crested guans are about the size of pheasants, with a dark bluish face, red eyes and a red dewlap of skin beneath the pointed beak (Gilbert et al., 2013). The feathering is dark brown or black with a crest of taller feathers atop its head, and a set of long tail feathers. The crested guan is monogamous, but lives in flocks of about six to eight pairs (Gilbert et al., 2013). These birds have a diverse, generalist frugivorous diet, and are essential for seed dispersal (Brooks and Strahl, 2000, Muñoz and Kattan, 2007). They also eat some flowers and invertebrates in addition to fruit (Muñoz and Kattan, 2007). Guans are mainly arboreal, rarely leaving the canopy (Brooks and Fuller, 2006). The call of the crested guan is a loud and honk-like, and a distinct “wing-whirring” display is used during courtship, creating a fast vibrating call (Ridgely, 1989).

Crested guan abundance increases at higher elevations during the reproductive season, around June, and then the crested guans retreat to lowland when the season is over (Chaves-Campos, 2003). There is also seasonal migration related to fruit abundance (Muñoz and Kattan, 2007). This altitudinal migration is a cause for conservation concern, because forest corridors between lowland and higher elevations need to be maintained to ensure population growth and survival (Chaves-Campos, 2003).

Crested guans belong to the Cracid family (Brooks and Strahl, 2000), which are the most endangered family in the Neotropics (Brooks and Fuller, 2006).  The population is in decline due to hunting and habitat loss (Muñoz and Kattan, 2007). Due to their sensitivity to environmental change, guans and other Cracids are used as ecological indicators in the Neotropics (Brooks and Strahl, 2000).

  • BROOKS, D. M. AND R. A. FULLER. 2006. Conserving Cracids: The most threatened family
  • of birds in the Americas. Miscellaneous Publications of Houston Museum of Natural Science, number 6. Houston, Texas, USA.
  • BROOKS, D. M. AND S. D. STRAHL. 2000. Curassows, guans, and chacalacas. Status survey
  • and conservation action plan for Crasids, 2000-2004. Information Press, Oxford, UK.
  • CHAVES-CAMPOS, J. 2003. Changes in abundance of crested guan (Penelope
  • purpurascens) and black guan (Chamaepetes unicolor) along an altitudinal gradient in Costa Rica. Ornitología Neotropical 14: 195-200.
  • GILBERT, KADEEM, AND T. S. SCHULENBERG. 2013. Crested guan (Penelope purpurascens).
  • Website http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=78311 [Accessed 3 March 2014].
  • MUNOZ, M. C. AND G. H. KATTAN. 2007. Diets of Cracids: How much do we know?
  • Ornitología Neotropical 18: 21-36.
  • RIDGELY, R. S. 1989. The crested guan. In A guide to the birds of Panama. 114-115.
  • Princeton University Press, Princeton, New Jersey, USA.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Gtsawyer

Supplier: Gtsawyer

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Penelope purpurascens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACTTAATTTTCGGCACATGAGCAGGCATAGTAGGCACCGCACTAAGCCTGCTAATTCGCGCAGAGCTTGGCCAACCAGGAACCCTACTAGGAGACGACCAAATCTACAACGTAATCGTCACAGCCCATGCCTTCGTCATAATCTTCTTCATAGTCATACCAATCATAATTGGCGGCTTTGGAAACTGACTAGTTCCTCTCATAATCGGCGCGCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTTCTTCTTCTACTAGCCTCATCCACCGTAGAAGCTGGAGCCGGAACAGGATGAACCGTCTACCCTCCCCTAGCAGGAAACCTAGCCCACGCTGGCGCTTCAGTAGACCTAGCCATCTTTTCCCTTCACCTGGCAGGTGTCTCCTCTATCCTAGGGGCAATCAACTTTATTACCACCGCCATTAACATAAAACCCCCAGCCCTCTCACAATACCAAACTCCTCTGTTCGTATGATCAGTCCTTATCACCGCCATCCTACTTTTATTATCCCTCCCCGTCCTAGCAGCTGGCATCACCATGCTCCTCACCGACCGTAATCTTAATACCACATTCTTTGACCCAGCCGGAGGCGGAGACCCAGTTCTATATCAACACCTCTTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Penelope purpurascens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number fewer than 50,000 individuals (A. Panjabi in litt. 2008), thus it is placed in the band 20,000-49,999 individuals here.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Crested Guan

The crested guan (Penelope purpurascens) is a member of an ancient group of birds of the Cracidae family, which are related to the Australasian mound builders. It breeds in lowlands from south Mexico and the Yucatán Peninsula to western Ecuador and southern Venezuela at up to 1,850 m (6,070 ft) altitude.

The crested guan is an arboreal forest species. The substantial twig nest is built in a tree or stump and lined with leaves. The female lays two or three large rough-shelled white eggs and incubates them alone.

This is a large gamebird, with a length varying from 84 to 91.5 cm (33.1 to 36.0 in). These birds commonly weigh around 1,750 g (3.86 lb), though can weigh as little as 1,361 g (3.000 lb) in P. p. brunnescens, the smallest race on average. Among standard measurements, the wing chord is 33 to 42.8 cm (13.0 to 16.9 in), the tail is 34 to 41.5 cm (13.4 to 16.3 in) and the tarsus is 7.4 to 9.1 cm (2.9 to 3.6 in).[2][3] It is similar in general appearance to a turkey, with a small head, long strong red legs, and a long broad tail. It is mainly dark brown, with white spotting on the neck and breast. The rump and belly are rufous. The head sports a bushy crest, from which the species gets its name, blue-grey bare skin around the eye, and a bare red dewlap or wattle.

The sexes are similar, but young birds have black vermiculations and ochre specks on the body plumage.

The crested guan is a noisy bird with a loud plee or quonk call, a whistled contact call and a powerful keLEEEErrrr! dawn song.

This is a social bird, often seen in pairs or family groups of 6–12. It walks along branches seeking the fruit and foliage on which it feeds, or flies off with a heavy ani-like flap and glide.

The range of this species has severely contracted outside remote or protected forests due to deforestation and hunting.

A crested guan in the wild on Barro Colorado Island, Panama

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!