Overview

Distribution

Range

Coastal e Australia (Cape York to s New South Wales).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lopholaimus antarcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TAYCTAATCTTCGGGGAATGAGCAGGCATAGTCGGTACCGCACTCAGCCTCCTCATCCGCGCAGAACTTGGTCAACCAGGCACTCTCCTAGGAGAT---GACCAAATCTACAACGTAATTGTCACGGCCCACGCCTTTGTAATAATCTTCTTCATAGTCATGCCAATCATGATCGGGGGATTTGGAAACTGACTAGTACCCCTCATAATCGGTGCCCCTGACATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTCCTACTACTTTTAGCCTCCTCTACAGTTGAAGCCGGCGCAGGTACAGGATGAACCGTATACCCGCCCTTAGCCGGTAACATAGCCCACGCCGGAGCCTCCGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCAATCCTAGGCGCCATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCTTATTCGTATGATCCGTTCTCATTACCGCCGTCCTACTCCTCCTATCTCTCCCAGTCCTTGCCGCCGGCATTACCATGCTACTCACAGACCGAAACCTAAACACCACATTCTTCGACCCTGCTGGTGGAGGCGACCCMGTACTMTACCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lopholaimus antarcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Topknot Pigeon

The Topknot Pigeon (Lopholaimus antarcticus) is a pigeon native to Australia. It is also known by the name of "Flock Pigeon".

Contents

Description

The birds are big, with length varying from 40 to 46 centimetres (16 to 18.4 inches). It has a pale grey breast, dark grey wings and a slaty-black tail with one light grey band. The beak is red-brown. The pigeon also has a flattened, wide and sweptback crest of feathers that commences at the beak to the nape of the neck. The crest consists of grey feathers at the front and brown-red feathers at the back. The juveniles are plainer in appearance with a brown bill. The tail band is less defined in the immature.

Habitat

The Topknot Pigeon is generally found in groups that can number in the hundreds. They are strong fliers and are often spotted over rainforests and valleys but are also are found around palm trees, figs, eucalyptus forests and woodlands. They are completely arboreal. The birds tend to feed on fruits in the forest canopy and often rest on trees above the canopy. They gain water from raindrops from trees. They are occasionally found in open country seeking food. Birds can often be found from Cape York in Queensland to the South Coast of New South Wales near the coast but have been seen as far south as Tasmania and the Gippsland Lakes in Victoria, depending on food availability. The species were observed in enormous numbers in areas that had rainforest but, unfortunately, numbers are declining because of the clearance of rainforests. Topknot pigeons are a protected species in Australia.

The birds are rarely heard but seem to produce soft, grumbling grunting noises. They commonly skirmish with each other and when skirmishing, they make short screech noises (akin to a pig).

Breeding

Breeding occurs from July to January, when nests are usually built in rainforest trees high above the ground. The nests consist of long and loose twigs. One egg is laid that is large and slightly glossy.

Rush Creek, SE Queensland, Australia


References

  • Pizzey and Knight, "Field Guide to the Birds of Australia", Angus & Robertson, ISBN 0-207-19691-5
  • Trounsen and Trounsen, "Australian Birds: A Concise Photographic Field Guide, Cameron House. ISBN 1-875999-47-7.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!