Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Description

The puffin is one of our most well-loved and easily recognised birds. It has a comical appearance, with its parrot-like, large colourful bill, red and black markings around the eyes (3), large pale cheek patches and bright orange legs (2). Young puffins lack the large colourful beak (2). In winter, adults lose their bright bill, and both adults and young have dark cheeks (3). A deep 'arrr-uh' noise is produced, which can be heard emanating from puffin burrows (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The clowns among the seabirds, that's what the puffin is often called. That's because of their large colorful beak. They only have this fancy forebeak during breeding season. During the winter, the forebeak is gone, leaving behind a short dark bill. Besides this aspect, puffins don't resemble clowns in any way. Clowns are clumsy but puffins are very handy. For example, they can hold lots of slippery fish in their beak at one time, sometimes as much as 10! You see them hanging out of the sides of the mouth while trying to catch just one more. Their secret to this trick has to do with their barbed palate. The bird uses its tongue to push the fish against the barbs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Throughout the year, the diet consists mainly of various species of fish, particularly sand eels. Puffins dive beneath the surface of the water and swim using their wings, in pursuit of prey (3). If they are feeding their young, they fill their bill with fish and carry them back to the burrow (3). For most of the year, puffins are out at sea, they return to land in order to breed. Just before the breeding season, the annual moult occurs; birds are flightless for a time after moulting, but they are still able to swim underwater, and can return to the breeding colonies between February and early April (4). Upon their return, comical displays can ensue, including bill-knocking and ritualised walking around the burrow entrance (3). New burrows may be made, or old ones utilised. A single egg is laid in a chamber at the end of the burrow in May. After an incubation period of up to 43 days, the chick hatches and remains inside the burrow for 6 weeks or so, after which time it becomes fully independent, dispersing out to sea (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: BREEDING: High arctic in eastern Canada and western Greenland south to Gulf of Maine (Matinicus Rock, Eastern Egg Rock, Seal Island) and from Iceland, Spitzbergen, Novaya Zemyla, and northwestern Russia south to northern France. NON-BREEDING: widely dispersed offshore, mostly in boreal waters, south to Massachusetts and Canary Islands (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Greenland and Northern Canada, Gulf of St. Lawrence, Nova Scotia, Iceland, Northern Scandinavia, Northern Russia, Ireland, and NW coast of France.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Belgian Exclusive Economic Zone, European waters (ERMS scope), Faroe Islands, Gulf of Maine, Iceland, Irish Exclusive economic Zone, North West Atlantic, Northern North Pacific, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; range extends throughout the Canadian Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Atlantic Puffin can be found throughout the North Atlantic Ocean, from north-west Greenland (to Denmark) to the coastline of Newfoundland (Canada) in the west, and from north Norway down to the Canary Islands, Spain in the east21.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern Atlantic. South to Long Island in western Atlantic. In eastern Atlantic, to North Sea, Morocco and Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in and around the North Atlantic (3). In winter they disperse over the open ocean reaching as far south as the Azores and Canary Islands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sexes are alike--11 1/2 to 13 1/2 inches long with a wingspread of 21-24 inches. These puffins are short, stocky with upper parts black and undersides white. Their cheeks are white. They have large parrotlike, triangular shaped bills, which in the breeding season are bright orange with a yellow-bordered patch of blue at the rear half. After the breeding season, they lose some of their horny bill plates and molt as well. Winter plumage is similar but faces are largely dark.

Average mass: 490.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 32 cm

Weight: 381 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 28-30 cm, Wingspan: 53-58 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Atlantic Puffins are pursuit-divers that catch most of their prey within 30 m of the water surface1. They are capable of diving to 60 m, although they usually forage at depths less than 30 m1,2. Birds gather on the water around nesting sites, sometimes for several days, before taking up residence on land3. They are frequently kleptoparasitised by Kittiwakes4. Breeding females make a greater contribution to feeding chicks than do males, whereas males spend a greater proportion of time at the breeding burrow5. Diet They prey on 'forage' species, including juvenile pelagic fishes, such as herring Clupea harengus, juvenile and adult capelin Mallotus villosus, and sandeel Ammodytes spp.8. At times, they also prey on juvenile demersal fishes, such as gadids7,9,10. Sandeels usually form the majority of the prey fed to chicks10,11,12,13,14, and many chicks starve during periods of low sandeel abundance10, although there are exceptions, such as at Skomer Island in 1969 when sprat made up the majority of the diet fed to chicks14. Foraging range This is a relatively wide-ranging species. When feeding chicks, birds generally forage within 10 km of their colony, but may range as far as 50 to 100 km or more6,7. A boat transect run on one day in 1970 found that 85% of all birds seen were concentrated within just 3 km of the colony3, but other studies have found peaks in the density of foraging birds at up to 40 km distance from the colony3,15,16,17. Similarly, surveys at the Isle of May, Scotland, suggest that birds forage close to the breeding colony, but also at other sites up to 40 km away 3,18. Various studies3,14,19,20, based on different breeding colonies, have estimated the theoretical maximum foraging radius at anywhere from 32 km14 to 200 km20..

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the summer, common puffins reside on rocky cliffs of the North Atlantic and northern Europe. They winter far at sea on deep, icy water and are seldom seen within sight of land until March.

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 50688 specimens in 1 taxon.
Water temperature and chemistry ranges based on 32728 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.455 - 19.253
  Nitrate (umol/L): 0.796 - 12.040
  Salinity (PPS): 30.418 - 37.775
  Oxygen (ml/l): 5.032 - 8.560
  Phosphate (umol/l): 0.068 - 0.809
  Silicate (umol/l): 0.565 - 7.673

Graphical representation

Temperature range (°C): -0.455 - 19.253

Nitrate (umol/L): 0.796 - 12.040

Salinity (PPS): 30.418 - 37.775

Oxygen (ml/l): 5.032 - 8.560

Phosphate (umol/l): 0.068 - 0.809

Silicate (umol/l): 0.565 - 7.673
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: primarily pelagic (AOU 1983). Most breeding colonies are on earthy islands where nests are in burrows (dug by puffin, rabbit, or other sea bird); in northern and central range large colonies occur among boulders; small populations may nest on cliff sites; usually uses nest site used in previous year. Tends to avoid areas used by great black-backed gull (preys on chicks and adults).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coastal and offshore, open ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Puffins nest in large colonies on offshore islands and inaccessible cliffs with grassy slopes in which burrows can be excavated (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Birds breeding in Greenland and Newfoundland probably remain in the wstern Atlantic region (Brown 1985). Returns to breeding grounds in Maine in March (Cowger 1976), in Newfoundland around mid-April (Harris and Birkhead 1985), in Greenland first half of May.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wintering range overlaps summer range, with exception of where pack ice has formed. Will move south to warmer waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common puffins dive from the air or surface and use their wings to swim underwater where they catch small fish, mollusks, and crustaceans. They swallow their catch underwater unless they're feeding their young, at which time they can carry back as many as 30 fish at a time in their bills .

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Summer diet mainly schooling fishes (herring, sandlance, capelin, gadids); importance of invertebrates (crustaceans, polychaetes) varies; chicks fed fishes; usually forages at depths of less than 60 m (Burger and Simpson 1986, Piatt and Nettleship 1985, Bradstreet and Brown 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish and crustaceans mainly. Also mollusks and marine worms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / associate
fruitbody of Trechispora clancularis is associated with occupied burrow of Fratercula arctica

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Global population 3.8-8.2 million, about half of which breed in Iceland (Nettleship and Evans 1985). North American population 350,000-400,000 breeding pairs (Rodway et al. 1996, Chardine 1999). Censuses in the 1970s and early 1980s yielded an estimate of about 365,000 breeding pairs in Canada/New England, mostly along the coasts of southeastern Newfoundland and Labrador; about 1100 pairs, Nova Scotia to Maine (population declined in late 1970s-early 1980s, Evans and Nettleship 1985). As of 1985, about 300 were breeding in Maine (Spendelow and Patton 1988). See Evans (1984) for population data from Greenland. Total population of F. A. GRAABE (European subspecies) estimated to be 901,000 (Lloyd et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Annual adult survival in each of several areas was 89% or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: In low latitude colonies, adults do not feed young at night (Bradstreet and Brown 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
383 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During courtship, mates fight on the water, pairs bill and by fighting attract other pairs until the whole ceremony tapers off. They copulate on the water. Puffins nest in colonies and construct nests by burrowing into loose soil 2-4 feet deep at tops of cliffs or on islands. The males do most of the burrow digging, using their beaks and webbed feet. Males stay with the females through the breeding season, and the pairs often sit outside the burrow. Eggs are laid between June and July, and usually only one egg is laid per pair. Eggs are round, white, and often spotted with brown. Both parents incubate by tucking the egg under one wing and leaning their body against it. Incubation lasts around 42 days. The newly hatched are fed very small fish. About 40 days after the chicks have hatched, they are abandoned by the parents, who go to sea; the chicks fast for a week and then jump into the sea at dusk or night, diving for their own food until they can fly at about 49 days old.

Average time to hatching: 42 days.

Average eggs per season: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg laying begins in late April in Maine, later in north. Some nest site holders do not breed. Clutch size is 1. Incubation, by both sexes, lasts about 6 weeks. Young are tended by both sexes, fledge at about 38-41 days (sometimes much longer). First breeds reportedly at 4-5 years or usually at 5+ years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in colonies, starting at around 5 years old. Nest is a burrow or other depression, excavated by both sexes. 1 egg, incubated by both parents for 36-45 days. Young fed by both parents, whole fish. Young fly from nest at night after 38-44 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Beak holds fish: puffin
 

The beak of a puffin can carry many fish at once because the bird uses its tongue to hold the fish against serrations on the upper mandible.

     
  "These puffins sport beaks that look as if they have been painted for a carnival…It is able to carry as many as 20 fish in its beak by holding them with its tongue against the serrated upper mandible." (Foy and Oxford Scientific Films 1982:150)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fratercula arctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACGAACCACAAAAACATCGGCACCCTATACTTAATCTTCGGCGCATGAGCCGGCATAGTTGGCACCGCCCTCAGCTTACTCATTCGCGCAGAATTAGGTCAACCAGGGACCCTCTTAGGAGAT---GACCAAATCTATAACGTAATCGTTACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGTGGCTTCGGAAACTGATTAGTTCCACTTATAATTGGTGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTTCTGCTCCTAGCCTCATCCACAGTGGAAGCTGGAGCTGGTACAGGGTGAACCGTTTATCCTCCTCTAGCCGGAAACCTAGCCCACGCCGGAGCTTCAGTAGACCTGGCAATTTTCTCCCTCCACTTAGCAGGTGTATCCTCTATCCTGGGTGCCATCAACTTTATTACAACAGCCATCAACATAAAACCCCCAGCCCTTTCACAATACCAAACCCCACTATTCGTATGATCAGTACTCATCACTGCTGTCTTACTACTACTCTCACTTCCAGTACTTGCCGCCGGCATTACTATACTCCTAACAGACCGAAACCTAAACACTACATTCTTCGACCCTGCCGGAGGTGGCGATCCCGTACTCTACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTATATATCCTAATTCTACCAGGCTTCGGGATTATCTCCCACGTCGTAACATACTATGCAGGAAAGAAAGAACCATTTGGTTACATAGGAATAGTATGAGCCATGCTATCTATTGGCTTCTTAGGATTCATTGTATGGGCACACCACATATTCACAGTAGGAATAGACGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fratercula arctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

---.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N1B - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant; large declines historically; populations now probably increasing overall, although local declines are occurring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Populations have declined due to over-harvesting in 19th century. Also, introduction of predators like rats to breeding islands has been detrimental. Major efforts over past couple decades to reintroduce breeding puffins to Maine islands have been successful. There is no official conservation status for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981. Included in the Birds of Conservation Concern Amber List (medium conservation concern) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to increase of 25%

Comments: Global trend unknown. North American population probably growing, although local trends vary (Lowther et al. 2002).

Global Long Term Trend: Increase of 10-25% to decline of 70%

Comments: Historically, populations drastically reduced through egging and hunting (Nettleship and Evans 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: In Greenland, egg-collecting (and less importantly hunting and deaths in salmon gill nets) may be significant threats. Many drown in surface-set and bottom-set gill nets in the fishery off Newfoundland; mortality acute during period when capelin form dense spawning schools inshore (Piatt and Nettleship 1985). Affected by hunting in Newfoundland and Gulf of St. Lawrence; breeding success has been reduced in some areas due to competition with fisheries for common food resource (e.g., capelin) and to increased predation and kleptoparasitism by large gulls (Brown and Nettleship 1984). On islands off Labrador, colonizing arctic foxes preyed heavily on puffins and reduced their breeding success (Birkhead and Nettleship 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Puffins are occasionally predated upon by great black-backed gulls and great skuas, as well as by rats and other mammalian ground predators (3). The greatest threats, however, are man-made; oil spills and over-fishing are both major potential threats to this endearing species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See Evans and Nettleship (1985) for management recommendations.

Has recolonized certain islands as result of reintroduction programs (e.g., began breeding on Eastern Egg Rock [Maine] after extensive transplants of young birds from Newfoundland, gull control, and use of models and vocalizations to attract puffins).

Management Research Needs: See Evans and Nettleship (1985) for research recommendations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Many of the major colonies of puffins are protected reserves (3). The RSPB and other concerned organisations have been lobbying for greater regulation of fishing in Europe, in order to prevent over-fishing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Each year, half a million common puffins are netted for food and their feathers in Iceland and the Faroe Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Eggs collected in Greenland (protective laws not observed) (Evans 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic Puffin

The Atlantic Puffin (Fratercula arctica) is a seabird species in the auk family. It is a pelagic bird that feeds primarily by diving for fish, but also eats other sea creatures, such as squid and crustaceans. Its most obvious characteristic during the breeding season is its brightly coloured bill. Also known as the Common Puffin, it is the only puffin species which is found in the Atlantic Ocean. The curious appearance of the bird, with its large colourful bill and its striking piebald plumage, has given rise to nicknames such as '"clown of the ocean" and "sea rooster". The Atlantic Puffin is the provincial bird for the Canadian province of Newfoundland and Labrador.

Contents

Description

The Atlantic Puffin is 26–29 centimetres (10–11 in) in length (bill 3–4 cm), with a 47–63 centimetres (19–25 in) wingspan.[2] The male is generally slightly larger than the female, but they are coloured alike. This bird is mainly black above and white below, with grey to white cheeks and red-orange legs. The bill is large and triangular and during the breeding season is bright orange with a patch of blue bordered by yellow at the rear.[3] The characteristic bright orange bill plates grow before the breeding season and are shed after breeding. The bills are used in courtship rituals, such as the pair tapping their bills together.[4] During flight, it appears to have grey round underwings and a white body; it has a direct flight low over the water. The related Horned Puffin (Fratercula corniculata) from the North Pacific looks very similar but has slightly different head ornaments.

The Atlantic Puffin is typically silent at sea, except for soft purring sounds it sometimes makes in flight. At the breeding colonies, its commonest call is a trisyllabic kaa-aar-aar, while the birds make a short growl when startled.[2]

Distribution and ecology

An adult returning with sand eels to feed the single chick

This species breeds on the coasts of northern Europe, the Faroe Islands, Iceland and eastern North America, from well within the Arctic Circle to northern France and Maine. The winter months are spent at sea far from land - in Europe as far south as the Mediterranean, and in North America to North Carolina.

About 95% of the Atlantic puffins in North America breed around Newfoundland's coastlines. The largest puffin colony in the western Atlantic (estimated at more than 260,000 pairs) can be found at the Witless Bay Ecological Reserve, south of St. John's, Newfoundland and Labrador.[5]

Puffin viewing has also started to become popular in Elliston Newfoundland, previously named Bird Island Cove, located near Trinity. Here, puffins have been known to be tame enough to get even 2 or 3 feet away from them.

Predators of the Atlantic Puffin include the Great Black-backed Gull (Larus marinus), the Great Skua (Stercorarius skua), and similar-sized species, which can catch a puffin in flight, or pick off one separated from the colony. Smaller gull species like the Herring Gull (L. argentatus) which are hardly able to bring down a healthy adult puffin, take eggs or recently hatched chicks, and will also steal fish.

Diet

Feeding areas are often located 100 km (60 mi) or more, offshore from the nest sites  — although when provisioning young the birds venture out only half that distance.[6] Atlantic Puffins can dive to depths of up to 70 m (200 ft) and are propelled through the water by their powerful wings, which are adapted for swimming; the webbed feet are used as a rudder while submerged. When hunting, Puffins may collect several small fish, such as herring, sprats and sand eels, zooplankton, crustaceans and mollusks. The tongue is used to hold the fish against spines in the palate, leaving the bill free to open to catch more fish. The fish, which may number up to twelve, are held in the bill with the heads facing in alternate directions.

Reproduction

Adults on nesting grounds (note burrows). Lunga (Treshnish Isles, Scotland)
Atlantic Puffin defending its burrow from a pair of Razorbills, Lundy

The Atlantic Puffin is sexually mature at the age of 4–5 years; the species is monogamous (they mate for life) and gives biparental care. They are colonial nesters, excavating burrows on grassy cliffs – they will also nest amongst rocks and scree. The species can face competition from other burrow nesting animals such as Rabbits, Manx Shearwaters and occasionally Razorbills. Male puffins perform most of the work of excavating or clearing out the nest area, which is sometimes lined with plants, feathers or seaweed. The only time spent on land is to nest; mates are found prior to arriving at the colonies, and mating takes place at sea. The breeding season for Atlantic puffins is normally in the summer, with eggs laid in June and July.[7]

Appearance of beak and eyes during the breeding season (left) and after the molt (right; lettered items have dropped off).

A single-egg clutch is produced each year, and incubation responsibilities are shared between both parents. Total incubation time is around 39–45 days, and the chick takes about 49 days to fledge. At fledging, the chick leaves the burrow unaccompanied, usually during the evening, and flies or swims out to sea. Contrary to popular belief, young puffins are not abandoned by their parents (although this does occur in some other seabirds, such as shearwaters). Synchronous laying of eggs is found in Atlantic Puffins in adjacent burrows.[8]

The eyes and beak of the male have a special appearance, acquired in the spring, during the breeding season. At the close of the breeding season, these special coatings and appendages drop off in a molt.[9]

Relationship with humans

Puffin hunters, Faroe Islands, 1898 or 1899
On remote Stóra Dímun, puffins are still important food today.

Hunting

The population of these birds was greatly reduced in the nineteenth century, when they were hunted for meat and eggs. Atlantic Puffins are still hunted and eaten, but the effect of this on populations is insignificant compared to other threats. On the Faroe Islands, for example, the birds may be hunted for local consumption after the breeding season, when excess birds are available. The inhabitants of the Blasket Islands off the south-west coast of Ireland ( abandoned in 1953) ate large numbers of puffins.

Status and conservation

More recent population declines may have been due to increased predation by gulls and skuas, the introduction of rats, cats, dogs and foxes onto some islands used for nesting, contamination by toxic residues, drowning in fishing nets, declining food supplies, and climate change.[10]

On the island of Lundy the number has decreased dramatically in recent years (the 2005 breeding population was estimated to be only two or three pairs) as a consequence of depredations by black rats (recently eliminated) and possibly also as a result of commercial fishing for sand eels, the puffins' principal prey.

On the other hand, puffin numbers increased considerably in the late twentieth century in the North Sea, including on the Isle of May and the Farne Islands. Numbers have been increasing by about 10% per year in recent years. In the 2006 breeding season, about 68,000 pairs were counted on the Isle of May. However, Iceland has many times as many breeding pairs with the puffin being the most populous bird on the island, estimated at about 5 million pairs.[11] . In 2008 declines were reported in the Farne Islands and Isle of May colonies.[12]

Reintroduction projects have taken place on a number of islands, including one on the coast of Maine titled Project Puffin, and these have given local boosts to some Puffin populations.

Since the Atlantic Puffin spends its winters on the open ocean, it is susceptible to human impacts such as oil spills. If an accidental oil spill occurs and pelagic birds are exposed, toxins are inhaled or ingested which leads to kidney and liver damage. This damage can contribute to a loss of reproductive success and damage to developing embryos.[8] Oil spills may also have indirect effects. The Atlantic Puffin and other pelagic birds are excellent bioindicators of the environment because they are near the top of the food chain in the ocean. Since the primary food source for Atlantic Puffins is fish, there is a great potential to bioaccumulate heavy metals from the environment. Heavy metals enter the environment through oil spills – such as the Prestige oil spill on the Galician coast – or from other natural or anthropogenic sources. In order to determine the effects on pelagic birds such as the Atlantic Puffin, quantifiable measurements must be taken. In the field, scientists obtain contaminant measurements from eggs, feathers or internal organs.[13]

Flying over the Isle of May, Scotland

Since the Atlantic Puffin gets the majority of its food by diving, it is important that there is an ample supply of resources and food. Different environmental conditions such as tidal cycle, upwellings and downwellings contribute to this abundance. In a study published in 2005[14] it was observed that Atlantic Puffins were associated with areas of well-mixed water below the surface. This study implies consequences for the species if global warming leads to an alteration of tidal cycles. If these cycles are modified too much it is probable that the Atlantic Puffin will have a difficult time locating food resources. Another consequence of an increase in temperature could be a reduction in the range of the Atlantic Puffin, as it is only able to live in cool conditions and does not fare overly well if it has to nest in barren, rocky places, and an increase in temperature could thus squeeze the zone of puffin-suitable habitat as warmer biotopes expand from the equator but the polar regions remain barren due to lack of historical accumulation of topsoil.

SOS Puffin is a conservation project based from the Scottish Seabird Centre at North Berwick to save the puffins on islands in the Firth of Forth. Puffin numbers on the island of Craigleith, once one of the largest colonies in Scotland, with 28,000 pairs, have crashed to just a few thousand due to the invasion of a large alien plant Tree Mallow, Lavatera arborea, which has taken over the island and prevented the puffins from accessing their burrows and breeding. The project has the support of over 450 volunteers and progress is being made with puffins returning in numbers to breed this year.[15]

Faroe Islands 1978 postal stamp FR 31 by Holger Philipsen

In culture

The name puffin – puffed in the sense of swollen – was originally applied to the fatty salted meat of young birds of the unrelated species Manx Shearwater, Puffinus puffinus.[16] Both species nest in burrows on off-shore islands and the name was applied to the meat of either and was formally applied to F. arctica by Pennant in 1768.[16]

The scientific name comes from the Medieval Latin fratercula, friar, and arctica, northern.[17]

The Atlantic Puffin is the provincial bird of Newfoundland and Labrador.[18] The Norwegian municipality of Værøy has an Atlantic Puffin in its coat-of-arms. In August 2007, the Atlantic Puffin was proposed as the official symbol of the Liberal Party of Canada by its deputy leader Michael Ignatieff, after he observed a colony of these birds and became fascinated by their behaviour.[19]

The island of Lundy's name is derived from the Norse lunde for the puffins that nest on the island. Puffins also appeared on the coins and stamps of the island and a value expressed in 'Puffins'.

See also

Gallery

Footnotes

  1. ^ BirdLife International (2012). "Fratercula arctica". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b The Birds of the Western Palearctic [Abridged]. OUP. 1997. ISBN 0-19-854099-X. 
  3. ^ Street & Emily (1999)
  4. ^ Project Puffin: Puffin videos. Retrieved 2008-JAN-13.
  5. ^ Government of Newfoundland and Labrador: Witless Bay Ecological Reserve. Retrieved 2008-JAN-13.
  6. ^ Lilliendahl et al. (2003)
  7. ^ "Atlantic Puffin - Fratercula arctica" on About.com
  8. ^ a b Ehrlich et al. (1988)
  9. ^ Wikisource-logo.svg "Puffin". New International Encyclopedia. 1905. 
  10. ^ Mitchell et al. (2004)
  11. ^ 22 July 2012
  12. ^ BBC News "Unexpected fall in puffin numbers", 25 July 2008
  13. ^ Perez-Lopez et al. (2006)
  14. ^ Ladd et al. (2005)
  15. ^ SOS Puffin project at the Scottish Seabird Centre, Scotland, UK
  16. ^ a b Lockwood, W B (1993). The Oxford Dictionary of British Bird Names. OUP. ISBN 978-0-19-866196-2. 
  17. ^ Jobling, James A (1991). A Dictionary of Scientific Bird Names. OUP. ISBN 0-19-854634-3. 
  18. ^ Churchill et al. (1998)
  19. ^ Excrement-hiding bird championed as Liberal symbol. Canadian Press, 2007-AUG-30. Retrieved 2008-JAN-13.

References

  • Alsop, Fred J. III (2001): Atlantic Puffin. In: Smithsonian Birds of North America, Western Region: 451[verification needed]. DK Publishing, Inc., New York City. ISBN 0-7894-7157-4
  • Churchill, Wendy; Dalziel, Alex & Rice, Vanessa (1998): Newfoundland and Labrador Provincial Emblems. Version of August 1998. Retrieved 2008-JAN-13.
  • Ehrlich, P.; Dobkin, D. & Wheye, D. (1988): Atlantic Puffin. In: The Birder's Handbook: A Field Guide to The Natural History of North American Birds: 207, 209–214. New York.
  • Harrison, Peter (1988): Seabirds (2nd ed.). Christopher Helm, London. ISBN 0-7470-1410-8
  • Ladd, C.; Jahncke, J.; Hunt, G. L.; Coyle, K. O. & Stabeno, P. J. (2005): Hydrographic features and seabird foraging in Aleutian Passes. Fisheries Oceanography 14(s1): 178–190. doi:10.1111/j.1365-2419.2005.00374.x (HTML abstract)
  • Lilliendahl, K.; Solmundsson, J.; Gudmundsson, G. A. & Taylor, L. (2003): Can surveillance radar be used to monitor the foraging distribution of colonially breeding alcids? [English with Spanish abstract] Condor 105(1): 145–150. doi:10.1650/0010-5422(2003)105[145:CSRBUT]2.0.CO;2 HTML abstract
  • Mitchell, P. I.; Newton, S. F.; Ratcliffe, N.; Dunn, T. E. (2004): Seabird Populations of Britain and Ireland: Results of the Seabird 2000 Census (1998–2002). T. & A.D. Poyser, London. ISBN 0-7136-6901-2
  • Perez-Lopez, M.; Cid, F.; Oropesa, A.; Fidalgo, L.; Beceiro, A. & Soler, F. (2006): Heavy metal and arsenic content in seabirds affected by the Prestige oil spill on the Galician coast (NW Spain). Science of The Total Environment 359(1-3): 209–220. doi:10.1016/j.scitotenv.2005.04.006 (HTML abstract)
  • Street, R. & Emily, A. (1999): Animal Diversity Web - Fratercula arctica. Retrieved 2007-09-04.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with F. CORNICULATA (AOU 1983). Morphologic and genetic data (Moen 1991) cast doubt on the validity of the three subspecies, which were described solely on the basis of body size.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!