Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Longueur 27-29 cm, envergure 44-49 cm, poids 44-78 g.

L’espèce s’établit dans des terriers qu’elle creuse le plus souvent dans des talus proches de l’eau. Elle apprécie les berges des rivières, les vallées abritées et les terrains ouverts avec des arbres dispersés, mais toujours dans des conditions chaudes et ensoleillées.

Elle requiert de grandes quantités d’insectes volants. Les Hyménoptères sont habituellement préférés, notamment abeilles et guêpes contre lesquelles elle semble partiellement immunisée. Le Guêpier est souvent grégaire quand il se nourrit. Dans les régions où il est commun, il n’est pas rare d’observer quelques dizaines d’oiseaux se nourrissant ensemble. Il chasse depuis un perchoir, effectuant des vols plus ou moins longs pour capturer et rapporter sa proie. L’abdomen des abeilles est frotté avec dextérité pour décharger le venin. Les aiguillons peuvent être retrouvés plantés sur le perchoir, mais certains sont avalés, sans doute après une détérioration préalable.

L’espèce est monogame, rarement bigame. Les individus non nicheurs s’associent parfois aux nicheurs pour les aider. Les mâles sont presque toujours surnuméraires dans les colonies. Le couple défend un ou plusieurs perchoirs proches du nid. Les deux partenaires partagent les tâches liées à la nidification et passent de longs moments perchés l’un à côté de l’autre, notamment en début de saison. Le nourrissage de la femelle par le mâle déute normalement après plusieurs jours d’excavation du nid. Il diminue pendant l’incubation, la femelle étant nourrie à l’entrée du trou ou à l’extérieur.

Le nid est un tunnel finissant par une chambre d’incubation située dans l’axe ou sur le côté. Dans les talus, le tunnel est horizontal ou légèrement surélevé. Lorsqu’il est creusé au sol, un trou vertical d’une dizaine de centimètres de profondeur précède le tunnel horizontal. L’unique ponte de 6 ou 7 œufs (extrêmes 4 et 9) est déposée en mai. L’incubation dure 20 jours et l’envol a lieu vers l’âge de 1 mois.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

European bee-eaters (Merops apiaster) have a broad distribution covering much of Europe and Africa with range estimates up to 11,000,000 square km. These migratory birds can be found as far north as Finland and range as far south as South Africa, extending east into some Asiatic countries as well. Most commonly, European bee-eaters will breed and nest in southern Europe, then migrate south during autumn and winter.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • BirdLife International 2009, 2009. "Merops apiaster" (On-line). In: IUCN 2009. IUCN Red List of Threatened Species.. Accessed January 12, 2010 at http://www.iucnredlist.org/apps/redlist/details/142227/0.
  • White, F., G. Bartholomew, J. Kinney. 1978. Physiological and Ecological Correlates of Tunnel Nesting in the European Bee-Eater, Merops apiaster. Physiological Zoology, 51/2: 140-154.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range

S Palearctic; winters to sub-Saharan Africa and w India.

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Physical Description

European bee-eaters are mid-sized insectivores that have dark, thick, and slightly downward curved bills. A bright yellow chin and throat patch meet a blue chest that extends down to the flanks and belly. Dark lores and eye-stripe are contrasted by a white patch above the upper mandible and lower white eye-stripe extending from the lower mandible. A dark chestnut color covers the crown and nape, becoming lighter in color on the back. Upper tail coverts are variable, ranging from green to blue, with most of the tail being blue. Wing lengths average 44 cm for males and 49 cm for females. Weights of European bee-eaters are similar in males and females and range from 44 to 78 g. Total body length ranges from 27 to 30 cm.

Males and females, very similar in coloration, can be distinguished by the hue of the greater coverts, being a chestnut in males and greenish-blue in females, and by the median coverts, where males are a chestnut and females have a greenish hue. Juveniles can be distinguished from adults by the color of the iris. In mature adults the iris is a vibrant red and juveniles will have a grayish-olive-red color. Also, the chestnut color found in adults is only green in juveniles.

Range mass: 44 to 78 g.

Average mass: 52 g.

Range length: 27 to 30 cm.

Average length: 28 cm.

Range wingspan: 44 to 49 cm.

Average wingspan: 46 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Lessells, C., G. Ovenden. 1989. Heritability of Wing Length and Weight in European Bee-Eaters (Merops apiaster). The Condor, 91/1: 210-214.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European bee-eaters are commonly found near freshwater systems and inhabit a variety of habitat types such as forest, savanna, shrubland, grassland, and agricultural areas. The habitat for nesting can be specific involving only river systems or gravel pits with steep exposed banks. European bee-eaters have also been found to dig burrows directly into the ground. Food availability can determine the habitat occupied by European bee-eaters. Many agricultural fields use bee-hives for pollination and M. apiaster will frequent those areas.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; scrub forest

Other Habitat Features: agricultural ; riparian

  • Yosef, R., M. Markovets, L. Mitchell, P. Tryjanowski. 2006. Body condition as a determinant for stopover in bee-eaters (Merops apiaster) on spring migration in the Arava Valley, southern Israel. Journal of Arid Enviornments, 64/3: 401-411.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

As their name implies, European bee-eaters' diet consists of bees ranging in size from large to small (Hymenoptera), but also includes dragonflies (Ondonata) and other flying insects. Bee-eaters are quick on the wing and agile for catching flying insects. When catching insects they will grasp them by the midsection, fly back to perch, and hit them against their perch until movement ceases. When catching stinging insects they will immobilize them and hit the sting against the perch to pull or rip it out, and then toss the prey up vertically to swallow. Breeding pairs of European bee-eaters continue to feed their fledglings until the young birds learn to successfully catch and eat insects.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

  • Krebs, J., M. Avery. 1984. Chick growth and prey quality in the European Bee-eater (Merops apiaster). Oecologia, 64/3: 363-368.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / predator
Merops apiaster is predator of adult of Bombus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

European bee-eaters are known as ecosystem engineers because of their effects on arid environments through burrowing breeding behavior. Three ways have been suggested regarding how European bee-eaters impact the environment: (i) burrowing and soil removal allows rain, sunlight, and nutrients to penetrate soil. (ii) abandoned burrows provide shelter for other species to colonize the area (iii) deep burrows provide access to invertebrate prey items which can increase food web complexity.

The microclimate that is created by these burrows can be significantly different from the macroclimate. Some species that re-use burrows made by European bee-eaters include European rollers (Coracias garrulus), little owls (Athene noctua), pied wagtails (Motacilla alba), and rock sparrows (Petronia petronia).

Analysis of active European bee-eaters' nests detected several species of mites (chicken mites, tropical fowl mites) and larvae of Diptera, beetles (Tenebrionidae family), and moths and butterflies (Lepidoptera order).

Ecosystem Impact: creates habitat; soil aeration

Commensal/Parasitic Species:

  • Casas-Crivlle, A., F. Valera. 2005. The European bee-eater (Merops apiaster) as an ecosystem engineer in arid enviornments. Journal of Arid Enviornments, 60/2: 227-238.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Montpellier snakes (Malpolon monspessulanus), ocellated lizards (Timon lepidus), and black kites (Milvus migrans) are common predators of European bee-eaters. Nestlings are most vulnerable because ground burrows are easily accessed by snakes and lizards.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The family Meropidae (bee-eaters), most species being colonial, often will exhibit interspecific and intraspecific communication. Like most colonial species, European bee-eaters are very vocal while within the colony. Pairs often call to locate or otherwise communicate to each other. European bee-eaters have a limited repertoire, which consists of several, slight variations on a "preep" call. This call is given in rapid succession while in social groups, and takes on a "bubbly" characteristic during courtship.

European bee-eaters have been found to exhibit intraspecific “helping”. A nesting pair may accept a third party to help with incubating or feeding to increase nesting success. This social communication may be between related individuals and help fitness.

Mixed flocks of European bee-eaters and blue cheeked bee-eaters (Merops persicus) have been found to have better breeding success as a result of mixed species foraging offsetting interspecific competition. Interspecific communication has also been found to be defensive during nesting, involving fighting and avoidance, whereas intraspecific communication included sunning, preening, and mobbing of predators. The benefit of being a social communal species is having more eyes on the lookout for danger; European bee-eaters will use vocal communication to warn others about danger.

Like all birds, European bee-eaters perceive their environment through visual, auditory, tactile and chemical stimuli.

Communication Channels: acoustic

  • Petrescu, A., C. Adam. 2001. Interspecific Relations in the Populations of Merops apiaster L. (Aves: Coraciiformes) of Southern Romania. Travaux du Museum National d' Histoire Naturelle, 43: 305-322.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

European bee-eaters have been documented to live up to 5.9 years in the wild.

Range lifespan

Status: wild:
5.9 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

European bee-eaters are monogamous and will generally stay together from year to year if both survive. Courtship feeding has been observed of some male European bee-eaters, where the male will bring food to the female a couple days before, during, and after egg laying. Roughly 20% of nesting pairs have 1 to 4 helpers that exhibit cooperative breeding, where a non-breeding male, likely a close relative, will assist the nesting pair by sitting on the nest and catching prey for young.

Mating System: monogamous ; cooperative breeder

In central Europe, most European bee-eaters return to their breeding range in late April or early May. They will mate in May and dig out burrows around 1 m deep in sand pits or steep river banks. Females lay 4 to 7 eggs in late May to early June. They are laid in 2 day intervals and incubated 3 to 4 weeks before hatching asynchronously. Before young fledge asynchronously at around 4 weeks of age they undergo weight loss to reduce their weight closer to that of an adult. Asynchronous Hatching and fledging is thought to help offset sibling rivalry and allow better care of young with a variable food source like flying insects. Juveniles become independent at 1 to 2 months of age. Sexual maturity is reached within the first year, though juveniles are not always successful at breeding in their first year. Juveniles may come back to the same colonies and nest near relatives such as parents or siblings. These juveniles may become family helpers if they fail to nest.

They are either solitary or colonial nesters. One study found a negative effect on nest success with increasing colony size. Isolated pairs with equal clutch size had a higher rate of nesting success. It is thought that colonial breeding could still be worthwhile if it increases adult survival.

Breeding interval: European bee-eaters breed once yearly.

Breeding season: European bee-eaters breed between May and June.

Range eggs per season: 4 to 7.

Average eggs per season: 5.

Range time to hatching: 3 to 4 weeks.

Range fledging age: 28 to 32 days.

Range time to independence: 1 to 2 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both male and female European bee-eaters participate in excavating the underground nesting burrow. After the eggs are laid, the pair shares incubation responsibilities. Chicks are born altricial, without feathers and eyes closed, and rely on significant parental care for survival. The male "helper" will also share incubation and feeding duties, but is not as reliable as the breeding pair. Both parents provide food and protection for young until fledging. Some male European bee-eaters will continue to feed the female for several days during and after egg laying.

European bee-eaters exhibit very specific feeding behaviors that are difficult for young birds to learn. Breeding pairs will continue to feed fledglings until the young learn the skills to successfully forage for themselves.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Avery, M., J. Krebs, A. Houston. 1988. Economics of courtship-feeding in the European bee-eater (Merops apiaster). Behavioral Ecology and Sociobiology, 23/2: 61-67.
  • Hoi, H., C. Hoi, J. Kistofik, A. Darolava. 2002. Reproductive success decreases with colony size in the European bee-eater. Ethology Ecology & Evolution, 14: 99-110.
  • Horváth, G., M. Fischer, T. Szekely. 1992. The delivery of surplus prey to the nest by a pair of bee-eaters (Merops apiaster). Ornis Hung, 2: 11-16.
  • Lessells, C., M. Avery, J. Krebs. 1994. Nonrandom dispersal of kin: why do European bee-eater (Merops apiaster) brothers nest close together?. Behavior Ecology, 5: 105-113.
  • Lessells, C., M. Avery. 1989. Hatching Asynchrony in European Bee-eaters Merops apiaster. Journal of Animal Ecology, 58/3: 815-835.
  • Lessells, C., G. Ovenden. 1989. Heritability of Wing Length and Weight in European Bee-Eaters (Merops apiaster). The Condor, 91/1: 210-214.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Merops apiaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTACCTAATCTTTGGAGCCTGAGCCGGTATAATTGGCACCGCCCTAAGCCTACTCATCCGTGCAGAACTCGGCCAACCGGGCACCCTCTTAGGAGATGACCAAATCTACAATGTCATCGTTACAGCTCATGCCTTCGTAATAATTTTCTTCATGGTCATGCCTATCATGATCGGAGGATTTGGAAACTGACTTGTTCCCCTGATAATTGGAGCCCCCGATATAGCATTCCCACGCATGAATAACATAAGCTTCTGACTACTGCCCCCCTCCTTCCTTCTACTTCTGGCATCTTCCACAGTAGAGGCCGGCGCAGGAACTGGATGGACCGTATACCCGCCTCTTGCCGGCAACCTTGCCCACGCCGGGGCATCCGTAGACCTAGCCATCTTCTCCCTCCACCTAGCGGGGGTTTCCTCCATCCTAGGCGCAGTTAATTTCATTACAACTGCCATCAACATAAAACCCCCAGCCCTCTCCCAATATCAAACCCCCCTATTTGTATGATCCGTACTAATTACCGCCGTCCTACTCCTACTATCACTCCCCGTCCTAGCTGCTGGAATCACTATGCTACTGACAGACCGAAACCTAAACACTACCTTCTTCGACCCAGCTGGAGGGGGCGACCCAATTCTATACCAACATCTATTCTGATTCTTCGGCCACCCTGAGGTATACATTCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Merops apiaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European bee-eaters are listed as a species of least concern by IUCN. Although their numbers have been declining over the past decade, the population (480,000 to 1,000,000 breeding individuals) is still well above any level of threat.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Migrant breeder and regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 480,000-1,000,000 breeding pairs, equating to 1440,000-3,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 2,940,000-12,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

European bee-eaters are seen as a pest by many farmers in central and southern Europe. These birds are attracted to high densities of cultivated bees, and are frequently persecuted by farmers. European bee-eaters may cause significant damage to a hive if they prey upon the queen.

Negative Impacts: crop pest

  • Al-Ghzawi, A., S. Zaitoun, H. Shannag. 2009. Incidence and Geographical Distribution of Honeybee (Apis mellifera L.) Pests in Jordan. Ann. soc. entomol. Fr., 45/3: 305-308.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

European bee-eaters have not been recorded as a species that benefits humans in an economic manner. They are unique and beautiful birds that attract many birders and photographers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European bee-eater

The European Bee-eater (Merops apiaster) is a near passerine bird in the bee-eater family Meropidae. It breeds in southern Europe and in parts of north Africa and western Asia. It is strongly migratory, wintering in tropical Africa, India and Sri Lanka. This species occurs as a spring overshoot north of its range, with occasional breeding in northwest Europe.

Description[edit]

This species, like other bee-eaters, is a richly-coloured, slender bird. It has brown and yellow upper parts, whilst the wings are green and the beak is black. It can reach a length of 27–29 cm (10.6–11.4 in), including the two elongated central tail feathers. Sexes are alike.

Food[edit]

Feeding bee-eater - the female (in front) awaits the offering which the male will make.

This is a bird which breeds in open country in warmer climates. Just as the name suggests, bee-eaters predominantly eat insects, especially bees, wasps and hornets which are caught in the air by sorties from an open perch. Before eating its meal, a European Bee-eater removes the sting by repeatedly hitting the insect on a hard surface. It eats some 250 bees daily.[citation needed] Lizards and frogs are also taken.[citation needed] The most important prey item in their diet are Hymenoptera, mostly Apis mellifera; a study in Spain found that these comprise 69.4% to 82% of the European bee-eaters' diet.[2] Their impact on bee populations however is small; they eat less than 1% of the worker bees in the area in which they live.[3]

A study found that European bee-eaters "convert food to body weight more efficiently if they are fed a mixture of bees and dragonflies than if they eat only bees or only dragonfiles."[4]

Behavior[edit]

These bee-eaters are gregarious, nesting colonially in sandy banks, preferably near river shores, usually at the beginning of May. They make a relatively long tunnel in which the 5 to 8, spherical white eggs are laid around the beginning of June. Both the male and the female take care of the eggs, which are brooded for about 3 weeks. These birds also feed and roost communally.

During courtship the male feeds large items to the female while eating the small ones himself.[5] Most males are monogamous, but occasional bigamy has been encountered.[5]

Typical call is a distinctive, mellow, liquid and burry prreee or prruup.

Reported UK breeding attempts[edit]

European Bee-eater has attempted to nest in Britain on at least five occasions:[citation needed]

  • In 1920, a pair made a nesting attempt in a sand bank of the River Esk at Musselburgh, Scotland. A local gardener captured the female, keeping her in a greenhouse, and she died two days later, after laying a single egg.
  • In 1955, three pairs of Bee-eaters nested in Streat sand quarry near Plumpton, East Sussex. The birds were first found on 12 June, although the birds' presence only became widely known at the start of August. One nest was accidentally destroyed by machinery in July, but seven young fledged from the two remaining nests towards the end of August. An RSPB wardening operation was instigated, and in total over 1,000 people visited the site. The birds remained until 24 September.
  • A pair nested at Bishop Middleham Quarry, County Durham in 2002. The birds were first found on 2 June, and within a few days started to undertake courtship feeding and copulation; five chicks hatched, but one died in the nest, one died before fledging, and a third disappeared and was also believed to have died. Durham Wildlife Trust (with RSPB assistance) set up a wardening post during the period when the birds were nesting. News was released to rare bird information services, and the national news media also reported on the birds' presence. In total, some 15,000 people visited the site during their stay; the adults and both fledged young were seen to leave on 28 August, when they flew off high to the south.
  • A pair took up residence on farmland adjacent to the River Wye, near Hampton Bishop, Herefordshire in summer 2005; by mid-July the adults were bringing insect food to the riverbank nest-hole confirming that eggs had hatched. A wardening operation was set up by the RSPB, with public access granted, resulting in c. 2,000 people seeing the birds. However, on the evening of 29 July, foxes predated the nest, and the birds soon left the site.
  • A pair excavated a nest hole at a coastal site in Dorset in 2006, but this attempt failed.[6]

Fiction[edit]

  • The third series of the sitcom To the Manor Born featured an episode, first aired on 11 August 1981, in which Bee-eaters bred at a fictional location in England [1].

Gallery[edit]

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!