Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Guillemots are true seabirds. They only come on land to breed. They look for food from the water by sticking their head underwater and search for a tasty fish, such as sprat and lesser sandeel. Guillemots are excellent divers, easily swimming down to 180 meters. Under water, they swim just like penguins, using their wings. That is why their feathers and wings are very short and strong.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Guillemots gather in breeding colonies for the summer. Between May and July, females lay a single egg directly onto cliff ledges; its conical shape prevents it from rolling off (3). At around 3 weeks of age, the young guillemot leaves the colony before it has fledged, and dramatically plunges into the sea accompanied by the adult male (6), who will care for the young at sea until it becomes independent a couple of months later (2), (5). Shortly after leaving the breeding colonies between June and August, adult guillemots undergo the main annual moult, and become flightless for around 6 to 7 weeks (5). During the winter guillemots disperse fairly widely, with young birds covering the greatest distances (5). Throughout the year, the diet consists mainly of various small species of fish, as well as crustaceans, marine worms and molluscs. Sand eels are particularly important during summer (2). Guillemots dive to obtain food (2), 'flying' under water with their wings (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The guillemot is the commonest member of the auk family in the British Isles (3). The head as well as the upperparts are dark brown in colour; the underparts are white. In winter a variable part of the head also becomes white (3). A 'bridled' form occurs in which the eye is bordered with white, and a white line extends backwards from the eye towards the neck (3). The bill is thin, uniformly dark and pointed, and the tail is short, so that in flight the legs are clearly visible; these features allow the guillemot to be distinguished from the razorbill (Alca torda), which also has darker upperparts (3). Young guillemots in their first summer are generally similar in appearance to adults, but have a white area on the throat (3). In breeding colonies, this species is particularly vocal, producing a variety of calls including a deep 'mmmmm' (3), which has given rise to an alternative common name for this species, the 'murre' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America; Labrador to Virginia
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Common Guillemot has a circumpolar distribution, occuring in the low-arctic and boreal waters of the north Atlantic and north Pacific (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

During breeding, the common murre populations of the Pacific Ocean range from coastal areas of western Alaska to central California. The Atlantic Ocean populations range from Labrador to Nova Scotia. They spend the winters close to the breeding areas but their range extends to southern California in the Pacific populations and to Maine in the Atlantic populations.

(del Hoyo, et al. 1996, Ehrlich 1988)

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: along coasts of North Pacific from Bering Strait south to northern Japan, eastern Korea, and central California; and North Atlantic from western Greenland, Iceland, Bear Island, and Novaya Zemlya south to Newfoundland and northern France. NON-BREEDING: at sea mainly in boreal waters (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern Atlantic and Pacific oceans. South to Japan and Korea in Pacific, south to Mediterranean in Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in the Atlantic and Pacific Oceans (1), breeding on the coasts of the north Pacific and north Atlantic (2). In Britain it breeds in internationally significant numbers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

At first glance, the common murre appears penguin-like, as the breeding adults are dark brown-black on the head, neck and back with a white underbelly and white tipped secondary feathers. They are about 38-43cm in length and stand upright like a penguin when on land. They have dark, long, and slender bills and dark greyish-black feet and legs. They have a wingspan of 64-71 cm. The adult winter plumage is mostly identical except for white on the cheeks and throat and a dark spur extending back from the eye. An alternate form, or the bridled morph, only occurs in a population in the North Atlantic. It has an eye ring with a line extending toward the back of its head in addition to the regular adult plumage. Chicks are downy when first hatched. They are blackish brown on top and white underneath. When they are first hatched they weigh 55-95 grams. Juveniles are similar to adults except for their smaller size and darker heads.

(Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Range mass: 945 to 1044 g.

Average basal metabolic rate: 6.8224 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 45 cm

Weight: 1006 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 40-43 cm, Wingspan: 71 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The Common Guillemot is a pursuit-diving marine bird which forages primarily during daylight. One parent remains at the colony with the chick whilst the other is on a foraging trip. Birds departing colonies usually splash-down to form large rafts close to the colony before departing to foraging areas. External radio tagging has been shown to adversely effect breeding (Wanless et al. 1988, Nevins 2004), whereas birds fitted with internal transmitters behaved as normal (Wanless et al. 1988). Diet During the breeding season, schooling pelagic fish species are the most important prey for adults, though benthic species can also be important.In Labrador, Canada, Shannies (Sticheaidae) were the main source of food, comprising 84% of the diet in 1996 and 52.9% in 1997 (Bryant and Jones 1999). Capelin (Mallotus villosus) were also important, forming 44.7% of the diet in 1997 (Bryant and Jones 1999). In the UK, the main prey taxa are sandeel (Ammodytes spp.) and clupeids. Small gadoids are also important at some colonies. Foraging range This species dives to maximum depths of 170-230m. During the breeding season, surveys recorded the highest densities of birds in the 51 - 100 m depth zone, although birds were still abundant in water less than 50 m and 101 - 200 m deep. Very few were seen in deeper areas (Wanless et al. 1990). The foraging range of this species appears variable across seasons and years. At the Isle of May, Scotland, during 1986 around 70% of foraging trips were over 7 km from the colony, whereas in the following year the birds tended to make shorter trips (Wanless et al. 1990). Foraging trips in eastern Canada are within 100 km (Cairns et al. 1987, Davoren et al. 2003), and in Pribilof Islands, Alaska, foraging occurred mostly within 60 km. In Witless Bay, Newfoundland, foraging aggregations formed over large Capelin schools within 5 km of breeding sites. Along the Newfoundland coastline, aggregations occurred within 15 km of the colonies, and at an offshore ridge about 80 km southeast of the colonies. Despite these large foraging radii, waters close to the colony were the most frequent destination of feeding birds. This was particularly true during chick rearing, when only one third of feeding trips could have exceeded 10 km from the colony (Cairns et al. 1987). In Pribilof Islands, Alaska, birds showed a consistent preference for shallower waters (Schneider and Hunt 1984). High densities of foraging birds have also been observed foraging over a submarine ridge (Coyle et al. 1992). In Kachemak Bay, Alaska, it appears that birds tend to feed over rocky substrates in water depths of about 18 to 55 m (Sanger G.A. 1987). They have also been observed to forage in riptides (Wanless et al. 1990), and in areas of sandy sediment suitable for sandeels (Wanless et al. 1998, BirdLife International 2000). Near Flamborough Head, UK, the Farallones, California, and Pribilof Islands, Alaska, birds forage at fronts between thermally distinct bodies of water. In the UK example, this occurs at a seasonally-occuring front between thermally-mixed and thermally-stratified water, whereas in the Farallones, the front was between cold and salty upwellings and estuarine outflow (Decker and Hunt 1996, BirdLife International 2000).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The common murre is primarily a pelagic species. It spends the majority of its time at sea except for during breeding season. The breeding season is spent on costal cliffs or offshore islands that are primarily rocky. (Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 225239 specimens in 1 taxon.
Water temperature and chemistry ranges based on 96909 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.467 - 17.280
  Nitrate (umol/L): 0.224 - 16.868
  Salinity (PPS): 5.715 - 35.972
  Oxygen (ml/l): 5.581 - 8.419
  Phosphate (umol/l): 0.138 - 0.890
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -0.467 - 17.280

Nitrate (umol/L): 0.224 - 16.868

Salinity (PPS): 5.715 - 35.972

Oxygen (ml/l): 5.581 - 8.419

Phosphate (umol/l): 0.138 - 0.890

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: pelagic and along rocky seacoasts (AOU 1983). Nests in the open or in crevices on broad and narrow cliff ledges, on stack (cliff) tops, and on flat, rocky, low-lying islands; less commonly nests under boulders or in caves; usually nests in same exact site in successive years (Harris and Birkhead 1985). Cliff-top nests in Washington had lower reproductive success than did crevice nests in vertical cliffs (Parrish 1995, Auk 112:390-401).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Open ocean, bays, and sea cliffs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits both coastal and offshore waters, and nests on coastal cliffs and rock stacks (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeders from Newfoundland are resident or move only short distance to south. Males from Chukchi Sea colonies in Alaska drift toward Siberia with flightless young for a few weeks before flying rapidly south to the southeastern Bering Sea. Females from these colonies fly directly to the wintering grounds (Hatch et al. 2000). Unimak Pass probably most important corridor to and from eastern Bering Sea. See Brown (1985) for discussion of movements in Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Moves south of freezing waters, but is permanent resident in many locations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The common murre is mainly piscivorous. They are surface divers that can remain submerged for up to one minute at a time. They often dive to a depth of 100 feet but have been recorded to reach a depth of 550 feet. They use their strong wings to fly underwater. Adults consume between 20g and 32g of food everyday. They mostly catch small fish up to 7 inches in length, which they carry in their bills lengthwise with the tail hanging out. Most of the fish species consumed include polar cod, capelin (Mallotus), launces, sprat (Sprattus), sandeels (Ammodytes), small Atlantic cod and herring (Clupeus). They also eat a variety of marine worms, amphipods, shrimp, molluscs, and Arctic squids.

(Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Mysids and shrimp dominate winter diet in Alaska, mostly fish and some squid off California, mostly capelin off Newfoundland (Sanger 1987). Young fed herring, capelin, sprat, sandlance (Bradstreet and Brown 1985). Dives from surface to at least 180 m (Piatt and Nettleship 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds mostly on fish, but will also eat marine worms, crustaceans, and squids.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Estimated global population 13.0-20.7 million breeding individuals (Ainley et al. 2002): eastern Asia, 3.0-3.3 million (Kondratyev et al. 2000); western North America, 4.0-8.4 million; eastern North America, 1.2 million (Ainley et al. 2002); Greenland and Europe, 4.8-7.8 million (Nettleship and Evans 1985). Population estimates for individual colonies in western North America are presented in USFWS (2001) and Carter et al. (2001), and summarized in Ainley et al. (2002); those for eastern North America are presented in Ainley et al. (2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Newfoundland, median potential foraging range (from breeding colony) was 37.8 km for incubating birds, 5.4 km for chick-rearing birds (Cairns et al. 1987). However, in northwestern Alaska, telemetry data from incubating or chick-rearing birds indicated that they regularly foraged up to 100 km from their colonies (Hatch et al. 2000). Annual adult survivorship greater than 85%. Up to 3900/sq km reported in winter on Grand Banks off Newfoundland. In California, Western Gull sometimes is an important predator on eggs and chicks (Spear 1993). High density breeding may reduce vulnerability to predators (J. Anim. Ecol. 60:721).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
317 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38 years (wild) Observations: In the wild, these animals have been known to live up to 38 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The first breeding season takes place at the age of 4-6 years. The common murre does not use nesting material, as the one egg is laid on the bare rock or soil of a steep cliff or ledge facing the sea. The egg is pyriform or pear-shaped which prevents it from rolling off of the ledge. This is because the egg pivots around the pointed tip when it is disturbed. The shape also maximizes the amount of surface area that will be in contact with the parent's brood patch during incubation. Eggs are laid between May and July in populations breeding on the Atlantic coast and between March and July on the Pacific coast. The eggs vary in colour from pure white to shades of green, blue, or brown with spots or speckles of brown, lilac, or black. These various colour forms are important for egg recognition by parents. Both parents participate in the incubation process, which takes between 28 and 34 days and is divided into 12-24 hour shifts. Chicks of the common murre are semiprecocial. Chicks fledge (leave the nest) at 18-25 days and go out to sea with the male of the pair. The chick is able to fly at the age of 39-46 days. (Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Average time to hatching: 31 days.

Average eggs per season: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Laying peaks in second half of June in southeastern Canada and in mid-June in western Gulf of Alaska. Mean laying date on the Farallon Islands, California, varies among years from early to late May (Sydeman and Eddy 1995, Condor 97:1048-1052). Both sexes, in turn, incubate 1 egg for 32-34 days (also reported as 28-35 days). May produce one or more replacement eggs if egg is lost during incubation. Young are fed at nest 18-25 days (also reported as 16-32 days) (average varies from about 19 to 23, affected by laying date, among other factors), then go to sea, tended by adult male for a few weeks. First breeds at about 3-5+ years. Breeding colonies may be large, with exceptionally high density; colony on Castle Rocks, California, had about 126,000 breeding birds in early 1980s (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

First breeds at 4-5 years old. Nest close together in colonies on cliffs and stony areas. No actual nest built. 1 egg, incubated by both partners for 28-37 days. Both parents feed hatchling. Young leaves nest with parents well before capable of flight, which happens around 50-70 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Uria aalge

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Uria aalge

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCTGCTCATCCGTGCAGAACTAGGCCAACCAGGGACCCTCCTAGGAGATGACCAAATCTATAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATGATTGGTGGTTTCGGAAACTGATTAGTCCCACTCATAATCGGTGCACCCGATATAGCATTTCCCCGTATAAACAATATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCTGGTACAGGATGAACTGTATATCCTCCCCTGGCTGGTAATCTAGCCCATGCCGGAGCTTCAGTGGATTTAGCAATCTTCTCCCTTCACTTAGCAGGTGTATCATCTATTCTAGGCGCTATCAACTTTATCACAACAGCCATCAACATAAAGCCTCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTACTTATCACTGCTGTCCTACTACTACTCTCACTCCCAGTACTTGCTGCTGGTATCACTAAATTACTAACAGATCGAAACTTAAACACAACATTCTTTGATCCAGCTGGAGGTGGTGACCCAGTACTTTACCAACACCTCTTCTGATTCTTTGGTCATCCAGAAGTATACATCCTAATCCTACCCGGCTTCGGAATTATCTCCCATGTCGTAACCTCCTATGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTGTCCATCGGCTTCCTAGGTTTCATCGTATGAGCTCACCACATATTCACCGTAGGAATAGACGTAGATACCCGGGCCTACTTTACATCCGCCACCATAATCATTGCTATTCCCACTGGCATCAAAGTATTCAGCTGCCTAGCTACACTACTTGGAGGAACTATCAAATGAGATCCTCCAATACTATGAGCCCTAGGCTTCATCTTCCTATTCACCATCGGAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the common murre is not threatened, they are highly susceptible to the damaging effects of oil spills and pollution.

(Terres 1980)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status, but has declined in recent past.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981, and listed under Appendix III of the Berne Convention (2). Included in the Birds of Conservation concern Amber list (medium conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.18,000,000 individuals (del Hoyo et al. 1996), while national population sizes have been estimated at < c.100 breeding pairs and c.50-10,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: On islands off Labrador, colonizing arctic foxes eliminated breeding populations of common murres (Birkhead and Nettleship 1995). Population decline in Washington (Bayer et al. 1991) possibly has been due to the effects of increased sea surface temperatures, oil spills, gill-net mortality, and/or U.S. Navy practice bombing (see Wiulson 1991). As many as 100,000 died in spring 1993 in nearshore waters of southeastern Alaska; cause unknown, perhaps related to abnormally warm water temperatures (Pacific Seabird Group Bull., 1993). Thousands drown in gill nets off Newfoundland. Many killed in halibut fishery off central California (protective legislation enacted, King 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historically, guillemots and their eggs were taken for food, and adults were shot for sport, but this largely ceased after the 1930s. Current threats include oil pollution (2). Although not a current problem, food shortage, thought to be caused mainly by over-fishing, is a potential threat (8). All auks are rendered particularly susceptible to oil pollution by their diving habits (2), and in recent years local incidents of mass mortality caused by starvation have occurred in Scotland (2). Food shortage may prove to be the most serious threat to this species in the long-term (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See Evans and Nettleship (1985) for management recommendations.

Management Research Needs: See Evans and Nettleship (1985) for research recommendations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Research into the effects of large-scale fishing on species of auks, particularly into the effects of industrial fishing of sand eels, is required (2). Furthermore, oil pollution and its effects must be minimised (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The excrement of the common murre is rich in potash, which is important for the growth of many marine species. Many of these species are essential food sources for a variety of fish species which have economic uses by humans.

(Terres 1980)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Murre

The Common Murre or Common Guillemot (Uria aalge) is a large auk. It is also known as the Thin-billed Murre in North America. It has a circumpolar distribution, occurring in low-Arctic and boreal waters in the North-Atlantic and North Pacific. It spends most of its time at sea, only coming to land to breed on rocky cliff shores or islands.

Common Murres have fast direct flight but are not very agile. They are more manoeuvrable underwater, typically diving to depths of 30–60 m (98–200 ft), and depths of up to 180 m (590 ft) have been recorded.

Common Murres breed in colonies at high densities, nesting pairs may be in bodily contact with their neighbours. They make no nest, their single egg is incubated on a bare rock ledge on a cliff face. Eggs hatch after ~30 days incubation. The chick is born downy and can regulate its body temperature after 10 days. Some 20 days after hatching the chick leaves its nesting ledge and heads for the sea, unable to fly, but gliding for some distance with fluttering wings, accompanied by its male parent. Chicks are capable of diving as soon as they hit the water. The female stays at the nest site for some 14 days after the chick has left.

Both male and female Common Murres moult after breeding and become flightless for 1–2 months. In southern populations they occasionally return to the nest site throughout the winter. Northern populations spend the winter farther from their colonies.

Taxonomy[edit]

The auks are a family of seabirds related to the gulls and terns which contains several genera. The Common Murre is placed in the guillemot (murre) genus Uria (Brisson, 1760), which it shares with the Thick-billed Murre or Brunnich's Guillemot, U. lomvia. These species, together with the Razorbill, Little Auk and the extinct Great Auk make up the tribe Alcini. This arrangement was originally based on analyses of auk morphology and ecology.[2]

The binomial name derives from Greek ouriaa, a waterbird mentioned by Athenaeus, and Danish aalge, "auk" (from Old Norse alka).[3]

Description[edit]

Adult bird in basic (winter) plumage, Germany

The Common Murre is 38–46 cm (15–18 in) in length with a 61–73 cm (24–29 in) wingspan.[4] Male and female are indistinguishable in the field and weight ranges between 945 g (2.08 lb) in the south of their range to 1,044 g (2.30 lb) in the north.[5] A weight range of 775–1,250 g (1.71–2.8 lb) has been reported.[6] In breeding plumage, the nominate subspecies (U. a. aalge) is black on the head, back and wings, and has white underparts. It has thin dark pointed bill and a small rounded dark tail. After the pre-basic moult, the face is white with a dark spur behind the eye. Birds of the subspecies U. a. albionis are dark brown rather than black, most obviously so in colonies in southern Britain. Legs are grey and the bill is dark grey. Occasionally, adults are seen with yellow/grey legs. In May 2008, an aberrant adult was photographed with a bright yellow bill.[7]

The plumage of first winter birds is the same as the adult basic plumage. However, the first pre-alternate moult occurs later in the year. The adult pre-alternate moult is December–February, (even starting as early as November in U. a. albionis). First year birds can be in basic plumage as late as May, and their alternate plumage can retain some white feathers around the throat.[4]

Swimming in Iceland

Some individuals in the North Atlantic, known as "bridled guillemots", have a white ring around the eye extending back as a white line. This is not a distinct subspecies, but a polymorphism that becomes more common the farther north the birds breed—perhaps character displacement with the northerly Thick-billed Murre, which has a white bill-stripe but no bridled morph. The white is highly contrasting especially in the latter species and would provide an easy means for an individual bird to recognize conspecifics in densely packed breeding colonies.[8]

The chicks are downy with blackish feathers on top and white below. By 12 days old, contour feathers are well developed in areas except for the head. At 15 days, facial feathers show the dark eyestripe against the white throat and cheek.[9]

Flight[edit]

The Common Murre flies with fast wing beats and has a flight speed of 80 km/h (50 mph).[10] Groups of birds are often seen flying together in a line just above the sea surface.[4] However, a high wing loading of 2 g/cm²[11] means that this species is not very agile and take-off is difficult.[12] Common Murres become flightless for 45–60 days while moulting their primary feathers.[13]

Diving[edit]

The Common Murre is a pursuit-diver that forages for food by swimming underwater using its wings for propulsion. Dives usually last less than one minute, but the bird swims underwater for distances of over 30 m (98 ft) on a regular basis. Diving depths up to 152 m (499 ft) have been recorded[14] and birds can remain underwater a couple of minutes.

Distribution and habitat[edit]

The breeding habitat is islands, rocky shores, cliffs and sea stacks. The range is:

Subspecies[15]RangeAppearance
Uria aalge aalgeNominate subspecies, eastern Canada, Greenland, Iceland, northern British Isles and southern Norway
U. a. albionisSouthern British Isles, France, Germany, Spain, PortugalSmaller than nominate, chocolate brown upperparts
U. a. hyperboreaNorthern Norway, Northwest Russia, Barents SeaLarger than U. a. aalge, black upperparts
U. a. intermediaBaltic SeaIntermediate between U. a. aalge and U. a. albionis
U. a. spilopteraFaroe Islands
U. a. inornataNorth Pacific, Japan, Eastern Russia, AlaskaLargest subspecies and largest auk, slightly larger than Thick-billed Murre
U. a. californicaCalifornia, Oregon, Washington, British Columbia

Some birds are permanent residents; northern birds migrate south to open waters near New England, southern California, Japan, Korea and the western Mediterranean. Common Murres rest on the water in the winter and this may have consequences for their metabolism. In the Black-legged Kittiwake (which shares this winter habit) resting metabolism is 40% higher on water than it is in air.[16]

The population is large, perhaps 7.3 million breeding pairs [17] or 18 million individuals.[1] It is presently stable, but potential threats include excessive hunting (legal in Newfoundland), pollution and oil spills.

Ecology and behaviour[edit]

Feeding[edit]

The Common Murre can venture far from its breeding grounds to forage; distances of 100 km (62 mi) and more are often observed[18] though if sufficient food is available closer by, birds only travel much shorter distances. The Common Murre mainly eats small schooling forage fish 200 mm (7.9 in) long or less, such as polar cod, capelin, sand lances, sprats, sandeels, Atlantic cod and Atlantic herring. Capelin and sand lances are favourite food, but what the main prey is at any one time depends much on what is available in quantity.[18] It also eats some molluscs, marine worms, squid, and crustaceans such as amphipods. It consumes 20–32 g (0.71–1.1 oz) of food in a day on average. It is often seen carrying fish in its bill with the tail hanging out.[8]

The Snake Pipefish is occasionally eaten, but it has poor nutritional value. The amount of these fish is increasing in the Common Murre's diet. Since 2003, the Snake Pipefish has increased in numbers in the North-east Atlantic and North Sea and sandeel numbers have declined.[19]

Communication[edit]

The Common Murre has a variety of calls, including a soft purring noise.

Reproduction[edit]

Colonies[edit]

Part of a U. a. californica colony,(Farallon Islands, California)

The Common Murre nests in densely packed colonies (known as "loomeries"), with up to twenty pairs occupying one square metre at peak season.[citation needed] Common Murres do not make nests and lay their eggs on bare rock ledges, under rocks, or the ground. They first breed at four to six years old and average lifespan is about 20 years.

Immature birds return to the natal colony, but from age 5 onwards ~25% of birds leave the colony, perhaps dispersing to other colonies.[20]

U. a. aalge colony, Gull Island, Witless Bay Ecological Reserve, Newfoundland and Labrador. Atlantic Puffins nest in burrows in the grassy area.

High densities mean that birds are close contact with neighbouring breeders.[21] Common Murres perform appeasement displays more often at high densities and more often than Razorbills.[21] Allopreening is common both between mates and between neighbours. Allopreening helps to reduce parasites, and it may also have important social functions.[22] Frequency of allopreening a neighbour correlates well with current breeding success.[22] Allopreening may function as a stress-reducer; ledges with low levels of allopreening show increased levels of fighting and reduced breeding success.[22]

Courtship[edit]

Courtship displays including bowing, billing and mutual preening. The male points its head vertically and makes croaking and growling noises to attract the females. The species is monogamous, but pairs may split if breeding is unsuccessful.[23][24]

Eggs and Incubation[edit]

See also Bird eggs
Murre eggs

Common Murre eggs are large (around 11% of female weight[15]), and are pointed at one end. There are a few theories to explain their pyriform shape:

  1. If disturbed, they roll in a circle rather than fall off the ledge.
  2. The shape allows efficient heat transfer during incubation.[25]
  3. As a compromise between large egg size and small cross-section. Large size allows quick development of the chick. Small cross-sectional area allows the adult bird to have a small cross-section and therefore reduce drag when swimming.[15]

Eggs are laid between May and July for the Atlantic populations and March to July for those in the Pacific. The female spends less time ashore during the two weeks before laying. When laying, she assumes a "phoenix-like" posture: her body raised upright on vertical tarsi; wings half outstretched. The egg emerges point first and laying usually takes 5–10 minutes.[26]

Herring Gull steals an egg, Lundy

The eggs vary in colour and pattern to help the parents recognize them,[citation needed] each egg's pattern being unique. Colours include white, green, blue or brown with spots or speckles in black or lilac. After laying, the female will look at the egg before starting the first incubation shift.[26] Both parents incubate the egg for the 28 to 34 days to hatching in shifts of 1–38 hours.[15]

Eggs can be lost due to predation or carelessness. Crows and Gulls are opportunist egg thieves. Eggs are also knocked from ledges during fights. If the first egg is lost, the female may lay a second egg. This egg is usually lighter than the first, with a lighter yolk.[citation needed] Chicks from second eggs grow quicker than those from first eggs. However this rapid growth comes at a cost, first chicks have larger fat reserves and can withstand temporary shortages of food.[citation needed]

Growth of the chick[edit]

Chicks occupy an intermediate position between the precocial chicks of genus Synthliboramphus and the semi-precocial chicks of the Atlantic Puffin.[27] They are born downy and by 10 days old they are able to regulate their own temperature.[9] Except in times of food shortage there is at least one parent present at all times, and both parents are present 10–30% of the time.[28] Both parents alternate between brooding the chick or foraging for food.

Adults feeding chick, Lundy

Provisioning is usually divided equally between each parent, but unequal provisioning effort can lead to divorce.[24] Common Murres are single-prey loaders, this means that they carry one fish at time. The fish is held lengthways in the adult's bill, with the fish's tail hanging from the end of the beak. The returning adult will form its wings into a 'tent' to protect the chick. The adult points its head downwards and the chick swallows the fish head first.

Alloparenting behaviour is frequently observed. Non-breeding and failed breeders show great interest in other chicks, and will attempt to brood or feed them. This activity is more common as the chicks get older and begin to explore their ledge. There has also been a record of a pair managing to raise two chicks.[29] Adults that have lost chicks or eggs will sometimes bring fish to the nest site and try to feed their imaginary chick.

At time of extreme food stress, the social activity of the breeding ledge can break down. On the Isle of May colony in 2007, food availability was low. Adults spent more of their time-budget foraging for their chicks and had to leave them unattended at times. Unattended chicks were attacked by breeding neighbour which often led to their deaths. Non-breeding and failed breeders continued to show alloparental care.[30]

The chicks will leave the nest after 16 to 30 days (average 20–22 days),[5] and glide down into the sea, slowing their fall by fluttering as they are not yet able to fly. Chicks glide from heights as high as 457 m (1,499 ft) to the water below.[14] Once the young chick has left the nest, the male is in close attendance for up to two months. The chicks are able to fly roughly two weeks after fledging. Up until then the male feeds and cares for the chick at sea. In its migration south the chick swims about 1,000 km (620 mi). The female remains at the nest site for up to 36 days after the chick has fledged (average 16 days).[31]

Relationship to humans[edit]

Common Murre Chick, Lundy
Breeding plumage
Common Murre family

Pollution[edit]

Major oil spills double the winter mortality of breeding adults but appear to have little effect on birds less than three years old.[32] This loss of breeding birds can be compensated by increased recruitment of 4–6 year olds to breeding colonies.[32]

Recreational disturbance[edit]

Nesting Common Murres are prone to two main sources of recreational disturbance: rock-climbing and birdwatching. Sea cliffs are a paradise for climbers as well as birds; a small island like Lundy has over 1000 described climbing routes.[33] To minimise disturbance, some cliffs are subject to seasonal climbing bans.[33]

Birdwatching has conflicting effects on Common Murres. Birdwatchers petitioned the UK government to introduce the Sea Birds Preservation Act 1869. This act was designed to reduce the effects of shooting and egg collecting during the breeding season.[34] Current concerns include managing the effect of visitor numbers at wildlife reserves. Common Murres have been shown to be sensitive to visitor numbers.[35]

Seabirds as indicators of marine health[edit]

When Common Murres are feeding their young, they return with one fish at a time. The provisioning time relates to the distance of the feeding areas from the colony and the numbers of available fish. There is a strong non-linear relationship between fish density and colony attendance during chick-rearing.[36]

As a food source[edit]

In areas such as Newfoundland, the birds, along with the related Thick-billed Murre, are referred to as 'turrs' or 'tuirs', and are consumed. The meat is dark and quite oily, due to the birds' diet of fish. Eggs have also been harvested. Eggers from San Francisco took almost half a million eggs a year from the Farallon Islands in the mid-19th century to feed the growing city.[37]

Notes[edit]

  1. ^ a b BirdLife International (2012). "Uria aalge". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Strauch (1985)
  3. ^ "Guillemot Uria aalge [Pontoppidan, 1763]". Bird facts. British Trust for Ornithology. Retrieved 20 August 2008. 
  4. ^ a b c Mullarney et al. (1999)
  5. ^ a b Harris & Birkhead (1985)
  6. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  7. ^ Blamire (2008)
  8. ^ a b Nettleship (1996)
  9. ^ a b Mahoney & Threlfall(1981)
  10. ^ Vaughn (1937)
  11. ^ Livezey (1988)
  12. ^ Bédard (1985)
  13. ^ Birkhead & Taylor (1977)
  14. ^ a b "Common Murre Fact Sheet, Lincoln Park Zoo"[dead link]
  15. ^ a b c d Gaston & Jones (1998)
  16. ^ Humphreys et al. (2007)
  17. ^ Mitchell et al. (2004)
  18. ^ a b Lilliendahl et al. (2003)
  19. ^ Harris et al. (2008)
  20. ^ Harris et al. (2007)
  21. ^ a b Birkhead (1978)
  22. ^ a b c Lewis et al. (2007)
  23. ^ Kokko et al. (2004)
  24. ^ a b Moody et al. (2005)
  25. ^ Johnson (1941)
  26. ^ a b Harris & Wanless (2006)
  27. ^ Gaston (1985)
  28. ^ Wanless et al. (2005)
  29. ^ Harris et al. (2000)
  30. ^ Ashbrook et al. (2008)
  31. ^ Harris & Wanless (2003)
  32. ^ a b Votier et al. (2008)
  33. ^ a b Harrison (2008)
  34. ^ Barclay-Smith (1959)
  35. ^ Beale (2007)
  36. ^ Harding et al. (2007)
  37. ^ White, Peter; (1995)

References[edit]

Ashbrook, Kate; Wanless, Sarah; Harris, Michael P. & Hamer, Keith C. (2008). "Hitting the buffers: Conspecific aggression undermines benefits of colonial breeding under adverse conditions". Biology Letters 4 (6): 630–3. doi:10.1098/rsbl.2008.0417. PMC 2614172. PMID 18796390. 
Barclay-Smith, Phyllis (2008). "The British contribution to bird protection". Ibis 101: 115. doi:10.1111/j.1474-919X.1959.tb02363.x. 
Beale, Colin M. (2007). "Managing visitor access to seabird colonies: A spatial simulation and empirical observations". Ibis 149: 102. doi:10.1111/j.1474-919X.2007.00640.x. 
Bédard, Jean (1985): Evolution and Characteristics of the Atlantic Alcidae in Nettleship and Birkhead (1985) pp 1–51
Bennett, J. (2001): Animal Diversity Web – Uria aalge. Retrieved 2008-JAN-13.
Birkhead, Tim R. (1978). "Behavioural adaptations to high density nesting in the Common Guillemot, Uria aalge". Animal Behaviour 26: 321. doi:10.1016/0003-3472(78)90050-7. 
Birkhead, Tim R. & Taylor, Antony M. (2008). "Moult of the Guillemot Uria aalge". Ibis 119: 80. doi:10.1111/j.1474-919X.1977.tb02048.x. 
Blamire, Sheila (2008). "A yellow-billed Guillemot in Norway". Birding World 21 (7): 306. 
Freethy, Ron (1987): The Auks: an ornithologist's guide. Facts on File, New York. ISBN 0-8160-1696-8
Gaston, Anthony J. (1985): Development of the young in the Atlantic Alcidae in Nettleship & Birkhead (1985) pp 319–354
Gaston, Anthony J. & Jones, Ian (1998) The Auks, Alcidae. Oxford University Press, Oxford. ISBN 0-19-854032-9
Harding, Ann M.A.; Piatt, John F. & Schmutz, Joel A. (2007). "Seabird behavior as an indicator of food supplies: sensitivity across the breeding season". Marine Ecology Progress Series 352: 269–274. doi:10.3354/meps07072. 
Harris, Michael P. & Birkhead, Tim R. (1985): Breeding Ecology of the Atlantic Alcidae in Nettleship & Birkhead (1985) pp 155–204
Harris, Michael P.; Bull, J., & Wanless, Sarah (2000). "Common Guillemots Uria aalge successfully feed two chicks". Atlantic Seabirds 2 (2): 92–94. 
Harris, Michael P.; Frederiksen, Morten & Wanless, Sarah (2007). "Within- and between-year variation in the juvenile survival of the Common Guillemot Uria aalge". Ibis 149 (3): 472. doi:10.1111/j.1474-919X.2007.00667.x. 
Harris, Michael P.; Newell, Mark; Daunt, Francis; Speakman, John R. & Wanless, Sarah (2007). "Snake Pipefish Entelurus aequoreus are poor food for seabirds". Ibis 150 (2): 413. doi:10.1111/j.1474-919X.2007.00780.x. 
Harris, Michael P. & Wanless, Sarah (2003). "Postfledging occupancy of breeding sites by female common murres (Uria aalge)". The Auk 120: 75. doi:10.1642/0004-8038(2003)120[0075:POOBSB]2.0.CO;2. 
Harris, Michael P. & Wanless, Sarah (2006). "Laying a big e.g. on a little ledge:does it help a female Common Guillemot if Dad's there?". British Birds 99: 230–235. 
Harrison, Paul (2008): Lundy (Climbers Club Guides) Climbers Club
Harrison, Peter (1988): Seabirds (2nd ed.). Christopher Helm, London. ISBN 0-7470-1410-8
Humphreys, Elizabeth M.; Wanless, Sarah & Bryant, David M. (2007). "Elevated metabolic costs while resting on water in a surface feeder: the Black-legged Kittiwake Rissa tridactyla". Ibis 149: 106–111. doi:10.1111/j.1474-919X.2006.00618.x. 
Johnson, Robert A. (1941). "Nesting behavior of the Atlantic Murre". Auk 58 (2): 153–163. doi:10.2307/4079099. 
Kokko, H.; Harris, Michael, P. & Wanless, Sarah (2004). "Competition for breeding sites and site-dependent population regulation in a highly colonial seabird, the common guillemot Uria aalge". Journal of Animal Ecology 73 (2): 367. doi:10.1111/j.0021-8790.2004.00813.x. 
Lewis, Sue; Roberts, Gilbert; Harris, Michael P.; Prigmore, Carina & Wanless, Sarah (2007). "Fitness increases with partner and neighbour allopreening". Biology Letters 3 (4): 386–389. doi:10.1098/rsbl.2007.0258. PMC 2390679. PMID 17550875. 
Lilliendahl, K.; Solmundsson, J.; Gudmundsson, G.A. & Taylor, L. (2003). "Can surveillance radar be used to monitor the foraging distribution of colonially breeding alcids?". Condor 105 (1): 145–150. doi:10.1650/0010-5422(2003)105[145:CSRBUT]2.0.CO;2. 
Mahoney, Shane P. & Threlfall, William (2008). "Notes on the eggs, embryos and chick growth of Common Guillemots Uria aalge in Newfoundland". Ibis 123 (2): 211. doi:10.1111/j.1474-919X.1981.tb00928.x. 
Mitchell, P. Ian; Newton, Stephen F.; Ratcliffe, Norman & Dunn, Timothy E. (eds.) (2004): Seabird Populations of Britain and Ireland. Poyser, London. ISBN 0-7136-6901-2
Moody, Allison T.; Wilhelm, Sabina, I.; Cameron-MacMillan, Maureen L.; Walsh, Carolyn J. & Storey, Anne E. (2004). "Divorce in common murres (Uria aalge): relationship to parental quality". Behavioral Ecology and Sociobiology 57 (3): 224. doi:10.1007/s00265-004-0856-8. 
Mullarney, Killian; Svensson, Lars; Zetterström, Dan & Grant, Peter J. (1999): Collins Bird Guide: 194–197 HarperCollins, London. ISBN 0-00-711332-3
National Geographic Society (2002): Field Guide to the Birds of North America. National Geographic, Washington DC. ISBN 0-7922-6877-6
Nettleship, David N. (1996): 2. Common Murre. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.) (1996), Handbook of Birds of the World (Volume 3: Hoatzin to Auks): 709–710, plate 59. Lynx Edicions, Barcelona. ISBN 84-87334-20-2
Nettleship, David, N. & Birkhead, Tim R. (eds.) (1985): The Atlantic Alcidae. Academic Press, London. ISBN 0-12-515671-5
Sibley, David Allen (2000): The Sibley Guide to Birds. Alfred A. Knopf, New York. ISBN 0-679-45122-6
Strauch, J.G. Jr. (1985). "The phylogeny of the Alcidae". Auk 102 (3): 520–539. 
Vaughn, H. R. H. (1937). British Birds 31: 123. 
Votier, S.C., Birkhead, T.R., Oro, D., Trinder, M., Grantham, M.J., Clark, J.A., McCleery, R.H. & Hatchwell, B.J. (2008). "Recruitment and survival of immature seabirds in relation to oil spills and climate variability". Journal of Animal Ecology 77 (5): 974–983. doi:10.1111/j.1365-2656.2008.01421.x. PMID 18624739. 
Wanless, S.; Harris, M.P.; Redman, P. & Speakman, J.R. (2005). "Low energy values of fish as a probable cause of a major seabird breeding failure in the North Sea". Marine Ecology Progress Series 294: 1–8. doi:10.3354/meps294001. 
White, Peter; (1995), The Farallon Islands, Sentinels of the Golden Gate, Scottwall Associates:San Francisco, ISBN 0-942087-10-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!