Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Penelope purpurascens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACTTAATTTTCGGCACATGAGCAGGCATAGTAGGCACCGCACTAAGCCTGCTAATTCGCGCAGAGCTTGGCCAACCAGGAACCCTACTAGGAGACGACCAAATCTACAACGTAATCGTCACAGCCCATGCCTTCGTCATAATCTTCTTCATAGTCATACCAATCATAATTGGCGGCTTTGGAAACTGACTAGTTCCTCTCATAATCGGCGCGCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTTCTTCTTCTACTAGCCTCATCCACCGTAGAAGCTGGAGCCGGAACAGGATGAACCGTCTACCCTCCCCTAGCAGGAAACCTAGCCCACGCTGGCGCTTCAGTAGACCTAGCCATCTTTTCCCTTCACCTGGCAGGTGTCTCCTCTATCCTAGGGGCAATCAACTTTATTACCACCGCCATTAACATAAAACCCCCAGCCCTCTCACAATACCAAACTCCTCTGTTCGTATGATCAGTCCTTATCACCGCCATCCTACTTTTATTATCCCTCCCCGTCCTAGCAGCTGGCATCACCATGCTCCTCACCGACCGTAATCTTAATACCACATTCTTTGACCCAGCCGGAGGCGGAGACCCAGTTCTATATCAACACCTCTTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Penelope purpurascens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number <50,000 individuals (A. Panjabi in litt. 2008), which is placed in the band 20,000-49,999 individuals here.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crested Guan

The Crested Guan, Penelope purpurascens, is a member of an ancient group of birds of the Cracidae family, which are related to the Australasian mound builders. It breeds in lowlands from south Mexico and the Yucatán Peninsula to western Ecuador and southern Venezuela at up to 1850 m altitude.

The Crested Guan is an arboreal forest species. The substantial twig nest is built in a tree or stump and lined with leaves. The female lays two or three large rough-shelled white eggs and incubates them alone.

This is a large gamebird, with a length varying from 84 to 91.5 cm (33 to 36.0 in). These birds commonly weigh around 1,750 g (3.9 lb), though can weigh as little as 1,361 g (3.00 lb) in P. p. brunnescens, the smallest race on average. Among standard measurements, the wing chord is 33 to 42.8 cm (13 to 16.9 in), the tail is 34 to 41.5 cm (13 to 16.3 in) and the tarsus is 7.4 to 9.1 cm (2.9 to 3.6 in).[1][2] It is similar in general appearance to a turkey, with a small head, long strong red legs, and a long broad tail. It is mainly dark brown, with white spotting on the neck and breast. The rump and belly are rufous. The head sports a bushy crest, from which the species gets its name, blue-grey bare skin around the eye, and a bare red dewlap or wattle.

The sexes are similar, but young birds have black vermiculations and ochre specks on the body plumage.

The Crested Guan is a noisy bird with a loud plee or quonk call, a whistled contact call and a powerful keLEEEErrrr! dawn song.

This is a social bird, often seen in pairs or family groups of 6-12. It walks along branches seeking the fruit and foliage on which it feeds, or flies off with a heavy ani-like flap and glide.

The range of this species has severely contracted outside remote or protected forests due to deforestation and hunting.

A Crested Guan in the wild on Barro Colorado Island, Panama

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!