Overview

Comprehensive Description

The Azure Kingfisher is a small kingfisher with a long slender black bill and a short tail. The head, neck, upper parts and breast sides are deep azure blue with a violet (purplish) sheen. The neck has a distinctive orange stripe on each side and there is a small orange spot before each eye. The throat is pale orange-white, grading to orange-reddish on belly and undertail. The flanks and sides of the breast are washed purple to violet. The legs and feet are red. The sexes are similar. Young birds have a darker cap and are generally duller.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Subspecies and Distribution:



    * affinis (G. R. Gray, 1860) - Morotai, Halmahera and Bacan (N Moluccas). *lessonii (Cassin, 1850) - W Papuan Is and lowland S New Guinea E to D’Entrecasteaux Is, also Aru Is. *ochrogaster (Reichenow, 1903) - islands in Geelvink Bay, and N New Guinea from R Mamberano E to Astrolabe Bay, S to Wahgi Valley, also Karkar I and Admiralty Is. * yamdenae (Rothschild, 1901) - Romang (E Lesser Sundas) and Tanimbar Is. * ruficollaris (Bankier, 1841) - N Australia, from Kimberley E to Cooktown. * azurea Latham, 1801 - E & SE Australia, from Cooktown S to Victoria. * diemenensis (Gould, 1846) - Tasmania.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

18 cm, male 29-32 g, female 31-35 g

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The Azure Kingfisher is a small kingfisher with a long slender black bill and a short tail. The head, neck, upper parts and breast sides are deep azure blue with a violet (purplish) sheen. The neck has a distinctive orange stripe on each side and there is a small orange spot before each eye. The throat is pale orange-white, grading to orange-reddish on belly and undertail. The flanks and sides of the breast are washed purple to violet. The legs and feet are red. The sexes are similar. Young birds have a darker cap and are generally duller.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is never far from water, preferring freshwater rivers and creeks as well as billabongs, lakes, swamps and dams, usually in shady overhanging vegetation. It is sometimes seen in parks on rivers, as well as duck or goldfish ponds in urban areas. Sea-level and lower altitudes, to 1520 m in New Guinea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Plunges from overhanging perches into water to catch prey. Prey items include: fish, crustaceans, aquatic insects and other invertebrates, and, sometimes, frogs. They will often bash their prey against the perch before swallowing it head first. Often watch Platypuses foraging underwater and catch any food items that are disturbed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

VOICE: Usually silent, but has high thin whistle when flying: 'pee-ee, pee-ee'.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Form monogamous pairs that defend a breeding territory. Both parents incubate and feed the chicks. The nest is at the end of a burrow dug out of soil in a riverbank. The tunnel slopes upwards to the nesting chamber and can be 80 cm - 130 cm long. Flooding can destroy low-lying burrows. Breeding season: September to January Clutch size: 4 to 7, usually 5 Incubation: 21 days Time in nest: 28 days

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alcedo azurea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTATACCTAATCTTCGGTGCATGAGCTGGCATAATCGGCACCGCCCTAAGCCTCCTCATCCGCGCAGAATTAGGCCAGCCAGGCACACTTCTAGGAGATGACCAAATCTACAACGTAATTGTCACCGCCCATGCTTTCGTCATAATTTTCTTCATGGTCATACCCATCATAATTGGCGGATTTGGAAACTGACTTGTCCCCCTAATAATCGGGGCCCCAGACATGGCATTTCCCCGCATAAACAACATGAGCTTCTGACTCCTCCCACCATCATTCCTTCTACTCTTAGCCTCCTCTACAGTTGAAGCAGGTGCTGGCACAGGTTGAACCGTATACCCCCCACTAGCCGGCAACCTCGCCCACGCTGGGGCTTCAGTAGACCTAGCTATCTTCTCCCTTCATTTAGCAGGAGTATCATCCATCCTAGGGGCAATTAACTTCATTACAACTGCCACCAACATAAAACCACCAGCCCTCTCCCAATACCAAACCCCACTTTTTGTATGATCCGTATTAATCACCGCCGTACTTCTTCTCCTATCGCTACCAGTCCTTGCTGCCGGCATCACTATACTGCTAACAGACCGTAACCTAAACACCACCTTCTTTGATCCCGCCGGAGGAGGAGATCCAATCCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alcedo azurea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as widespread in the north of its range (del Hoyo et al. 2001).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Azure Kingfisher

The azure kingfisher (Alcedo azurea) is a small kingfisher (17–19 centimetres (6.7–7.5 in)), in the river kingfisher family, Alcedinidae. It is found in Northern and Eastern Australia and Tasmania, as well as the lowlands of New Guinea and neighbouring islands, and out to North Maluku and Romang.

It is a very colourful bird, with deep blue to azure back, a large white to buff spot on side of neck and throat, rufous-buff with some blue-violet streaks on breast and flanks. The feet are red with only two forward toes. The lores (the region between the eye and the bill) are white and inconspicuous except in front view, where they stand out as two large white eye-like spots which may have a role in warding off potential predators.

Azure kingfisher showing large white eye-like lores

The subspecies differ only in minor details. ruficollaris is smaller, brighter, and has more blue on the flanks. diemenensis is rather large, short-billed, and has a distinctly darker crown. lessoni is more contrasting, with little blue on the flanks. affinis has a red billtip, as has the smaller yamdenae, and ochrogaster is very pale below. Still, there is very little intergradation in the areas where subspecies meet. Comparing subspecific variation with climate data, the former's pattern does not follow and in some instances runs contrary to Bergmann's Rule and Gloger's Rule (Schodde & Mason, 1976, Woodall, 2001).

The contact zone between the mainland Australian subspecies is along the east coast of Far North Queensland, between Cairns and Princess Charlotte Bay (Schodde & Mason 1976), that of the New Guinea ones between Simbu Province and the northern Huon Peninsula, as well as south of Cenderawasih Bay (Woodall, 2001).

Habitat includes the banks of vegetated creeks, lakes, swamps, tidal estuaries and mangroves. Often difficult to see until it quickly darts from a perch above water. Feeds on freshwater yabbies and small fish. Nest in a chamber up to 1 metre long in an earthen creek bank. 5–7 white, rounded, glossy eggs. Voice is a high-pitched, shrill, 'pseet-pseet'.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!