Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from the eastern Canadian Arctic and western Greenland south to the Gulf of Maine, east to the northern British Isles, Scandanavia, and Baltic Sea, and east along northern Russia to the Chukchi and Beaufort seas, including Alaska (Butler and Buckley 2002). In winter, most tend to stay near breeding areas (if open water is available).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; range extends throughout the Canadian Atlantic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-arctic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Black Guillemot can be found throughout Arctic waters on the northern coasts of Russia, Alaska (USA), Canada and Norway, in the Atlantic Ocean off Greenland (to Denmark), eastern Canada as far south as the United Kingdom including the North and Baltic Sea (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The Black guillemot is a circumpolar species distributed in boreal, low arctic and high arctic regions of the North Atlantic and Arctic oceans. Black guillemots can be found in coastal areas from the Gulf of Maine, New England across parts of the northern coast of North America, as far as Alaska. In Europe and Asia they are found from the British Isles and northward across the northern coast of Asia. The largest concentrations can be found among islands of the high and low arctic. Wintering populations disperse as far south as Rhode Island in North America and France in the eastern Atlantic (Johnsgard 1987; Nettleship and Evans 1985; Nettleship 1996).

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar. South to New Jersey and to northern France.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

A relatively small seabird, Black guillemots are approximately 32cm in length. In breeding plumage, as their name implies, Black guillemots are black from bill to tail. They also have large white wing patches, and bright red feet, legs and inside the mouth. As many as seven sub-species have been described based on variations in size, bill and wing length, and plumage. After an early fall moult adults take on a patchy black and white plumage that has been described as "salt and pepper" and legs become a paler red. This winter plumage retains the white wing patch on the black wing, however the body plumage becomes white below and barred black and white above with a black bill and mostly white head. Newly fledged birds are similar to wintering adults and yearlings have an adult-like plumage with brownish spots in the white wing patch (Bedard 1985; Gaston 1985; Johnsgard 1987; Nettleship 1996; Stokes and Stokes 1996).

Range mass: 325 to 550 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 33 cm

Weight: 428 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 30-36 cm, Wingspan: 58 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Black guillemots nest in holes under rocks (rarely in ground) on rocky islands, among boulders at base of coastal cliffs, in or under beach flotsam and other human debris (e.g., in northern Alaska), or in coastal cliff crevices. Females tend to nest in the same site in successive years. In winter, they inhabit rocky seacoasts, open sea, or margins of landfast ice, seldom far from shore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Black Guillemots are pursuit divers that propel themselves through the water using their wings. Diet The species is probably primarily a benthic forager, since much of the prey consists of benthic fish and invertebrates, including crustaceans (Bradstreet and Brown 1985, Cairns 1987a, BirdLife International 2000). Various studies find sandeels (Ammodytes spp.) (Harris and Riddiford 1989, Ewins 1990) and blennies (particularly butterfish Pholis gunnellus) (Harris and Riddiford 1989, Ewins 1990, BirdLife International 2000) to be the most important prey species of fish, although the relative contributions of each of these to the overall diet differs. Flatfish (Harris and Riddiford 1989) and gadoids (Ewins 1990) are also sometimes important. Amongst invertebrates, sea-scorpions are noted as an important prey item (Harris and Riddiford 1989). Adults tend to consume a higher proportion of invertebrates than chicks (Ewins 1990). The general trend is for increasing importance of invertebrates with latitude (presumably reflecting overall availability) in the summer diet of both adults and chicks. The few data on winter food suggest that invertebrates are of greater importance during the winter than during the summer (Ewins 1990). Breeding site Both early spring and breeding distributions appear to be influenced by the Hell Gate and Cardigan Strait polynya located in western Jones Sound, Canada, between Ellesmere and Devon islands. The evidence presented suggests that annual variation in the distribution of ice edges in Jones Sound may influence the distribution of breeding birds among suitable breeding habitat. The observed distribution of Guillemots in March, April, and May is coincident with the location of open water and the associated ice edges. Thereafter, as the ice margin recedes and shoreleads open, the distribution of Guillemots tends to reflect the location of breeding colonies (Prach and Smith 1992). Foraging range Birds feeding in the eastern Canadian Arctic fed principally in waters 10-130 m deep (Cairns 1987a). Birds have been caught in nets up to 50 m deep, but have a theoretical maximum dive of 130 m. They have been observed actively feeding in water 35-45 m deep (Uspenski 1956). However, in Kattegatt, Denmark, approximately 80% of all Black Guillemots were recorded in water with depths of 10-30 m (Durinck et al. 1994). Black Guillemots were always recorded less than 5 km from the coast of Caithness, Scotland during May-July (BirdLife International 2000). At the Bay of Fundy, Canada, almost all birds remained within 300 m of the shore (Ronconi and St. Clair 2002). At Papa Westray, Scotland, the mean foraging distance was 2.4 km away from the colony, and birds were recorded foraging in areas up to 3.9 km away from the colony, but despite this large variation in foraging range, feeding sites were never located further than 1.5 km from the shore (BirdLife International 2000). At Rockabill, Ireland, birds forage within 1 km of the colony or else fly 7km or more to reach the mainland coast (BirdLife International 2000). In the eastern Canadian Arctic, censuses indicated that most birds were feeding within 13 km of breeding colonies, with a few found as far as 15 km (BirdLife International 2000). Sightings were frequently highest within 5 km of the colony (BirdLife International 2000). Several studies (at the Bay of Fundy, Finland, Denmark and Iceland) found that Black Guillemots foraged between 0.5 and 4 km from nest sites, and occasionally beyond 7 km away (BirdLife International 2000). By contrast, in the NW Territories, Canada, breeding adults rarely foraged close to the colony, and some birds may have been travelling as far as 55 km (BirdLife International 2000). Birds probably capture some prey in the water column, but forage principally on benthic prey (Cairns 1987a). In Shetland, birds tend to forage where the sea bed is rocky and vegetated with dense stands of kelp (Laminaria spp.) (Ewins 1990) which reflects the habitat preferences of their main prey (BirdLife International 2000).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Generally Black guillemots are restricted to rocky shores due to their nesting requirements. They nest most often in crevices among stones and boulders at the base of cliffs or cracks in cliffs, and less often under rocks among vegetation and under driftwood. In the high arctic some cliff sites may be as high as 230m. Artificial cover (debris on shore, harbor walls, under buildings) has allowed guillemots to nest in areas where they may not have previously.

Foraging habitat varies dramatically with the seasons. During the breeding season birds forage in inshore waters generally less than 50m in depth. Although they remain fairly close to shore year round, in winter months black guillemots are more pelagic, frequently feeding along pack ice edges where pack ice occurs. Some overwinter in polynyas of the high north (Brown 1985; Cairns 1992; Harris and Birkhead 1985; Johnsgard 1987; Nettleship 1996; Winn 1950).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3171 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1174 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 12.348
  Nitrate (umol/L): 0.703 - 10.275
  Salinity (PPS): 6.218 - 35.391
  Oxygen (ml/l): 6.076 - 9.084
  Phosphate (umol/l): 0.231 - 1.130
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -1.109 - 12.348

Nitrate (umol/L): 0.703 - 10.275

Salinity (PPS): 6.218 - 35.391

Oxygen (ml/l): 6.076 - 9.084

Phosphate (umol/l): 0.231 - 1.130

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanic; usually inshore, but also offshore. Rocky coastlines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Young move away from breeding site in direction of prevailing current; see Brown (1985) for details for western Atlantic and elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some move to southern part of range, but most remain north at edges of pack ice in open water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats small fishes and invertebrates found on or near bottom in shallow water or in deeper water near pack ice. Chicks are fed mainly fishes (and invertebrates in high arctic. Forages close to colony (usually 4 km or less).

Black guillemots feed by diving underwater in relatively shallow water (usually less than 50 meters deep). Dives last up to 2.5 minutes but usually are closer to 1 minute in duration, depending on water depth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Like other members of the Alcidae family, C. grylle are adapted to wing-propelled swimming allowing them to dive deeply where they feed mainly on fish on or near the seafloor. Prey items include sandlance (Ammodytidae), gunnels (Pholidae), sculpins (Cottidae), pricklebacks (Stichaeidae), Arctic cod (Boreogadus saida) and many other fish as well as many invertebrates: polychaetes, molluscs, jellyfish, crustaceans, sponges, crabs, and even barnacles. They are known to dive for nearly 2 minutes and up to estimated depths of 50m. Many patterns of foraging behavior have been found. There is typically a morning, and sometimes evening, peak in foraging activity, but in some areas feeding may be continuous throughout daylight hours. Foraging distribution has been shown to change with tidal cycles where birds prefer waters of moderate flow. Seasonal cycles also exist with guillemots feeding inshore during the breeding season and farther offshore or around pack ice edges during the winter (Bradstreet and Brown 1985; Cairns 1986; Cairns 1992; Johnsgard 1987; Nettleship 1996; Nol and Gaskin 1987; Winn 1950).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish and crustaceans mainly. Also mollusks, marine worms, some plant material.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Many occurrences throughout northern waters, primarily in the eastern Arctic and north Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Global breeding population estimated to be 500,000 to 1,000,000 (Gaston and Jones 1998). Accurate census extremely difficult (Butler and Buckley 2002). Censuses in 1970s and early 1980s yielded estimate of about 5000 pairs in New England, about 70,000 in eastern Canada (Nettleship and Evans 1985). A few hundred in Alaska (Lensink 1984). See Evans (1984) for population data from Greenland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Despite larger clutch size, breeding success (about 0.6-0.8 young fledged per pair) is similar to that one other alcids that lay only 1 egg (Harris and Birkhead 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
157 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.9 years (wild) Observations: Maximum longevity from banding studies is 25.9 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs are laid mainly in May-June in southeastern Canada, late June-early July in Beaufort Sea area (Johnson and Herter 1989). Clutch size is 1-2. Incubation, by both sexes, lasts 23-39 days (average 4-4.5 weeks). Young are tended by both parents; most leave the nest area and are independent by 31-51 days. Individuals first breed at an age of 2+ years. Nesting usually occurs in small groups or as single pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black guillemots breed in relatively small scattered colonies and lay 2 eggs. The typical reproductive cycle is as follows. Some adults over-winter near breeding colonies while the others return between late February and early May. Birds have been seen searching for suitable nest sites (see habitat section for nesting requirements) immediately after copulation and eggs are usually laid between late May and mid June. Guillemots have a double brood patch; two eggs are the standard clutch size but sometimes one and more rarely three are laid. More experienced parents often lay slightly earlier and have a larger mean clutch size. Once the last egg is laid incubation is continuous with both parents sharing shifts for 28 to 32 days. Colony attendance is highest in the early morning. Down-covered semi-precocial chicks take 3 to 4 days to fully hatch then are left unattended in the nest. As the chicks get older they wander inside the nest crevice. Both sexes feed the demanding chicks up to 20 fish a day until they fledge at age 30 to 40 days. Sometimes parents must entice young from the nest with fish, but once fledged, chicks are on their own. The average breeding success ranges from 0.48 to 1.6 young per pair with losses due to predation, bad weather, and flooding from high tides. By age three or four, young birds start to breed and join this cycle (Harris and Birkhead 1985; Hilden 1994; Johnsgard 1987; Nettleship 1996; Winn 1950).

Average time to hatching: 25 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 4 years old. May nest in colonies or as isolated pairs, with nest sheltered by large rocks or other debris. 1-2 eggs, incubated by both partners for 23-39 days. Young fed whole fish by both parents. Young leave nest independently but before capable of flight.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cepphus grylle

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATATTTAATCTTCGGTGCATGAGCCGGTATAGTCGGCACTGCCCTAAGCTTACTCATCCGTGCAGAACTAGGTCAACCAGGAACTCTTCTAGGAGACGACCAAATTTACAACGTAATTGTCACAGCCCACGCCTTCGTAATAATTTTCTTCATAGTAATGCCAATCATAATTGGAGGCTTCGGAAACTGATTAGTCCCACTTATAATCGGTGCCCCCGATATAGCATTCCCTCGCATGAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTACTCCTCCTAGCTTCTTCTACAGTAGAAGCTGGAGCTGGTACAGGATGAACTGTATACCCTCCCCTAGCCGGTAACCTAGCACACGCCGGAGCTTCAGTAGATCTTGCAATCTTCTCCCTCCACTTAGCAGGTGTATCTTCCATTCTGGGTGCTATCAACTTTATCACAACAGCCATCAACATAAAACCTCCAGCCCTCTCACAATACCAAACCCCACTATTTGTATGATCAGTACTTATTACCGCTGTCTTATTATTACTCTCCCTCCCAGTACTCGCTGCTGGTATTACTATACTACTAACAGACCGAAACCTAAATACAACATTCTTTGACCCAGCCGGAGGTGGTGATCCAGTACTATATCAACACCTCTTCTGATTCTTTGGACATCCAGAAGTATACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cepphus grylle

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread; most regions report stable or increasing populations, following earlier declines.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black guillemots have no threatened status and are quite abundant, especially in some regions of the high arctic. Total population of the North Atlantic and Arctic oceans was estimated in 1985 at 270,000 pairs (200,000-350,000). In some areas population declines have been observed. In the past local reductions may have resulted from hunting or egging. Currently some populations seem to be increasing and expanding their distributions. Locally introduced predators, oil spills, and commercial gill-net fishing may impact guillemots, however there are no serious threats globally. High rates of nest visits by scientists have also been shown to decrease nesting success (Brown and Nettleship 1984; Cairns 1980; Johnsgard 1987; Nettleship and Evans 1985; Nettleship 1996).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Increased in the Gulf of St. Lawrence region in the 1980s (Chapdelaine and Brousseau 1992). Stable or increasing in southern part of northwestern Europe; predation by introduced mink has caused some local declines in northwestern Europe (Evans 1984). Apparently has become more abundant in Beaufort Sea area in recent decades because of ability to nest in made-made beach debris (Johnson and Herter 1989); however, this trend has recently reversed, possibly the result of global warming (Butler and Buckley 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.400,000-700,000 individuals (del Hoyo et al. 1996), while the population in Russia has been estimated at < c.100 breeding pairs and < c.50 individuals on migration (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Evans and Nettleship (1985) for research and management recommendations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Hunted in Greenland (Evans 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

During the 1800's and first half of the 20th century Black guillemots were taken for food; adults were hunted, young collected and eggs taken from nests. These activities were known to occur in parts of eastern Canada (mainly Labrador and the Gulf of St. Lawrence), Iceland, Faeroe Islands, British Isles, areas of the White Sea, and many Scandinavian countries. Many laws prevent such activities now (Nettleship and Evans 1985).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black guillemot

The black guillemot or tystie (Cepphus grylle) is a medium-sized alcid.

Adult birds have black bodies with a white wing patch, a thin dark bill, and red legs and feet. They show white wing linings in flight. In winter, the upperparts are pale grey and the underparts are white. The wings remain black with the large white patch on the inner wing. They are 32–38 cm in length, and with a 49–58 cm wingspan.

Flying in Scotland

Their breeding habitat is rocky shores, cliffs and islands on northern Atlantic coasts in eastern North America as far south as Maine, and in western Europe as far south as Ireland.They are one of the few birds to breed on Surtsey, Iceland a new volcanic island. In the UK it is a fairly common breeding bird in western and northern Scotland and Northern Ireland. In the rest of Great Britain they only breed at St. Bees Head in Cumbria, the Isle of Man and on east Anglesey in north Wales. Some birds breed in Alaska where their range overlaps with the pigeon guillemot. They usually lay their eggs in rocky sites near water.

These birds often overwinter in their breeding areas, moving to open waters if necessary, but usually not migrating very far south.

They dive for food from the surface, swimming underwater. They mainly eat fish and crustaceans, also some mollusks, insects and plant material.

The call in the breeding season is a high whistle. The red gape is also prominent then.

Showing red gape
Winter plumage off the coast of Maine

References[edit]

Further reading[edit]

Leonard, K. 2008. Black Guillemots on the Copeland Islands in 2008. Annual Report for 2008. Copeland Bird Observatory. p. 50.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with C. COLUMBA and possibly C. CARBO of Asia (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!