Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: arctic coast of eastern Siberia and Cape Lisburne, Alaska, to northern Japan in western Pacific and Farallon Islands (central California) in eastern Pacific. WINTERS: offshore from Alaska and Kamchatka south through breeding range to central California and southern Japan; accidental in Hawaii (AOU 1983). Center of abundance appears to be western Gulf of Alaska and the Aleutians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Coasts and islands of ne Asia to Aleutians and s California.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Tufted puffins are Northern Pacific sea birds that spend a majority of the year over the Pacific Ocean, but nest along coastlines from lower California to Alaska, and across the ocean from Japan to the shores of northeastern Asia. (Gaston 1998)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Fratercula cirrhata is similar in size to crows, with an average length of 15 inches, and a 15 inch wingspan. Size varies a little from location to location: western Pacific animals tend to be a little larger than eastern ones. There is also a difference in size between the sexes as male birds tend to be slightly larger than females.

In the winter, as puffins prepare for spring breeding, their colors become more decorative, presumably to attract mates. During this time they develop a brownish-black body, with some white feathers lining the underside of the wing, a white face and glossy, yellow plumes above and behind eye. The bill is mostly bright red, with yellow and sometimes green markings. When breeding ends in the early summer, puffins lose their plumes, the bright colors of the bill turn to a dull reddish-brown,and the belly is speckled with some pale brown flecks. Their legs and feet are red or orange-red throughout the year.

Juvenile puffins resemble winter adults, but with a grey-brown breast, white belly, and a shallow, brown bill. (Gaston 1998, Gabrielson 1970)

Range mass: 700 to 840 g.

Average mass: 760 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 38 cm

Weight: 779 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: primarily pelagic. Can be found well out to sea all year; summer observations probably immature nonbreeders (Johnsgard 1987). Immatures more likely than adults to winter in bays (Johnsgard 1987). Probably the most pelagic of alcids. Nests on offshore islands or along the coast. Nests on slopes in ground burrows, sometimes under boulders and piles of rocks, occasionally under dense vegetation (AOU 1983); also recorded nesting in sandy estuarine islands along north-central Alaska Peninsula (Spendelow and Patton 1988). May nest in association with murres, cormorants, auklets, gulls. See Spendelow and Patton (1988) for further details on nesting habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although puffins spend a majority of the year on the ocean, they build their nests on the shores of islands and coastal regions. They require shores with steep, grassy, sloping land with soil that allows them to burrow. In more rocky areas, puffins build their nests in the rock and on cliff faces. They prefer high places that allow them to swoop down and gain momentum. Their stubby wings make it difficult for them to take flight from water or land without help. They prefer secluded areas where some protection is offered by their surroundings. Their burrows are typically two to six feet long, and four to six inches in diameter. In highly populated colonies, the burrows of two or three of the animals sometimes run together. (Paul 1994, Gaston 1998, Jewett 1953)

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 360 specimens in 1 taxon.
Water temperature and chemistry ranges based on 215 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.625 - 15.958
  Nitrate (umol/L): 0.299 - 5.414
  Salinity (PPS): 30.381 - 34.011
  Oxygen (ml/l): 5.724 - 8.121
  Phosphate (umol/l): 0.379 - 0.800
  Silicate (umol/l): 2.587 - 16.169

Graphical representation

Temperature range (°C): 0.625 - 15.958

Nitrate (umol/L): 0.299 - 5.414

Salinity (PPS): 30.381 - 34.011

Oxygen (ml/l): 5.724 - 8.121

Phosphate (umol/l): 0.379 - 0.800

Silicate (umol/l): 2.587 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on fishes, cephalopods, crustaceans, and polychaetes, as available. In Alaska, breeders and chicks ate more fishes than did nonbreeders (Baird 1991). Obtains food by diving underwater, often in deep water. See Wehle (1983) for information on feeding of young in Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Tufted puffins are primarily offshore feeders. During nesting, and when food is in abundance, they may feed inshore. The diet of chicks is almost entirely small fish, while the adults' diets are more diverse. Adults prey mostly on anchovies and other small fish, but also eat squid, octopus, crabs, zooplankton, and jellyfish.

When hunting for fish, puffins usually attack fish in schools.

Puffins fly very close the the water and feed by diving under the water catching their prey in their mouths. They can stay underwater for 20 to 30 seconds using their wings to swim. When taking food to their young, they usually hold about 10 fish in their mouths while returning to the nest, but they have been observed carrying up to 6o fish in their bills at one time. Puffins use their tongues to hold fish against the spiny palate in their mouth while opening their beak to catch more fish. (Arctic Studies Center 1997, Jewett 1953, Gaston 1998)

Animal Foods: fish; mollusks; aquatic crustaceans; cnidarians; zooplankton

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Puffins are important predators of small fish and marine invertebrates in the areas in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Tufted puffins protect their young by nesting on offshore islands and in burrows. Adults are swift in flight and spend much of their time in the open ocean. Puffins may be preyed on by sharks and other large seabirds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Fratercula cirrhata preys on:
Actinopterygii
zooplankton
Cnidaria
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: A world total of 1031 known colonies tabulated in Piatt and Kitaysky (2002); some of these may be combined in occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Estimated total individuals is 2,971,260, although this estimate is derived from other estimates of "unknown accuracy," owing to the difficulty of counting birds in burrows (Piatt and Kitaysky 2002).

Alaska: 1970s estimate indicated a population of about 4 million birds (Lensink 1984). British Columbia population probably includes 78,000 breeders (Kaiser, in Hyslop and Kennedy 1992). Washington population may be 50% larger than the 29,000 breeders recorded for the 1970s (Spendelow and Patton 1988). About 6500 breeders occurred in Oregon in the late 1970s. California: about 240 breeders in the late 1970s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary or in pairs when at sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tufted puffins have a limited range of calls, including a low grumbling noise heard usually from underground in breeding colonies. Chicks often peep to indicate that they want food. They use postures and other physical cues to communicate as well.

They use unknown cues for finding their way back from the vastness of the open ocean to the nesting colonies in which they were born.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: At Barren Islands, Alaska, adults brought food to chicks shortly after sunrise, at midday, and before sunset; sometimes additional trips (see Johnsgard 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
72 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding begins late April in south to early June in north. Mean laying date is in early June in the western Gulf of Alaska. Incubation, by both sexes, lasts 42-53 days (average 46). Young are tended by both adults for 43-53 days (average 46), then go to sea untended by adults. Many occupied burrows never have eggs laid in them (Johnsgard 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the period prior to egg laying, large groups of puffins congregate off-shore from their nesting colony and engage in intense courtships and frequent copulations. Similar behaviors occur on land at the same time, with puffins courting mates through skypointing (flying straight upwards), strutting, and billing (two birds rubbing their bills together).

Mating System: monogamous

Fratercula cirrhata usually begin breeding in April, although mating activity has been seen as early as March and as late as May in some cases.

Each female puffin lays one off-white egg, sometimes with faint blue and brown markings, usually between late April and early June. Eggs produced later than June are unlikely to produce fledglings. The peak egg-laying period usually lasts about two weeks in each colony. Both parents help with incubation, which last betweeen 40 and 53 days.

Once the chicks hatch, their growth rate is variable between colonies and from year to year. The difference is dependent on the feeding conditions of their location. Both parents take turns bringing food to the chicks, which happens two to three times daily, and most frequently in the morning and early evening. Chicks remain in the burrow and rely on their parents until they are fledged, which usually happens 45-55 days after hatching. There is no post-fledging parental care, and the puffling first leaves the nest for the open sea alone and at night. Young puffins usually do not return to the colony for almost two years, spending all their time at sea. Puffins become sexually mature at the age of three, but most do not mate until they're four.

Juveniles moult during their first winter at sea, and again the following autumn. Adult puffins moult completely following the breeding season, and partially before breeding. (Gaston 1998, Kessel 1989, Paul 1994)

Breeding interval: Tufted puffins breed once yearly.

Breeding season: Fratercula cirrhata usually begin breeding in April, although mating activity has been seen as early as March and as late as May in some cases.

Average eggs per season: 1.

Range time to hatching: 40 to 53 days.

Range fledging age: 45 to 55 days.

Range time to independence: 45 to 55 days.

Average age at sexual or reproductive maturity (female): 3-4 years.

Average age at sexual or reproductive maturity (male): 3-4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents incubate, protect, and feed their developing young until they are fledged.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fratercula cirrhata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCACAAAGACATTGGCACCCTATACTTAATCTTTGGCGCATGAGCTGGCATAGTTGGRACTGCCCTCAGCCTACTTATTCGTGCAGAATTAGGTCAACCAGGGACCCTTTTAGGAGACGACCAAATCTATAACGTAATCGTCACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGTGGCTTCGGAAACTGATTAGTCCCACTTATAATTGGCGCCCCAGACATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTCCTACTCCTAGCCTCATCTACAGTAGAGGCCGGAGCTGGTACAGGATGAACCGTCTATCCTCCCCTAGCTGGAAACCTAGCCCACGCCGGAGCTTCAGTAGACCTGGCAATTTTCTCCCTCCACTTAGCAGGTGTGTCCTCTATCCTGGGTGCCATCAACTTTATTACAACAGCCATCAACATAAAACCCCCAGCTCTTTCACAATACCAAACCCCACTATTCGTATGATCGGTACTCATTACTGCTGTCTTACTACTACTCTCACTTCCAGTACTTGCCGCCGGCATTACTATGCTCCTAACAGACCGAAACCTAAACACTACATTCTTCGACCCTGCCGGAGGGGGTGATCCCGTACTCTATCAGCACCTCTTCTGATTCTTTGGTCACCCAGAAGTATACATCCTAATTCTACCAGGCTTTGGAATTATCTCCCACGTCGTAACATACTATGCAGGAAAAAAAGAGCCATTCGGTTACATAGGAATAGTATGAGCCATACTATCCATTGGCTTCCTAGGGTTCATCGTATGGGCGCACCATATATTCACAGTAGGAATGGACGTAGACACTCGAGCTTACTTCACATCCGCCACTATAATCATCGCCATCCCTACTGGCATCAAAGTATTCAGCTGACTCGCTACACTCCACGGAGGGACTATCAAATGAGACCCCCCAATACTATGGGCCTTAGGCTTTATCTTCCTTTTCACTATCGGAGGCCTCACAGGAATTGTCCTAGCAAACTCTTCACTAGACATCGCCCTGCACGACACATACTACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fratercula cirrhata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3B - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fratercula cirrhata is not a threatened species, but in some locations its numbers are decreasing. In Alaska, they are highly abundant, but the seabird colonies of Alaska are protected by federal and state laws. Also, a permit is often required to land on islands where puffins are nesting. In the puffin colonies along the coasts of California, Oregon, and Washington, population size has been declining since the beginning of the century due to decreasing numbers of fish, ocean pollution, and oil spills. As with most species, puffins have fallen victim to the expansion of humans. To attempt to make up for human takeover of land that was once used for puffin nesting, some programs have been set up to restore of former nesting colonies and help reduce the risk to populations by establishing more nesting sites. (Paul 1994, Small 1994)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.3,500,000 individuals (del Hoyo et al. 1996), while national population sizes have been estimated at < c.100 breeding pairs and c.50-1,000 wintering individuals in Japan and c.10,000-1 million breeding pairs c.1,000-10,000 wintering individuals in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Many Alaskan colonies probably have been devastated by introduced foxes (Lensink 1984). Present low numbers in California possibly are due to oil pollution and/or crash in the sardine population. Many are killed in Japanese gill-net fishery in North Pacific. See Lensink (1984), King (1984), and Ogi (1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Fratercula cirrhata does no harm to humans. Puffins will only harm people when they intrude on their nesting sites. They have a beak strong enough to bite through a human finger to the bone. (Lockley 1953)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Tufted puffins were historically hunted for food. Hunting puffins is discouraged nowadays in most places, and forbidden by law in others, but people who do still hunt them try to capture only non-breeding animals. In the past, skins were used to make tough parkas worn feather side in. Puffins are also used as tourist attractions for communities near healthy colonies, but visitors must watch the birds from the ocean. Because human disturbances may cause puffins to leave their nesting sites, people are often prohibited from landing at nesting sites. Puffins are also indicators of a healthy ocean, and show humans when over-fishing is occuring. When there are fewer fish in the ocean, puffins bring a noticeably reduced amount of fish ashore. (Paul 1994, Kessel 1989)

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tufted Puffin

The tufted puffin (Fratercula cirrhata) also known as crested puffin, is a relatively abundant medium-sized pelagic seabird in the auk (Alcidae) family found throughout the North Pacific Ocean. It is one of three species of puffin that make up the Fratercula genus and is easily recognizable by its thick red bill and yellow tufts.

Description[edit]

1895 portrait of breeding adult

Tufted puffins are around 35 cm (15 in) in length with a similar wingspan and weigh about three quarters of a kilogram (1.6 lbs). Birds from the western Pacific population are somewhat larger than those from the eastern Pacific, and male birds tend to be slightly larger than females.[2]

Adult in winter plumage

They are mostly black with a white facial patch, and, typical of other puffin species, feature a very thick bill which is mostly red with some yellow and occasionally green markings. Their most distinctive feature and namesake are the yellow tufts (Latin: cirri) that appear annually on birds of both sexes as the summer reproductive season approaches. Their feet become bright red and their face also becomes bright white in the summer. During the feeding season, the tufts moult off and the plumage, beak and legs lose much of their lustre.

As among other alcids, the wings are relatively short, adapted for diving, underwater swimming and capturing prey rather than gliding, of which they are incapable. As a consequence, they have thick, dark myoglobin-rich breast muscles adapted for a fast and aerobically strenuous wing-beat cadence, which they can nonetheless maintain for long periods of time.

Juveniles

Juvenile tufted puffins resemble winter adults, but with a grey-brown breast shading to white on the belly, and a shallow, yellowish-brown bill.[2] Overall, they resemble a horn-less and unmarked rhinoceros auklet (Cerorhinca monocerata).

Taxonomy[edit]

The tufted puffin was first described in 1769 by German zoologist Peter Simon Pallas. Its generic name is derived from the Latin Fratercula "little brother", and the specific epithet cirrhata means "tufted".[3] Since it may be more closely related to the Rhinoceros Auklet than the other puffins, it is sometimes placed in the monotypic genus Lunda.

The juveniles, due to their similarity to C. monocerata, were initially mistaken for a distinct species of a monotypic genus, and named Sagmatorrhina lathami ("Latham's saddle-billed auk", from sagmata "saddle" and rhina "nose").

Distribution and Habitat[edit]

Tufted puffins form dense breeding colonies during the summer reproductive season from British Columbia, throughout southeastern Alaska and the Aleutian Islands, Kamchatka, the Kuril Islands and throughout the Sea of Okhotsk.[4] While they share some habitat with horned puffins (F. corniculata), the range of the tufted puffin is generally more eastern. They have been known to nest in small numbers as far south as the northern Channel Islands, off southern California.[5] However, the last confirmed sighting at the Channel Islands occurred in 1997.[6]

Tufted puffins typically select islands or cliffs that are relatively inaccessible to predators, close to productive waters, and high enough that they can take to the air successfully. Ideal habitat is steep but with a relatively soft soil substrate and grass for the creation of burrows.[7]

During the winter feeding season, they spend their time almost exclusively at sea, extending their range throughout the North Pacific and south to Japan and California.

Behavior[edit]

Adult outside nesting burrow on the Kuril Islands

Breeding[edit]

Breeding takes place on isolated islands: over 25,000 pairs have been recorded in a single colony off the coast of British Columbia. The nest is usually a simple burrow dug with the bill and feet, but sometimes a crevice between rocks is used instead. It is well-lined with vegetation and feathers. Courtship occurs through skypointing, strutting, and billing. A single egg is laid, usually in June, and incubated by both parents for about 45 days. Fledglings leave the nest at between 40 and 55 days.

Adult swimming at the Henry Doorly Zoo

Diet[edit]

Tufted puffins feed almost exclusively on fish, which they catch by diving from the surface. Adults may also feed on squid or other invertebrates. Feeding areas can be located far offshore from the nesting areas. Puffins can store large quantities of small fish in their bills and carry them to their chicks.

Predators and threats[edit]

Tufted puffins are preyed upon by various avian raptors such as snowy owls, bald eagles and peregrine falcons, and mammals like the Arctic foxes. Foxes seem to prefer the puffin over other birds, making the bird a main target. Choosing inaccessible cliffs and entirely mammal-free islands protects them from terrestrial predators while laying eggs in burrows is effective in protecting them from egg-scavengers like gulls and ravens.[2]

Relationship with humans[edit]

The Aleut and Ainu people of the North Pacific traditionally hunted tufted puffin for food and feathers. Skins were used to make tough parkas worn feather side in and the silky tufts were sewn into ornamental work. Currently, harvesting of tufted puffin is illegal or discouraged throughout its range.[7]

The tufted puffin is a familiar bird on the coasts of the Russian Pacific coast, where it is known as toporik (топорик) – roughly meaning "axe-bill" –, while the other puffins are collectively called túpiki (ту́пики) in Russian. F. cirrhata is the namesake of one of its main breeding sites, Kamen Toporkov ("Tufted Puffin Rock") or Ostrov Toporkov ("Tufted Puffin Island"), an islet offshore Bering Island.

Conservation status in Puget Sound[edit]

Many rules and regulations have been set out to try to conserve fishes and shorebirds in Puget Sound. The Department of Natural Resources (DNR) of Washington State has created aquatic reserves surrounding Smith and Minor Islands.[8] Over 36,000 acres (150 km2) of tidelands and seafloor habitat were included in the proposed aquatic reserve. Not only do these islands provide the necessary habitat for many seabirds such as tufted puffins and marine mammals, but this area also contains the largest kelp beds in all of Puget Sound. In addition, Protection Island reserve has also been off limits to the public to aid marine birds in breeding. Protection Island contains one of the last two nesting colonies of puffins in Puget Sound, and about 70% of the tufted puffin population nests on this island.[9]

References[edit]

  1. ^ BirdLife International (2012). "Fratercula cirrhata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Gaston, A. J.; Jones, I. L. (1998). The Auks: Alcidae. Oxford: Oxford University Press. ISBN 0-19-854032-9. 
  3. ^ Simpson, D. P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd. p. 883. ISBN 0-304-52257-0. 
  4. ^ Artyukhin, Yu.B.; Burkanov, V.N. (1999). Morskiye ptitsy i mlekopitayushchiye Dalnego Vostoka Rossii [Sea birds and mammals of the Russian Far East: A Field Guide] (in Russian). Мoscow: АSТ Publishing. p. 215. 
  5. ^ McChesney, G. J.; Carter, H. R.; Whitworth, D. L. (1995). Reoccupation and Extension of Southern Breeding Limits of Tufted Puffins and Rhinoceros Auklets in California. Waterbird Society. 
  6. ^ McChesney, G. J.; Carter, H. R. (2008). Studies of Western Birds 1. pp. 213–217. 
  7. ^ a b Stirling, K. (2000). "Fratercula cirrhata". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2012-08-22. 
  8. ^ "Smith & Minor Islands Aquatic Reserve Management Plan" (pdf). Seattle, WA: Washington State Department of Natural Resources. 2010. 
  9. ^ Chew, J. (2010-11-04). "DNR ceremony seals Protection Island Aquatic Reserve". Peninsula Daily News. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Often placed in the monotypic genus LUNDA (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!