Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Penelope obscura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTAATCGTCACAGCCCATGCCTTCGTCATAATCCTCTTCATAGTCATACCAATCATAATTGGCGGCTTTGGAAACTGACTGGTCCCTCTCATAATCGGCGCGCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTTCTCCTTCTACTAGCCTCATCTACCGTAGAAGCTGGAGCCGGAACAGGATGAACCGTCTACCCTCCCTTAGCAGGAAACCTAGCCCACGCTGGCGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCTATCCTGGGAGCAATTAACTTTATTACCACCGCCATTAACATAAAACCCCCAGCCCTCTCACAATACCAAACTCCTCTGTTCGTATGGTCAGTCCTTATCACCGCTATCCTACTTTTATTATCCCTTCCCGTCCTAGCAGCTGGCATCACCATGCTTCTCACCGACCGCAATCTTAATACCACATTCTTTGACCCAGCCGGAGGCGAAGACCCAGTTCTATATCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTTATTCTCCCCGGCTTCGGGATCATTTCCCACGTAGTAGCATACTACGCTGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCAATACTATCAATTGGATTCCTTGGCTTCATCGTATGAGCCCATCACATATTCACAGTAGGTATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Penelope obscura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dusky-legged Guan

The dusky-legged guan (Penelope obscura) is a species of bird in the Cracidae family, the chachalacas, guans, and curassows. It is found in southernmost Brazil, northern Uruguay, Paraguay, and northeastern Argentina; a narrow disjunct range is in northern Argentina extending into south-central Bolivia.

Its natural habitats are subtropical or tropical moist lowland forests and subtropical or tropical moist montane forests. The bird measures an average of 73 centimeters in length and weighs an average of 1.2 kilograms, being very similar in appearance to its smaller relative, the rusty-margined guan (P. supercilliaris). Eats fruit, flowers and buds taken from the ground or plucked from tree branches, and acts as a seed disperser for various species of trees and palms, such as the endangered palm Euterpe edulis, or the palms of the Syagrus genus (e.g. Queen Palm and Licuri).[2]

References[edit]

  1. ^ BirdLife International (2012). "Penelope obscura". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ (Portuguese) José Felipe Monteiro Pereira (2008) Aves e Pássaros Comuns do Rio de Janeiro Rio de Janeiro: Technical Books pp.48 ISBN 978-85-61368-00-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!