Overview

Distribution

Tufted puffins are Northern Pacific sea birds that spend a majority of the year over the Pacific Ocean, but nest along coastlines from lower California to Alaska, and across the ocean from Japan to the shores of northeastern Asia. (Gaston 1998)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: arctic coast of eastern Siberia and Cape Lisburne, Alaska, to northern Japan in western Pacific and Farallon Islands (central California) in eastern Pacific. WINTERS: offshore from Alaska and Kamchatka south through breeding range to central California and southern Japan; accidental in Hawaii (AOU 1983). Center of abundance appears to be western Gulf of Alaska and the Aleutians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Coasts and islands of ne Asia to Aleutians and s California.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Fratercula cirrhata is similar in size to crows, with an average length of 15 inches, and a 15 inch wingspan. Size varies a little from location to location: western Pacific animals tend to be a little larger than eastern ones. There is also a difference in size between the sexes as male birds tend to be slightly larger than females.

In the winter, as puffins prepare for spring breeding, their colors become more decorative, presumably to attract mates. During this time they develop a brownish-black body, with some white feathers lining the underside of the wing, a white face and glossy, yellow plumes above and behind eye. The bill is mostly bright red, with yellow and sometimes green markings. When breeding ends in the early summer, puffins lose their plumes, the bright colors of the bill turn to a dull reddish-brown,and the belly is speckled with some pale brown flecks. Their legs and feet are red or orange-red throughout the year.

Juvenile puffins resemble winter adults, but with a grey-brown breast, white belly, and a shallow, brown bill. (Gaston 1998, Gabrielson 1970)

Range mass: 700 to 840 g.

Average mass: 760 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 38 cm

Weight: 779 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Although puffins spend a majority of the year on the ocean, they build their nests on the shores of islands and coastal regions. They require shores with steep, grassy, sloping land with soil that allows them to burrow. In more rocky areas, puffins build their nests in the rock and on cliff faces. They prefer high places that allow them to swoop down and gain momentum. Their stubby wings make it difficult for them to take flight from water or land without help. They prefer secluded areas where some protection is offered by their surroundings. Their burrows are typically two to six feet long, and four to six inches in diameter. In highly populated colonies, the burrows of two or three of the animals sometimes run together. (Paul 1994, Gaston 1998, Jewett 1953)

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Nonbreeding: primarily pelagic. Can be found well out to sea all year; summer observations probably immature nonbreeders (Johnsgard 1987). Immatures more likely than adults to winter in bays (Johnsgard 1987). Probably the most pelagic of alcids. Nests on offshore islands or along the coast. Nests on slopes in ground burrows, sometimes under boulders and piles of rocks, occasionally under dense vegetation (AOU 1983); also recorded nesting in sandy estuarine islands along north-central Alaska Peninsula (Spendelow and Patton 1988). May nest in association with murres, cormorants, auklets, gulls. See Spendelow and Patton (1988) for further details on nesting habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 360 specimens in 1 taxon.
Water temperature and chemistry ranges based on 215 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.625 - 15.958
  Nitrate (umol/L): 0.299 - 5.414
  Salinity (PPS): 30.381 - 34.011
  Oxygen (ml/l): 5.724 - 8.121
  Phosphate (umol/l): 0.379 - 0.800
  Silicate (umol/l): 2.587 - 16.169

Graphical representation

Temperature range (°C): 0.625 - 15.958

Nitrate (umol/L): 0.299 - 5.414

Salinity (PPS): 30.381 - 34.011

Oxygen (ml/l): 5.724 - 8.121

Phosphate (umol/l): 0.379 - 0.800

Silicate (umol/l): 2.587 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Tufted puffins are primarily offshore feeders. During nesting, and when food is in abundance, they may feed inshore. The diet of chicks is almost entirely small fish, while the adults' diets are more diverse. Adults prey mostly on anchovies and other small fish, but also eat squid, octopus, crabs, zooplankton, and jellyfish.

When hunting for fish, puffins usually attack fish in schools.

Puffins fly very close the the water and feed by diving under the water catching their prey in their mouths. They can stay underwater for 20 to 30 seconds using their wings to swim. When taking food to their young, they usually hold about 10 fish in their mouths while returning to the nest, but they have been observed carrying up to 6o fish in their bills at one time. Puffins use their tongues to hold fish against the spiny palate in their mouth while opening their beak to catch more fish. (Arctic Studies Center 1997, Jewett 1953, Gaston 1998)

Animal Foods: fish; mollusks; aquatic crustaceans; cnidarians; zooplankton

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on fishes, cephalopods, crustaceans, and polychaetes, as available. In Alaska, breeders and chicks ate more fishes than did nonbreeders (Baird 1991). Obtains food by diving underwater, often in deep water. See Wehle (1983) for information on feeding of young in Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Puffins are important predators of small fish and marine invertebrates in the areas in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tufted puffins protect their young by nesting on offshore islands and in burrows. Adults are swift in flight and spend much of their time in the open ocean. Puffins may be preyed on by sharks and other large seabirds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Fratercula cirrhata preys on:
Actinopterygii
zooplankton
Cnidaria
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: A world total of 1031 known colonies tabulated in Piatt and Kitaysky (2002); some of these may be combined in occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Estimated total individuals is 2,971,260, although this estimate is derived from other estimates of "unknown accuracy," owing to the difficulty of counting birds in burrows (Piatt and Kitaysky 2002).

Alaska: 1970s estimate indicated a population of about 4 million birds (Lensink 1984). British Columbia population probably includes 78,000 breeders (Kaiser, in Hyslop and Kennedy 1992). Washington population may be 50% larger than the 29,000 breeders recorded for the 1970s (Spendelow and Patton 1988). About 6500 breeders occurred in Oregon in the late 1970s. California: about 240 breeders in the late 1970s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary or in pairs when at sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Tufted puffins have a limited range of calls, including a low grumbling noise heard usually from underground in breeding colonies. Chicks often peep to indicate that they want food. They use postures and other physical cues to communicate as well.

They use unknown cues for finding their way back from the vastness of the open ocean to the nesting colonies in which they were born.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: At Barren Islands, Alaska, adults brought food to chicks shortly after sunrise, at midday, and before sunset; sometimes additional trips (see Johnsgard 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
72 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During the period prior to egg laying, large groups of puffins congregate off-shore from their nesting colony and engage in intense courtships and frequent copulations. Similar behaviors occur on land at the same time, with puffins courting mates through skypointing (flying straight upwards), strutting, and billing (two birds rubbing their bills together).

Mating System: monogamous

Fratercula cirrhata usually begin breeding in April, although mating activity has been seen as early as March and as late as May in some cases.

Each female puffin lays one off-white egg, sometimes with faint blue and brown markings, usually between late April and early June. Eggs produced later than June are unlikely to produce fledglings. The peak egg-laying period usually lasts about two weeks in each colony. Both parents help with incubation, which last betweeen 40 and 53 days.

Once the chicks hatch, their growth rate is variable between colonies and from year to year. The difference is dependent on the feeding conditions of their location. Both parents take turns bringing food to the chicks, which happens two to three times daily, and most frequently in the morning and early evening. Chicks remain in the burrow and rely on their parents until they are fledged, which usually happens 45-55 days after hatching. There is no post-fledging parental care, and the puffling first leaves the nest for the open sea alone and at night. Young puffins usually do not return to the colony for almost two years, spending all their time at sea. Puffins become sexually mature at the age of three, but most do not mate until they're four.

Juveniles moult during their first winter at sea, and again the following autumn. Adult puffins moult completely following the breeding season, and partially before breeding. (Gaston 1998, Kessel 1989, Paul 1994)

Breeding interval: Tufted puffins breed once yearly.

Breeding season: Fratercula cirrhata usually begin breeding in April, although mating activity has been seen as early as March and as late as May in some cases.

Average eggs per season: 1.

Range time to hatching: 40 to 53 days.

Range fledging age: 45 to 55 days.

Range time to independence: 45 to 55 days.

Average age at sexual or reproductive maturity (female): 3-4 years.

Average age at sexual or reproductive maturity (male): 3-4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both parents incubate, protect, and feed their developing young until they are fledged.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins late April in south to early June in north. Mean laying date is in early June in the western Gulf of Alaska. Incubation, by both sexes, lasts 42-53 days (average 46). Young are tended by both adults for 43-53 days (average 46), then go to sea untended by adults. Many occupied burrows never have eggs laid in them (Johnsgard 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fratercula cirrhata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCACAAAGACATTGGCACCCTATACTTAATCTTTGGCGCATGAGCTGGCATAGTTGGRACTGCCCTCAGCCTACTTATTCGTGCAGAATTAGGTCAACCAGGGACCCTTTTAGGAGACGACCAAATCTATAACGTAATCGTCACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGTGGCTTCGGAAACTGATTAGTCCCACTTATAATTGGCGCCCCAGACATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTCCTACTCCTAGCCTCATCTACAGTAGAGGCCGGAGCTGGTACAGGATGAACCGTCTATCCTCCCCTAGCTGGAAACCTAGCCCACGCCGGAGCTTCAGTAGACCTGGCAATTTTCTCCCTCCACTTAGCAGGTGTGTCCTCTATCCTGGGTGCCATCAACTTTATTACAACAGCCATCAACATAAAACCCCCAGCTCTTTCACAATACCAAACCCCACTATTCGTATGATCGGTACTCATTACTGCTGTCTTACTACTACTCTCACTTCCAGTACTTGCCGCCGGCATTACTATGCTCCTAACAGACCGAAACCTAAACACTACATTCTTCGACCCTGCCGGAGGGGGTGATCCCGTACTCTATCAGCACCTCTTCTGATTCTTTGGTCACCCAGAAGTATACATCCTAATTCTACCAGGCTTTGGAATTATCTCCCACGTCGTAACATACTATGCAGGAAAAAAAGAGCCATTCGGTTACATAGGAATAGTATGAGCCATACTATCCATTGGCTTCCTAGGGTTCATCGTATGGGCGCACCATATATTCACAGTAGGAATGGACGTAGACACTCGAGCTTACTTCACATCCGCCACTATAATCATCGCCATCCCTACTGGCATCAAAGTATTCAGCTGACTCGCTACACTCCACGGAGGGACTATCAAATGAGACCCCCCAATACTATGGGCCTTAGGCTTTATCTTCCTTTTCACTATCGGAGGCCTCACAGGAATTGTCCTAGCAAACTCTTCACTAGACATCGCCCTGCACGACACATACTACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fratercula cirrhata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Fratercula cirrhata is not a threatened species, but in some locations its numbers are decreasing. In Alaska, they are highly abundant, but the seabird colonies of Alaska are protected by federal and state laws. Also, a permit is often required to land on islands where puffins are nesting. In the puffin colonies along the coasts of California, Oregon, and Washington, population size has been declining since the beginning of the century due to decreasing numbers of fish, ocean pollution, and oil spills. As with most species, puffins have fallen victim to the expansion of humans. To attempt to make up for human takeover of land that was once used for puffin nesting, some programs have been set up to restore of former nesting colonies and help reduce the risk to populations by establishing more nesting sites. (Paul 1994, Small 1994)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3B - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.3,500,000 individuals (del Hoyo et al. 1996), while national population sizes have been estimated at < c.100 breeding pairs and c.50-1,000 wintering individuals in Japan and c.10,000-1 million breeding pairs c.1,000-10,000 wintering individuals in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Many Alaskan colonies probably have been devastated by introduced foxes (Lensink 1984). Present low numbers in California possibly are due to oil pollution and/or crash in the sardine population. Many are killed in Japanese gill-net fishery in North Pacific. See Lensink (1984), King (1984), and Ogi (1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Fratercula cirrhata does no harm to humans. Puffins will only harm people when they intrude on their nesting sites. They have a beak strong enough to bite through a human finger to the bone. (Lockley 1953)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tufted puffins were historically hunted for food. Hunting puffins is discouraged nowadays in most places, and forbidden by law in others, but people who do still hunt them try to capture only non-breeding animals. In the past, skins were used to make tough parkas worn feather side in. Puffins are also used as tourist attractions for communities near healthy colonies, but visitors must watch the birds from the ocean. Because human disturbances may cause puffins to leave their nesting sites, people are often prohibited from landing at nesting sites. Puffins are also indicators of a healthy ocean, and show humans when over-fishing is occuring. When there are fewer fish in the ocean, puffins bring a noticeably reduced amount of fish ashore. (Paul 1994, Kessel 1989)

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Often placed in the monotypic genus LUNDA (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!