Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Comprehensive Description

The Ringed Kingfisher (Megaceryle torquata, formerly Ceryle torquata) is the largest Kingfisher in the Americas (Henderson 2010). They can grow up to 41 cm and weigh up to 290g (Stiles and Skutch 1989). This species is sexually dimorphic in coloration. Males have a slate grey coloration above, a rufous breast, and a white collar in between (Fogden 2005). Additionally, they have white spots in front of and behind the eyes (Stiles and Skutch 1989). They also have a bushy crest that is finely streaked with black and wing and tail feathers that are black, spotted and barred with white, and broadly edged with blue and grey (Stiles and Skutch 1989). Females look similar, however the grey extends to the top of the breast and is separated from the rufous breast by a second white band (Fogden 2005). Juveniles resemble females but the breast is paler and the white band on the chest is indistinct or absent (Brush 2009).

Ringed Kingfishers are found up to 900m in elevation from Southern Texas to Tierra del Fuego and in the Lower Antilles (Stiles and Skutch 1989). The Ringed Kingfisher has a large range, the population is large and increasing, so the species is considered of Least Concern by BirdLife International (2013).

These kingfishers hunt in both fresh and salt water along rivers, lakes and estuaries (Fogden 2005). The North American populations are non-migratory (Brush 2009). They dive from higher perches than many other kingfisher species and return immediately to their perch after catching prey (Fogden 2005). Unlike other kingfisher species, the Ringed Kingfisher does not hover over the water while hunting (Henderson 2010). They feed almost exclusively on fish, but occasionally eat crabs and other crustaceans (Brush 2009).

They make burrows in banks with an unlined chamber at the end (Stiles and Skutch 1989). Both sexes participate in constructing the nest (Brush 2009). The horizontal tunnel is 15 centimeters (6 inches) high, 10 centimeters (4 inches) wide, and 1.2 to 1.8 meters (6 to 8 feet) deep (Henderson 2010). In Costa Rica, Ringed Kingfishers nest from January to March (Henderson 2010). Females lay 3 to 5 eggs per season (Stiles and Skutch 1989). Chicks are feathered after 24 days and leave the nest 35-38 days after hatching (Brush 2009). They are solitary except while breeding; both males and females defend the territory during the breeding season (Brush 2009).

Ringed Kingfishers are very vocal. They utter a loud “klek-klek-klek” rattling alarm call when disturbed (Henderson 2010). A single, loud “klek” is used as contact call; pair members alternate low calls while raising and lowering the tail (Stiles and Skutch 1989).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: from southern Sinaloa, Nuevo Leon, and southern Texas south through most of South America (migratory in southern South America); also in the Lesser Antilles. Occasionally wanders northward to central Texas in northern fall and winter (AOU 1983). To 1100 m in Honduras, 1300 m in Panama, and 1500 m in Guatemala, but uncommon much above 500 m (Fry and Fry 1992). See Fry and Fry (1992) for descriptions of the ranges of the 3 weakly differentiated subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 41 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Lakes, rivers, streams, lagoons, and coastal regions (AOU 1983). Wide slow-flowing rivers, lowland lakes, marshes, estuaries, brackish coastal lagoons, mangroves, and sometimes open beaches; also sometimes ricefields, reservoirs, canals, water gardens in cities, and Chilean fiords (Fry and Fry 1992). In Colombia and Bolivia, frequents primarily open habitat along the edges of lakes and streams (Remson 1990). BREEDING: Nests in a horizontal burrow dug in a steep earth or sand bank usually along a river but occasionally in erosion gullies and road cuts well away from water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 833 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Nonmigratory except in southern South America; present at Isla Grande (Tierra del Fuego) from November to March, winters north to Valparaiso and Buenos Aires (Fry and Fry 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly fishes (up to about 20 cm long), also sometimes frogs, small aquatic reptiles, insects, and salamanders (Fry and Fry 1992), obtained by plunging into water often from an overhanging branch. Concentrates dives in the first 2 meters from shoreline (Remson 1990). Usually forages in heavily wooded places, but has been seen fishing on reefs 1 km offshore (Fry and Fry 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Basically solitary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Known egg laying months: about March in Texas, about January in Tamaulipas, April-May in Belize, about March-May in Panama, February and June in Suriname, April in Trinidad, August in Guyana, and about November in southern Chile (Fry and Fry 1992). Clutch size 3-6 (commonly 4-5). Incubation 22 days or more, by both sexes in turn. Young tended by both parents, leave nest at 33-38 days when able to fly strongly. Generally nests solitarily, but "colonies" of several to 150 pairs have been reported from the Orinoco River, Venezuela (Fry and Fry 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Megaceryle torquata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Megaceryle torquata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATACTTAATCTTCGGAGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTCATCCGAGCAGAACTAGGCCAACCTGGCACACTCCTAGGAGACGACCAAATCTACAATGTAATCGTTACAGCCCATGCCTTCGTCATAATTTTCTTTATAGTAATACCCATCATAATCGGGGGATTCGGAAACTGACTTGTGCCTTTAATAATTGGAGCCCCAGACATAGCATTTCCACGCATAAACAATATAAGCTTCTGACTCCTGCCCCCTTCATTCCTCCTCCTTCTCGCCTCCTCTACAGTAGAAGCAGGCGCAGGTACAGGATGAACGGTCTACCCGCCCCTCGCCGGCAACCTAGCTCACGCAGGAGCTTCAGTAGACTTAGCCATCTTCTCCCTTCACTTAGCAGGGGTATCTTCTATCTTAGGAGCAATCAACTTCATTACCACTGCCACCAACATAAAACCCCCAGCCTTGTCACAATACCAAACACCCTTGTTCGTCTGATCAGTCCTAATCACCGCTGTCCTTCTTTTACTATCCCTACCTGTACTTGCCGCTGGCATTACAATACTCCTCACAGACCGCAACTTAAACACCACATTCTTCGACCCAGCTGGAGGAGGTGACCCTATCTTATACCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTATATATCCTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ringed Kingfisher

The ringed kingfisher (Megaceryle torquata) is a large, conspicuous and noisy kingfisher, commonly found along the lower Rio Grande valley in southeasternmost Texas in the United States through Central America to Tierra del Fuego in South America.

The breeding habitat is areas near large bodies of water, usually in heavily wooded areas where it finds a perch to hunt from. It is mostly a sedentary species, remaining in territories all year long.

It is 40–41 cm long, with deep blue or bluish-gray plumage with white markings, a shaggy crest and a broad white collar around the neck. Its most distinguishing characteristic is the entire rufous belly, which also covers the entire breast of the male. Females are more colorful than the male (i.e., reverse sexual dimorphism) and have a bluish-gray breast and a narrow white stripe separating the breast from the belly.

These birds nest in a horizontal tunnel made in a river bank or sand bank. The female lays 3 to 6 eggs. Both parents excavate the tunnel, incubate the eggs and feed the young.

It is often seen perched prominently on trees, posts, or other suitable "watchpoints" close to water before plunging in head first after its fish prey. They also eat insects and small amphibians.

Their voice is a loud, penetrating rattle given on the wing and when perched.

The Megaceryle kingfishers were formerly placed in the genus Ceryle with the pied kingfisher, but the latter is genetically closer to the American green kingfishers.[citation needed]

Gallery[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Megaceryle was formerly (AOU 1993, 1998) treated as a subgenus of Ceryle Boie, but is returned to earlier generic status (AOU 1957) on the basis of evidence from mitochondrial and nuclear DNA (Moyle 2006). Includes 3 weakly differentiated subspecies, torquatus, stictipennis, and stellata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!