Overview

Distribution

Range

Coastal e Australia (Cape York to s New South Wales).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lopholaimus antarcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TAYCTAATCTTCGGGGAATGAGCAGGCATAGTCGGTACCGCACTCAGCCTCCTCATCCGCGCAGAACTTGGTCAACCAGGCACTCTCCTAGGAGAT---GACCAAATCTACAACGTAATTGTCACGGCCCACGCCTTTGTAATAATCTTCTTCATAGTCATGCCAATCATGATCGGGGGATTTGGAAACTGACTAGTACCCCTCATAATCGGTGCCCCTGACATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTCCTACTACTTTTAGCCTCCTCTACAGTTGAAGCCGGCGCAGGTACAGGATGAACCGTATACCCGCCCTTAGCCGGTAACATAGCCCACGCCGGAGCCTCCGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCAATCCTAGGCGCCATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCTTATTCGTATGATCCGTTCTCATTACCGCCGTCCTACTCCTCCTATCTCTCCCAGTCCTTGCCGCCGGCATTACCATGCTACTCACAGACCGAAACCTAAACACCACATTCTTCGACCCTGCTGGTGGAGGCGACCCMGTACTMTACCAACAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lopholaimus antarcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Topknot pigeon

The topknot pigeon (Lopholaimus antarcticus) is a pigeon native to Australia. It is also known by the name of flock pigeon.

Description[edit]

The birds are big, with length varying from 40 to 46 centimetres (16 to 18.4 inches). It has a pale grey breast, dark grey wings and a slaty-black tail with one light grey band. The beak is red-brown. The pigeon also has a flattened, wide and sweptback crest of feathers that commences at the beak to the nape of the neck. The crest consists of grey feathers at the front and brown-red feathers at the back. The juveniles are plainer in appearance with a brown bill. The tail band is less defined in the immature.

Habitat[edit]

The topknot pigeon generally occurs in groups that may number hundreds. They are strong fliers often seen over rainforests and valleys, but also around palm trees, figs, eucalyptus forests and other woodlands. They are highly arboreal; not only do they feed largely on fruits in the forest canopy, and often roost on trees that stand proud of the canopy, but they also generally rely on rainwater from raindrops in trees. However, in times of shortage, they occasionally forage over open country. Depending on food availability, the species ranges from Cape York in Queensland to near the South Coast of New South Wales, but they have not been reported as far south as Tasmania or the Gippsland Lakes in Victoria.

The species used to occur in enormous numbers in Australian rainforest, but the population declined because of forest clearance and shooting. Because of concern over the steep decline in their population, topknot pigeons now are a protected species in Australia. However the increasing prevalence of a new food source in the fruit of the 'weed' camphor laurel trees has seen a recent resurgence in their number. The birds generally are silent, but sometimes make soft, grumbling, grunting sounds. However, they do commonly squabble with each other and at such times they make short screeching noises rather like the squeals of pigs.

Breeding[edit]

Breeding occurs from July to January, when nests are usually built in rainforest trees high above the ground. The nests consist of long and loose twigs. One egg is laid that is large and slightly glossy.

Rush Creek, SE Queensland, Australia


References[edit]

  • Pizzey and Knight, "Field Guide to the Birds of Australia", Angus & Robertson, ISBN 0-207-19691-5
  • Trounsen and Trounsen, "Australian Birds: A Concise Photographic Field Guide, Cameron House. ISBN 1-875999-47-7.

External links[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!