Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Geographic Range

White-throated kingfishers range from Turkey in the west to the Philippines in the east, including Afghanistan, Bangladesh, Bhutan, Cambodia, China, Egypt, India, Indonesia, Iran, Iraq, Israel, Jordan, Kuwait, Laos, Lebanon, Malaysia, Myanmar, Nepal, Pakistan, Saudi Arabia, Singapore, Sri Lanka, Syria, Taiwan, Thailand, and Vietnam.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Anderton, J., P. Rassmussen. 2005. Birds of South Asia. The Ripley Guide. Vols. 1 and 2. Barcelona: Smithsonian Institution and Lynx Edicions.
  • International Union for Conservation of Nature and Natural Resources. 2006. "2006 IUCN Red List of Threatened Species" (On-line). Accessed May 13, 2007 at http://www.iucnredlist.org/search/details.php/47716/all.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

White-throated kingfishers have thick, reddish-orange bills, red legs, and dark chocolate-colored heads, bellies, and shoulders. A brilliant white patch can be found on the throat and sometimes the breast. The wings and tail are bright blue with white patches on the primaries and black distal tips. The sexes appear similar. Juvenile birds are generally less brilliantly-colored with duskier bills and less brown on the wings. Young individuals may also sport a shoulder mark with extensive blue edging. White-throated kingfishers are the only South Asian kingfisher that is distinctly darker below than it is above. Adult birds weigh 65.5 to 81 grams. Basal metabolic rate has not been recorded.

There are several recognized subspecies.

Halcyon smyrnensis smyrnensis, one of the two larger subspecies, ranges from the Gulf of Khambhat in India west to Saudi Arabia. This subspecies is bright blue-green above and has pale brown underparts.

Halcyon smyrnensis fusca is a resident in the whole of India and ranges upward into parts of Nepal and Sikkim. This subspecies also has a bright blue-green back, but its belly is more darkly chocolate-colored and it is smaller than H. smyrnensis smyrnensis.

Halcyon smyrnensis perpulchra is found in east Pakistan northern India, Bangladesh, Myannmar, Thailand, Malaysia, southeast China and Taiwan. This subspecies is on the smaller side and is more purplish-blue above than the previous two supspecies.

Halcyon smyrnensis saturatior is found on the Andaman Islands. This subspecies is also purplish-blue, but it is larger than H. smyrnensis perpulchra and it also bears a darker brown belly.

Range mass: 65.5 to 81 g.

Range length: 194 to 210 mm.

Range wingspan: 113 to 129 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Wells, D. 1999. The Birds of the Thai-Malay Peninsula Vol. I. Bath: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-throated kingfishers are common in agricultural areas, swamps, marshes, near ponds, lakes, in parklands and in mangrove swamps. In India they seem to be less reliant on particular aquatic habitats than other kingfishers and can be found in dry decidious forests in addition to rice paddies, oil palm plantations, drainage ditches, gardens, fishponds and even beaches. Though they feed on fish, white-throated kingfishers are not deep divers and do not spend significant amounts of time underwater.

Range elevation: 0 to 2300 m.

Habitat Regions: tropical ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: forest ; scrub forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

  • Ali, S., S. Ripley. 1983. Handbook of the Birds of India and Pakistan Vol. 4. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

White-throated kingfishers are carnivorous generalists that eat many organisms, including locusts, crickets, beetles, mantises, ants, termites, dragonflies, grasshoppers, Ocypode and Paratelphusa crabs , scorpions, centipedes, Mabuya and Calotes lizards, mice, frogs, small perching birds, and fish. Individuals hunt by flying forth from an observation post over clear ground or water to seize prey. Prey is often seized off the ground and then flown to the perch, where it is bludgeoned or stabbed before being swallowed.

Animal Foods: birds; mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

White-throated kingfishers are medium-sized generalist predators that feed on a wide variety of small creatures and help to keep various populations in check. The literature does not list specific parasites of Halcyon smyrnensis, or other organisms that have special mutualistic relationships with this species. It seems possible that white-throated kingfishers are subject to parasitism by protists of the genus Plasmodium and it is almost certain that Haemoproteus halcyonis (a blood parasite of other Halcyon species) uses white-throated kingfishers as hosts.

Commensal/Parasitic Species:

  • Haemoproteus halcyonis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Specific predators of white-throated kingfishers have not been reported. It seems reasonable to assume that white-throated kingfishers are subject to predation by large birds of prey, and probably snakes and rodents while they are nesting.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

White-throated Kingfishers are very vocal birds, their vocalizations being characterized as "a loud defiant rattling laugh." Breeding males are the most noted for their calls.. They have several calls which include a sharp repetition of high pitched KRICH-KRICH tones of 2-4 kHz at a rate of 2-4 notes per second. The particular song of the White-throated Kingfisher is a very loud descening trill (2-3 kHz), composed of speparate notes (10-11 per second), which trail off in pitch and volume.

During the mating season male White-throated Kingfishers accompany their nearling constant singing with a repeated brief display of the their white wing patches to intimidate potential rivals. While perched atop a tree, fencepost, or other visible station, the male will let out his distinctive call, then flap his wings swiftly several times parallel to the horizon.

The female White-throated Kingfisher also employs her wings for signalling during the breeding months. To signal that she is receptive, the female kingfisher approaches the male, partially opens her wings and performs a shivering motion while letting out a repetitive clicking call.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

White-throated kingfisher average lifespan in or out of captivity is not recorded. Few white-throated kingfishers have been banded, but the longest interval between intitial banding and recapture is 5 years and six months.

Average lifespan

Status: captivity:
5.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Halcyon smyrnensis breeds seasonally and in monogamous pairs. According to the literature the formation of pairs has not been properly studied, but it is clear that one male and one female form a cooperative relationship to raise the young. It is not clear if this relationship seasonal or life-long.

Mating System: monogamous

White-throated kingfishers breed yearly in pairs, but it is unclear if a mated pair will remain together for more than one season. Breeding occurs from January through August, with most activity during the period from April to July. Breeding begins earliest in India and Sri Lanka. Mating birds dig a 50 cm to 1 m deep burrow into a vertical embankment or wall. The tunnel usual slants upward and terminates in a wider nesting chamber. The floor of this chamber is not lined, but usually becomes scattered with feeding and waste detritus. Both parents share the incubation of their 3 to 7 eggs for an unspecified amount of time. Chicks are altricial and born blind. Once the chicks have hatched, both parents also participate in feeding and caring for the young. The fledging period is from 18 to 20 days.

Overall there is little data on reproductive behavior in this or other Asian Halcyon species. Time to hatching, time to independence, number of clutches each pair rears and age at sexual maturity are unclear for this species.

Breeding interval: White-throated kingfishers breed once yearly.

Breeding season: Breeding generally occurs from January to August, with some local variation.

Range eggs per season: 3 to 7.

Range fledging age: 18 to 20 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents participate in nest-building, clutch incubation, and the feeding and general rearing of the offspring.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ali, S., S. Ripley. 1983. Handbook of the Birds of India and Pakistan Vol. 4. New York: Oxford University Press.
  • Wells, D. 1999. The Birds of the Thai-Malay Peninsula Vol. I. Bath: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halcyon smyrnensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATACCTAATCTTTGGTGCTTGAGCCGGCATAGTAGGCACTGCCCTCAGCCTACTTATCCGCGCAGAGCTTGGCCAGCCCGGCACTCTCCTAGGAGATGACCAAATCTACAATGTTATCGTCACCGCCCATGCCTTCGTTATAATCTTCTTCATAGTTATGCCCATTATGATCGGCGGGTTCGGCAACTGACTTGTCCCCCTCATAATCGGCGCCCCAGACATAGCATTCCCGCGCATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCCTGCTCCTTCTAGCCTCATCCACAGTAGAAGCAGGCGCCGGTACAGGGTGAACAGTCTATCCCCCACTCGCTGGTAACCTAGCCCATGCAGGAGCTTCAGTGGACCTGGCCATCTTTTCCCTCCACCTAGCAGGTGTATCCTCCATCCTGGGAGCAATTAACTTCATCACAACCGCCACCAATATAAAACCTCCCGCCTTATCCCAATACCAAACACCACTATTTGTATGGTCCGTATTAATCACTGCCATCTTACTACTCCTATCACTTCCAGTCCTCGCCGCCGGCATCACCATATTACTAACAGACCGCAACCTAAACACCACATTCTTCGACCCCGCCGGAGGTGGCGACCCCGTACTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Halcyon smyrnensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-throated kingfishers are listed as a species of least concern on the IUCN Red List. Their large range and abundance in common habitats suggests they are not at current conservation risk.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified. In Europe, the breeding population is estimated to number 90-170 breeding pairs, equating to 270-510 individuals (BirdLife International 2004), but Europe forms <5% of the global range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

White-throated kingfishers can often be found around fish drying racks and may become a nuisance at ornamental fish ponds and commercial hatcheries. Though they also contribute to controlling agricultural pests, they can be considered aquaculture pests.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

White-throated kingfishers eat domestic and agricultural pests, including both mammalian and insect pests. Like many other generalists, these birds help control the populations of small vertebrates and invertebrates that might otherwise do costly damage to human works and food supplies.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-throated Kingfisher

The White-throated Kingfisher (Halcyon smyrnensis) also known as the White-breasted Kingfisher or Smyrna Kingfisher, is a tree kingfisher,[2] widely distributed in Eurasia from Bulgaria,[3] Turkey, West Asia east through the Indian Subcontinent to the Philippines. This kingfisher is a resident over much of its range, although some populations may make short distance movements. It can often be found well away from water where it feeds on a wide range of prey that includes small reptiles, amphibians, crabs, small rodents and even birds. During the breeding season they call loudly in the mornings from prominent perches including the tops of buildings in urban areas or on wires.

Contents

Description [edit]

White-throated Kingfisher (ssp. fusca)

This is a large kingfisher, 28 cm in length. The adult has a bright blue back, wings and tail. Its head, shoulders, flanks and lower belly are chestnut, and the throat and breast are white. The large bill and legs are bright red. The flight of the White-throated Kingfisher is rapid and direct, the short rounded wings whirring. In flight, large white patches are visible on the blue and black wings. Sexes are similar, but juveniles are a duller version of the adult.

This species forms a superspecies with Halcyon cyanoventris and most major works recognize four geographic races. They vary clinally in size, the shades of blue on the mantle which is more greenish in smyrnensis and fusca and more blue or purplish in saturatior.

  • smyrnensis (Linnaeus, 1758) is found in Turkey, Northern and Central Israel,[4] Egypt, Iraq, Pakistan, Afghanistan, northwestern India, China, Taiwan and the Philippines, south of Thailand, West Malaysia, Singapore, Sumatra and Java.
  • fusca (Boddaert, 1783) is found in India, Sri Lanka, South China, Taiwan, Sumatra and West Java. Population from Burma to the Greater Sundas were treated under the name perpulchra but are now lumped into fusca. South China and Taiwanese populations are sometimes treated as subspecies fokiensis.
  • saturatior Hume, 1874 is found in the Andaman Islands.
  • gularis (Kuhl, 1820) is found in the Philippines.
A pair of fusca

H. s. gularis of the Philippines has only the neck and throat white. It is sometimes treated as a distinct species, H. gularis. Race fusca is found in Peninsular India and Sri Lanka and is slightly smaller, bluer and with a darker brown underside than the nominate race found in northwestern India. Race saturatior is found in the Andaman Islands and is larger with darker brown underparts. Race perpulchra (not always recognized) is found in northeastern India and is smaller than fusca with paler underparts.[5] Albinism has been noted on occasion.[6]

The English of White-throated was introduced since the range is large and geographic adjectives would make the name too restrictive, while the older name of White-breasted would not describe the eastern race which has only the throat white.

Geographic variation in plumage

The call of this kingfisher is a chuckling chake-ake-ake-ake-ake. They are particularly noisy in the breeding season.

Local names include Baluchistan: Aspi chidok; Sindhi: Dalel; Hindi: Kilkila, Kourilla;Himachal Pradesh: Neela machhrala; Punjabi: Wadda machhera; Bengali: Sandabuk machhranga; Assamese: Masroka; Cachar: Dao natu gophu; Gujarati: Kalkaliyo, Safedchati kalkaliyo; Marathi: Khandya; Tamil: Vichuli; Telugu: Lakmuka, Buchegadu; Malayalam: Ponman; Kannada: Rajamatsi; Sinhalese: Pilihuduwa.[7]

Habitat and distribution [edit]

Perched on a wire

White-throated Kingfisher is a common species of a variety of habitats, mostly open country in the plains (but has been seen at 7500 ft in the Himalayas[8]) with trees, wires or other perches. The range of the species is expanding.

This kingfisher is widespread and populations are not threatened. Average density of 4.58 individuals per km2. has been noted in the Sundarbans mangroves.[9]

Behaviour and ecology [edit]

Immature showing patchy white bib (Kolkata, India)

Feeding and diet [edit]

It perches conspicuously on wires or other exposed perches within its territory, and is a frequent sight in south Asia. This species mainly hunts large crustaceans,[10] insects, earthworms,[11] rodents, snakes, fish and frogs.[12][13] Predation of small birds such as the Oriental White-eye, chick of a Red-wattled Lapwing, sparrows and munias have been reported.[14][15][16] The young are fed mostly on invertebrates.[17] In captivity, it has been noted that it rarely drinks water although bathing regularly.[18]

Breeding [edit]

The White-throated Kingfisher begins breeding at the onset of the Monsoons. Males perch on prominent high posts in their territory an call in the early morning. The tail may be flicked now and in its courtship display the wings are stiffly flicked open for a second or two exposing the white wing mirrors. They also raise their bill high and display the white throat and front. The female in invitation makes a rapid and prolonged kit-kit-kit... call. The nest is a tunnel (50 cms long, but a nest with a 3 foot tunnel has been noted[19]) in an earth bank. The nest building begins with both birds flying into a suitable mud wall until an indentation is made where they can find a perch hold. They subsequently perch and continue digging the nest with their bills. Nest tunnels in a haystack have also been recorded.[20] A single clutch of 4-7 round white eggs is typical. The eggs take 20–22 days to hatch while the chicks fledge in 19 days.[14][21][22]

Movements [edit]

Birds have sometimes been seen attracted to lights at night, especially during the monsoon season, suggesting that they are partly migratory.[14]

Mortality [edit]

With a powerful bill and rapid flight, these kingfishers have few predators when healthy and rare cases of predation by a Black Kite[23] and a Jungle Crow may be of sick or injured birds.[24] An individual found dead with its beak embedded into the wood of a tree has been suggested as an accident during rapid pursuit of prey, possibly an Oriental White-eye.[16] A few parasites have been noted.[25]

In the 1800s these birds were hunted for their bright feathers that were used to adorn hats.[26]

References [edit]

  1. ^ BirdLife International (2012). "Halcyon smyrnensis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Fry, Fry and Harris. Kingfishers, Bee-eaters and Rollers. ISBN 0-7136-8028-8. 
  3. ^ Spasov S (2006). "The first record of White-throated Kingfisher Halcyon smyrnensis for Bulgaria". Sandgrouse 28 (1): 76–77. 
  4. ^ Arnold, Paula: Birds of Israel, (1962), Shalit Publishers Ltd., Haifa, Israel. p. 12
  5. ^ Rasmussen, PC & JC Anderton (2005). Birds of South Asia. The Ripley Guide. Smithsonian Institution and Lynx Edicions. 
  6. ^ Gunawardana, Jagath (1993). "Description of an albino White-breasted Kingfisher (Halcyon smyrnensis).". Ceylon Bird Club Notes (June): 56–57. 
  7. ^ Anonymous (1998). "Vernacular Names of the Birds of the Indian Subcontinent" (PDF). Buceros 3 (1): 53–109. 
  8. ^ Khacher, Lavkumar J (1970). "Notes on the White-eye (Zosterops palpebrosa) and Whitebreasted Kingfisher (Halcyon smyrnensis).". J. Bombay Nat. Hist. Soc. 67 (2): 333. 
  9. ^ Reza AHMA, MM Feeroz, MA Islam & MMKabir (2003). "Status and density of kingfishers (family: Alcedinidae, Halcyonidae and Cerylidae) in the Sundarbans mangrove forest, Bangladesh" (PDF). Bangladesh J. Life Sci. 15 (1): 55–60. 
  10. ^ Tehsin, Raza (1995). "Crab-eating by Whitebreasted Kingfisher Halcyon smyrnensis (Linn.).". J. Bombay Nat. Hist. Soc. 92 (1): 121. 
  11. ^ Yahya, HSA; Yasmin,Shahla (1991). "Earthworms in the dietary of the Whitebreasted Kingfisher Halcyon smyrnensis (Linn.).". J. Bombay Nat. Hist. Soc. 88 (3): 454. 
  12. ^ Roberts,T J; Priddy,C (1965). "Food of the Whitebreasted Kingfisher Halcyon smyrnensis (Linnaeus)].". J. Bombay Nat. Hist. Soc. 62 (1): 152–153. 
  13. ^ Tehsin ,Raza (1989). "Feeding behaviour of Whitebreasted Kingfisher Halcyon smyrnensis (Linnaeus).". J. Bombay Nat. Hist. Soc. 86 (3): 449. 
  14. ^ a b c Ali, S & S Dillon Ripley (1983). Handbook of the birds of India and Pakistan 4 (2 ed.). Oxford University Press. pp. 90–93. 
  15. ^ Sen, SN (1944). "Food of the White-breasted Kingfisher (Halcyon smyrnensis fusca)". J. Bombay Nat. Hist. Soc. 44 (3): 475. 
  16. ^ a b Purandare, Kiran Vasant (2008). Freak accidental death of a White-breasted Kingfisher Halcyon smyrnensis. Indian Birds 4 (1). 
  17. ^ Burton NHK (1998). "Notes on the diet of nestling White-throated Kingfishers Halcyon smyrnensis in Malaysia" (PDF). Forktail 14: 79–80. 
  18. ^ Harper, EW. "The White-breasted Kingfisher Halcyon smyrnensis in captivity.". J. Bombay Nat. Hist. Soc. 13 (2): 364–365. 
  19. ^ Law, SC (1925). "Nesting habits of the Indian Whitebreasted Kingfisher Halcyon smyrnensis fusca.". J. Bombay Nat. Hist. Soc. 30 (2): 477–478. 
  20. ^ Balasubramanian,P (1992). "New nesting site of the Indian Whitebreasted Kingfisher Halcyon smyrnensis fusca (Boddaert).". J. Bombay Nat. Hist. Soc. 89 (1): 124. 
  21. ^ Palkar SB, RJ Lovalekar & VV Joshi (2009). "Breeding biology of White-breasted Kingfisher Halcyon smyrnensis.". Indian Birds 4 (3): 104–105. 
  22. ^ Hume, AO (1890). The nests and eggs of Indian birds 3 (2 ed.). R H Porter, London. pp. 15–19. 
  23. ^ Narayanan, E (1989). "Pariah Kite Milvus migrans capturing Whitebreasted Kingfisher Halcyon smyrnensis.". J. Bombay Nat. Hist. Soc. 86 (3): 445. 
  24. ^ Balasubramanian, P. (1990). "Behaviour of southern spotted owlet Athene brama brama (Temminck) and jungle crow (Temminck) and jungle crow Corvus macrorhynchos at Point Calimere, Tamil Nadu.". J. Bombay Nat. Hist. Soc. 87 (1): 145. 
  25. ^ Nandi AP; De NC; Majumdar G (1985). "Records of two new nematodes (Acuariidae) parasitizing kingfishers (Coraciiformes) of West Bengal India". Helminthologia 22 (3): 161–170. 
  26. ^ Lockwood, Edward (1878). Natural history, sport and travel. W H Allen and Co. pp. 185–186. 

Other sources [edit]

  • Mohanty, Banalata (2006). "Extracellular Accumulations in the Avian Pituitary Gland: Histochemical Analysis in Two Species of Indian Wild Birds.". Cells Tissues Organs 183 (2): 99–106. doi:10.1159/000095514. PMID 17053326. 
  • Oommen, M; Andrews, MI (1996). "Awakening, roosting and vocalization behaviour of the Whitebreasted Kingfisher Halcyon smyrnensis fusca (Boddaert).". Pavo 34 (1&2): 43–46. 
  • Oommen, M; Andrews, MI (1993). "Breeding biology of the Whitebreasted Kingfisher, Halcyon smyrnensis". In Verghese,A; Sridhar,S; Chakravarthy,AK. Bird Conservation: Strategies for the Nineties and Beyond. Ornithological Society of India, Bangalore. pp. 177–180. 
  • Ticehurst, CB (1927). "[Remarks on races of Halcyon smyrnensis and descriptions of two new subspecies - Zosterops palpebrosa occidentis and Z.P. nilgiriensis].". Bull. Brit. Orn. Club 47 (312): 87–90. 
  • Oommen, M; Andrews,MI (1998) Food and feeding habits of the Whitebreasted Kingfisher Halcyon smyrnensis. Chap. 19. In: Birds in Agricultural Ecosystem. (Eds: Dhindsa,MS; Rao,P Syamsunder; Parasharya,BM) Society for Applied Ornithology, Hyderabad, 132-136.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!