Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Guillemots are true seabirds. They only come on land to breed. They forage for food from the surface by sticking their head underwater and search for a tasty fish, such as sprat and lesser sandeel. Guillemots are excellent divers, easily swimming down to 180 meters. Under water, they swim just like penguins, using their wings. That is why their feathers and wings are very short and strong.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Guillemots are true seabirds. They only come on land to breed. They look for food from the water by sticking their head underwater and search for a tasty fish, such as sprat and lesser sandeel. Guillemots are excellent divers, easily swimming down to 180 meters. Under water, they swim just like penguins, using their wings. That is why their feathers and wings are very short and strong.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Guillemots gather in breeding colonies for the summer. Between May and July, females lay a single egg directly onto cliff ledges; its conical shape prevents it from rolling off (3). At around 3 weeks of age, the young guillemot leaves the colony before it has fledged, and dramatically plunges into the sea accompanied by the adult male (6), who will care for the young at sea until it becomes independent a couple of months later (2), (5). Shortly after leaving the breeding colonies between June and August, adult guillemots undergo the main annual moult, and become flightless for around 6 to 7 weeks (5). During the winter guillemots disperse fairly widely, with young birds covering the greatest distances (5). Throughout the year, the diet consists mainly of various small species of fish, as well as crustaceans, marine worms and molluscs. Sand eels are particularly important during summer (2). Guillemots dive to obtain food (2), 'flying' under water with their wings (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The guillemot is the commonest member of the auk family in the British Isles (3). The head as well as the upperparts are dark brown in colour; the underparts are white. In winter a variable part of the head also becomes white (3). A 'bridled' form occurs in which the eye is bordered with white, and a white line extends backwards from the eye towards the neck (3). The bill is thin, uniformly dark and pointed, and the tail is short, so that in flight the legs are clearly visible; these features allow the guillemot to be distinguished from the razorbill (Alca torda), which also has darker upperparts (3). Young guillemots in their first summer are generally similar in appearance to adults, but have a white area on the throat (3). In breeding colonies, this species is particularly vocal, producing a variety of calls including a deep 'mmmmm' (3), which has given rise to an alternative common name for this species, the 'murre' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Common Guillemot has a circumpolar distribution, occuring in the low-arctic and boreal waters of the north Atlantic and north Pacific (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Labrador to Virginia
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During breeding, the common murre populations of the Pacific Ocean range from coastal areas of western Alaska to central California. The Atlantic Ocean populations range from Labrador to Nova Scotia. They spend the winters close to the breeding areas but their range extends to southern California in the Pacific populations and to Maine in the Atlantic populations.

(del Hoyo, et al. 1996, Ehrlich 1988)

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: along coasts of North Pacific from Bering Strait south to northern Japan, eastern Korea, and central California; and North Atlantic from western Greenland, Iceland, Bear Island, and Novaya Zemlya south to Newfoundland and northern France. NON-BREEDING: at sea mainly in boreal waters (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern Atlantic and Pacific oceans. South to Japan and Korea in Pacific, south to Mediterranean in Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in the Atlantic and Pacific Oceans (1), breeding on the coasts of the north Pacific and north Atlantic (2). In Britain it breeds in internationally significant numbers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

At first glance, the common murre appears penguin-like, as the breeding adults are dark brown-black on the head, neck and back with a white underbelly and white tipped secondary feathers. They are about 38-43cm in length and stand upright like a penguin when on land. They have dark, long, and slender bills and dark greyish-black feet and legs. They have a wingspan of 64-71 cm. The adult winter plumage is mostly identical except for white on the cheeks and throat and a dark spur extending back from the eye. An alternate form, or the bridled morph, only occurs in a population in the North Atlantic. It has an eye ring with a line extending toward the back of its head in addition to the regular adult plumage. Chicks are downy when first hatched. They are blackish brown on top and white underneath. When they are first hatched they weigh 55-95 grams. Juveniles are similar to adults except for their smaller size and darker heads.

(Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Range mass: 945 to 1044 g.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 6.8224 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 45 cm

Weight: 1006 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 40-43 cm, Wingspan: 71 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The Common Guillemot is a pursuit-diving marine bird which forages primarily during daylight. One parent remains at the colony with the chick whilst the other is on a foraging trip. Birds departing colonies usually splash-down to form large rafts close to the colony before departing to foraging areas. External radio tagging has been shown to adversely effect breeding (Wanless et al. 1988, Nevins 2004), whereas birds fitted with internal transmitters behaved as normal (Wanless et al. 1988). Diet During the breeding season, schooling pelagic fish species are the most important prey for adults, though benthic species can also be important.In Labrador, Canada, Shannies (Sticheaidae) were the main source of food, comprising 84% of the diet in 1996 and 52.9% in 1997 (Bryant and Jones 1999). Capelin (Mallotus villosus) were also important, forming 44.7% of the diet in 1997 (Bryant and Jones 1999). In the UK, the main prey taxa are sandeel (Ammodytes spp.) and clupeids. Small gadoids are also important at some colonies. Foraging range This species dives to maximum depths of 170-230m. During the breeding season, surveys recorded the highest densities of birds in the 51 - 100 m depth zone, although birds were still abundant in water less than 50 m and 101 - 200 m deep. Very few were seen in deeper areas (Wanless et al. 1990). The foraging range of this species appears variable across seasons and years. At the Isle of May, Scotland, during 1986 around 70% of foraging trips were over 7 km from the colony, whereas in the following year the birds tended to make shorter trips (Wanless et al. 1990). Foraging trips in eastern Canada are within 100 km (Cairns et al. 1987, Davoren et al. 2003), and in Pribilof Islands, Alaska, foraging occurred mostly within 60 km. In Witless Bay, Newfoundland, foraging aggregations formed over large Capelin schools within 5 km of breeding sites. Along the Newfoundland coastline, aggregations occurred within 15 km of the colonies, and at an offshore ridge about 80 km southeast of the colonies. Despite these large foraging radii, waters close to the colony were the most frequent destination of feeding birds. This was particularly true during chick rearing, when only one third of feeding trips could have exceeded 10 km from the colony (Cairns et al. 1987). In Pribilof Islands, Alaska, birds showed a consistent preference for shallower waters (Schneider and Hunt 1984). High densities of foraging birds have also been observed foraging over a submarine ridge (Coyle et al. 1992). In Kachemak Bay, Alaska, it appears that birds tend to feed over rocky substrates in water depths of about 18 to 55 m (Sanger G.A. 1987). They have also been observed to forage in riptides (Wanless et al. 1990), and in areas of sandy sediment suitable for sandeels (Wanless et al. 1998, BirdLife International 2000). Near Flamborough Head, UK, the Farallones, California, and Pribilof Islands, Alaska, birds forage at fronts between thermally distinct bodies of water. In the UK example, this occurs at a seasonally-occuring front between thermally-mixed and thermally-stratified water, whereas in the Farallones, the front was between cold and salty upwellings and estuarine outflow (Decker and Hunt 1996, BirdLife International 2000).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 225239 specimens in 1 taxon.
Water temperature and chemistry ranges based on 96909 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.467 - 17.280
  Nitrate (umol/L): 0.224 - 16.868
  Salinity (PPS): 5.715 - 35.972
  Oxygen (ml/l): 5.581 - 8.419
  Phosphate (umol/l): 0.138 - 0.890
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -0.467 - 17.280

Nitrate (umol/L): 0.224 - 16.868

Salinity (PPS): 5.715 - 35.972

Oxygen (ml/l): 5.581 - 8.419

Phosphate (umol/l): 0.138 - 0.890

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The common murre is primarily a pelagic species. It spends the majority of its time at sea except for during breeding season. The breeding season is spent on costal cliffs or offshore islands that are primarily rocky. (Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Nonbreeding: pelagic and along rocky seacoasts (AOU 1983). Nests in the open or in crevices on broad and narrow cliff ledges, on stack (cliff) tops, and on flat, rocky, low-lying islands; less commonly nests under boulders or in caves; usually nests in same exact site in successive years (Harris and Birkhead 1985). Cliff-top nests in Washington had lower reproductive success than did crevice nests in vertical cliffs (Parrish 1995, Auk 112:390-401).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 225239 specimens in 1 taxon.
Water temperature and chemistry ranges based on 96909 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.467 - 17.280
  Nitrate (umol/L): 0.224 - 16.868
  Salinity (PPS): 5.715 - 35.972
  Oxygen (ml/l): 5.581 - 8.419
  Phosphate (umol/l): 0.138 - 0.890
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -0.467 - 17.280

Nitrate (umol/L): 0.224 - 16.868

Salinity (PPS): 5.715 - 35.972

Oxygen (ml/l): 5.581 - 8.419

Phosphate (umol/l): 0.138 - 0.890

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Open ocean, bays, and sea cliffs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits both coastal and offshore waters, and nests on coastal cliffs and rock stacks (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeders from Newfoundland are resident or move only short distance to south. Males from Chukchi Sea colonies in Alaska drift toward Siberia with flightless young for a few weeks before flying rapidly south to the southeastern Bering Sea. Females from these colonies fly directly to the wintering grounds (Hatch et al. 2000). Unimak Pass probably most important corridor to and from eastern Bering Sea. See Brown (1985) for discussion of movements in Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Moves south of freezing waters, but is permanent resident in many locations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The common murre is mainly piscivorous. They are surface divers that can remain submerged for up to one minute at a time. They often dive to a depth of 100 feet but have been recorded to reach a depth of 550 feet. They use their strong wings to fly underwater. Adults consume between 20g and 32g of food everyday. They mostly catch small fish up to 7 inches in length, which they carry in their bills lengthwise with the tail hanging out. Most of the fish species consumed include polar cod, capelin (Mallotus), launces, sprat (Sprattus), sandeels (Ammodytes), small Atlantic cod and herring (Clupeus). They also eat a variety of marine worms, amphipods, shrimp, molluscs, and Arctic squids.

(Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Mysids and shrimp dominate winter diet in Alaska, mostly fish and some squid off California, mostly capelin off Newfoundland (Sanger 1987). Young fed herring, capelin, sprat, sandlance (Bradstreet and Brown 1985). Dives from surface to at least 180 m (Piatt and Nettleship 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds mostly on fish, but will also eat marine worms, crustaceans, and squids.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Estimated global population 13.0-20.7 million breeding individuals (Ainley et al. 2002): eastern Asia, 3.0-3.3 million (Kondratyev et al. 2000); western North America, 4.0-8.4 million; eastern North America, 1.2 million (Ainley et al. 2002); Greenland and Europe, 4.8-7.8 million (Nettleship and Evans 1985). Population estimates for individual colonies in western North America are presented in USFWS (2001) and Carter et al. (2001), and summarized in Ainley et al. (2002); those for eastern North America are presented in Ainley et al. (2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Newfoundland, median potential foraging range (from breeding colony) was 37.8 km for incubating birds, 5.4 km for chick-rearing birds (Cairns et al. 1987). However, in northwestern Alaska, telemetry data from incubating or chick-rearing birds indicated that they regularly foraged up to 100 km from their colonies (Hatch et al. 2000). Annual adult survivorship greater than 85%. Up to 3900/sq km reported in winter on Grand Banks off Newfoundland. In California, Western Gull sometimes is an important predator on eggs and chicks (Spear 1993). High density breeding may reduce vulnerability to predators (J. Anim. Ecol. 60:721).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
317 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38 years (wild) Observations: In the wild, these animals have been known to live up to 38 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The first breeding season takes place at the age of 4-6 years. The common murre does not use nesting material, as the one egg is laid on the bare rock or soil of a steep cliff or ledge facing the sea. The egg is pyriform or pear-shaped which prevents it from rolling off of the ledge. This is because the egg pivots around the pointed tip when it is disturbed. The shape also maximizes the amount of surface area that will be in contact with the parent's brood patch during incubation. Eggs are laid between May and July in populations breeding on the Atlantic coast and between March and July on the Pacific coast. The eggs vary in colour from pure white to shades of green, blue, or brown with spots or speckles of brown, lilac, or black. These various colour forms are important for egg recognition by parents. Both parents participate in the incubation process, which takes between 28 and 34 days and is divided into 12-24 hour shifts. Chicks of the common murre are semiprecocial. Chicks fledge (leave the nest) at 18-25 days and go out to sea with the male of the pair. The chick is able to fly at the age of 39-46 days. (Ehrlich 1988, del Hoyo, et al. 1996, Terres 1980)

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 31 days.

Average eggs per season: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Laying peaks in second half of June in southeastern Canada and in mid-June in western Gulf of Alaska. Mean laying date on the Farallon Islands, California, varies among years from early to late May (Sydeman and Eddy 1995, Condor 97:1048-1052). Both sexes, in turn, incubate 1 egg for 32-34 days (also reported as 28-35 days). May produce one or more replacement eggs if egg is lost during incubation. Young are fed at nest 18-25 days (also reported as 16-32 days) (average varies from about 19 to 23, affected by laying date, among other factors), then go to sea, tended by adult male for a few weeks. First breeds at about 3-5+ years. Breeding colonies may be large, with exceptionally high density; colony on Castle Rocks, California, had about 126,000 breeding birds in early 1980s (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 4-5 years old. Nest close together in colonies on cliffs and stony areas. No actual nest built. 1 egg, incubated by both partners for 28-37 days. Both parents feed hatchling. Young leaves nest with parents well before capable of flight, which happens around 50-70 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Uria aalge

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCTGCTCATCCGTGCAGAACTAGGCCAACCAGGGACCCTCCTAGGAGATGACCAAATCTATAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATGATTGGTGGTTTCGGAAACTGATTAGTCCCACTCATAATCGGTGCACCCGATATAGCATTTCCCCGTATAAACAATATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCTGGTACAGGATGAACTGTATATCCTCCCCTGGCTGGTAATCTAGCCCATGCCGGAGCTTCAGTGGATTTAGCAATCTTCTCCCTTCACTTAGCAGGTGTATCATCTATTCTAGGCGCTATCAACTTTATCACAACAGCCATCAACATAAAGCCTCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTACTTATCACTGCTGTCCTACTACTACTCTCACTCCCAGTACTTGCTGCTGGTATCACTAAATTACTAACAGATCGAAACTTAAACACAACATTCTTTGATCCAGCTGGAGGTGGTGACCCAGTACTTTACCAACACCTCTTCTGATTCTTTGGTCATCCAGAAGTATACATCCTAATCCTACCCGGCTTCGGAATTATCTCCCATGTCGTAACCTCCTATGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTGTCCATCGGCTTCCTAGGTTTCATCGTATGAGCTCACCACATATTCACCGTAGGAATAGACGTAGATACCCGGGCCTACTTTACATCCGCCACCATAATCATTGCTATTCCCACTGGCATCAAAGTATTCAGCTGCCTAGCTACACTACTTGGAGGAACTATCAAATGAGATCCTCCAATACTATGAGCCCTAGGCTTCATCTTCCTATTCACCATCGGAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Uria aalge

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5