Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leptotila plumbeiceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATACCTAATTTTCGGCGCATGAGCCGGCATAGTAGGTACCGCCCTTAGCCTCCTTATTCGTGCAGAACTTGGACAACCCGGCACCCTCCTCGGAGACGACCAAATCTACAATGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATGATTGGGGGCTTTGGAAACTGATTAGTCCCACTCATAATCGGAGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTGCCCCCATCCTTCCTCCTCCTCCTGGCCTCTTCCACAGTTGAAGCTGGTGCTGGAACAGGATGAACTGTATATCCTCCCCTAGCCGGCAACCTAGCCCATGCCGGAGCCTCCGTAGACCTGGCCATCTTTTCACTCCACCTAGCCGGTGTCTCCTCCATCCTAGGGGCTATTAACTTTATTACTACCGCCATCAACATAAAACCCCCAGCCCTGTCACAATACCAAACCCCCCTGTTCGTATGGTCAGTTCTCATCACCGCTGTCCTCCTTCTCCTATCCCTCCCAGTCCTTGCTGCTGGCATCACTATGCTTCTCACAGACCGCAACCTGAACACTACATTCTTTGATCCTGCCGGCGGAGGTGATCCAGTACTATACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leptotila plumbeiceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey-headed Dove

The Grey-headed Dove (Leptotila plumbeiceps) is a large New World tropical dove. It is a resident breeder from eastern Mexico to western Panama. It was formerly considered conspecific with the Grey-fronted Dove, L. rufaxilla, of South America and the Grenada Dove, L. wellsi, of Grenada.

The Grey-headed Dove inhabits the understory of forests, old second growth, scrubby woodland and cacao plantations. It builds a stick nest in a tree and lays two white eggs. Incubation is about 14 days, and fledging another 15.

They Grey-headed Dove is 25 cm (9.8 in) long and weighs 155 g (5.5 oz). the adult has a grey crown and neck, the latter showing purple iridescence. It has a whitish forehead and throat. The upperparts and wings are olive-brown, and the underparts are pinkish shading to white on the belly. The tail is broadly tipped with white. The bill is black and the legs red. Young birds lack the grey on the head and have buff edges to the feathers of the back.

The Grey-headed Dove is usually seen singly or in pairs. It forages on the ground for fruit, seeds and grit. Its flight is fast and direct, with the regular beats and clattering of the wings which are characteristic of pigeons in general.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!