Articles on this page are available in 2 other languages: Spanish (7), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Hydroprogne caspia

A large (19-23 inches) tern, the Caspian Tern in summer is most easily identified by its gray-tipped wings, black cap, and large orange bill. In winter, the black in this species’ cap is replaced by mottled gray. Male and female Caspian Terns are similar to one another in all seasons. The Caspian Tern inhabits every continent except Antarctica. In North America, this species breeds locally in central Canada, the Great Lakes, along the Gulf coast of the United States, and along the Pacific and Atlantic coasts of the U.S.and Canada. In winter, Caspian Terns may be found in southern California, along the coast of the southeastern U.S., and further south into Mexico and Central America. In the Old World, this species breeds in Eurasia from Eastern Europe east to China, along the coasts of Africa and South Asia, and in Australasia, wintering widely in the tropics. Caspian Terns breed in a variety of habitats, including marshes, estuaries, barrier islands, bays, and lakes, and may be found either in freshwater or in saltwater. In winter, this species utilizes similar habitat types as in summer. Caspian Terns primarily eat fish and small crustaceans. Caspian Terns may be most easily seen standing or walking along the shore or on the beach, where their large size and bright orange bill are most apparent. With the aid of binoculars, it may also be possible to observe this species feeding by diving headfirst into the water. Caspian Terns are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Caspian terns have a cosmopolitan distribution, they are found on all continents except Antarctica. They are found along coastlines of oceans, seas, large lakes, and rivers. They migrate between breeding and wintering ranges for the most part, although some populations are resident year-round.

In the Americas, Caspian terns breed along coastal and inland waterways from the Gulf of Mexico and Baja California northwards through the Great Lakes and Canadian interior and as far north as southern Alaska on the Pacific coast and the Canadian maritime provinces on the Atlantic coast. They winter from southern California to Guatemala along the Pacific coast, including the Gulf of California, and from southern North Carolina on the Atlantic coast to Panama and Venezuela, including the Gulf of Mexico. They also winter in the Antilles.

Caspian terns breed in coastal areas from Scandinavia to the Baltic and Black Seas, throughout central Asia to Mongolia and the Persian Gulf and Red Sea to southeast Asia. They also breed throughout Australasia and Africa. Winter ranges are in warmer areas of their breeding range, including the Baltic, Black, and Mediterranean Seas, the Persian Gulf, and along African coastlines to South Africa.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Swedish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Cosmopolitan—wide distribution worldwide.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Caspian terns have a cosmopolitan distribution, they are found on all continents except Antarctica. They are found along coastlines of oceans, seas, large lakes, and rivers. They migrate between breeding and wintering ranges for the most part, although some populations are resident year-round. In the Americas, Caspian terns breed along coastal and inland waterways from the Gulf of Mexico and Baja California northwards through the Great Lakes and Canadian interior and as far north as southern Alaska on the Pacific coast and the Canadian maritime provinces on the Atlantic coast. They winter from southern California to Guatemala along the Pacific coast, including the Gulf of California, and from southern North Carolina on the Atlantic coast to Panama and Venezuela, including the Gulf of Mexico.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Caspian Tern has a cosmopolitan but scattered distribution. Their breeding habitat is large lakes and ocean coasts in North America (including the Great Lakes), and locally in Europe (mainly around the Baltic Sea and Black Sea), Asia, Africa, and Australasia (Australia and New Zealand). North American birds migrate to southern coasts, the West Indies and northernmost South America. European and Asian birds winter in the Old World tropics. African and Australasian birds are resident or disperse over short distances1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDS: Eastern U.S.: locally on Atlantic and Gulf coasts, from Virginia to northern Florida (very few), also recently in New Jersey, on the central Gulf Coast of Florida, and in southeastern Louisiana, Alabama, Mississippi, and Texas; and around the Great Lakes. Canada: Labrador, southeastern Quebec, and Newfoundland; Great Lakes region in southern Ontario; southern Manitoba and central Saskatchewan, along shores of Lake Winnipeg, Lake Winnepegosis, and Dore Lake; in Lake Athabasca in northeastern Alberta; and vicinity of Great Slave Lake in southern Mackenzie. In western North America: locally (mostly in interior but on coast in Washington and California) in Washington, eastern Oregon, northern Utah, northwestern Wyoming, Idaho (recent range expansion), and North Dakota, south to southern California and western Nevada; also Baja California and Sinaloa. WINTERS: southern U.S. (mainly coastal areas north to California and North Carolina) south to Mexico; sometimes to northern South America (Colombia, Venezuela), rarely in the West Indies. Casual in Hawaii. Breeds and winters extensively also in the Old World (Africa, Eurasia, Australian region).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Caspian terns are the largest tern species and are recognized by their large, bright coral red bill and full black cap on the head. Sexes are alike, from 47 to 54 cm long and from 530 to 782 g. Their upperparts are smooth gray and their breast, belly, rump, and tail are white. The wing feathers are dark gray to black on the underside. Their black cap might be speckled with white during the non-breeding season and in juveniles. The tail is only slightly notched. They have a large bill that is deep red to orange, sometimes with dark gray mark at the tip.

Range mass: 530 to 782 g.

Range length: 47 to 54 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Caspian terns are the largest tern species and are recognized by their large, bright coral red bill and full black cap on the head. Sexes are alike, from 47 to 54 cm long and from 530 to 782 g. Their upperparts are smooth gray and their breast, belly, rump, and tail are white. The primary feathers are dark gray to black on the underside. Their black cap extends to below the eye and onto the back of the head, it can become speckled with white during the non-breeding season and in juveniles. The tail is only slightly notched. They have a robust bill that is deep red to orange, sometimes with dark gray mark at the tip. Caspian terns are distinguished from other terns by their large size, substantially larger than most terns and about the size of gulls.

Range mass: 530 to 782 g.

Range length: 47 to 54 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 53 cm

Weight: 661 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from most other terns in much larger size and much thicker bill. Differs from the somewhat smaller royal tern in having a thicker bill, more extensive dark coloration on the underside of the primaries, and a less deeply forked tail; lacks the white forehead that is present in immature and basic plumages of royal and elegant terns.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Caspian terns are found in coastal areas, including beaches, marshes, estuaries, or in open habitats on islands in large bodies of water. They forage over water and nest on sandy, muddy, or pebbly shores or areas with little vegetation on islands.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine

Terrestrial Biomes: desert or dune

Aquatic Biomes: coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Although populations breeding near the equator are largely sedentary2, northern populations are strongly migratory and disperse after breeding before migrating southwards1. The species breeds between April and June (northern Hemisphere) or between September and December (southern Hemisphere)1 in large dense monospecific colonies or as single pairs or small groups (2-3 pairs) amidst large colonies of other species1, 3, 4. It is not a highly gregarious species outside of the breeding season4 but may aggregate into flocks on passage6, and during the winter it may feed in loose congregations1 in rich fishing areas or at nightly roost sites4. Habitat The breeding, passage and wintering habitats of this species are similar, although during the winter it is largely confined to the coast10. It frequents sheltered sea coasts1, 4, estuaries1, 2, 5, inlets, bays, harbours5, coastal lagoons4, 5, saltmarshes1 and saltpans5, 9, also occurring inland on fresh or saline wetlands including large lakes, inland seas1, 2, large rivers3, 5, creeks5, floodlands4, reservoirs1, 2, 5 and sewage ponds5. When breeding the species shows a preference for nesting on sandy, shell-strewn or shingle beaches3, 4, sand-dunes, flat rock-surfaces4, sheltered reefs5 or islands1, 3, 4 with sparse vegetation and flat or gently sloping margins surrounded by clear, shallow, undisturbed waters4. It also forms winter roosts on sandbars, mudflats and banks of shell1. Diet Its diet consists predominantly of fish 5-25 cm in length10 as well as the eggs and young of other birds, carrion1, aquatic invertebrates3 (e.g. crayfish)10, flying insects6, 10 and earthworms10. Breeding site The nest is a shallow depression in the sand, gravel, shells, sparse vegetation1 or dried mud2 of ridges, beaches3, 4, 5, dunes4, flat rocky or stony islets, banks5, islands or reefs in seas, lakes and large rivers3, dredge spoil piles and islands in reservoirs5. The species nests in large colonies or as single pairs or small groups amidst colonies of other species, neighbouring nests placed between 0.7 and 4 m part1. The species may forage up to 60 km from the site of the breeding colony1. Management information Management for this species should include a number of measures such as habitat and vegetation management, the use of artificial nest substrates, predator management (e.g. control of gull populations) and the minimisation of disturbance10. Habitat and vegetation management may include the creation of artificial islands with calm water on their leeward side to allow the growth of submerged vegetation and fish spawning habitats, or alternatively the creation of floating artificial nesting-rafts (e.g. barges covered with sand)10.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caspian terns are found in coastal habitats, including beaches, marshes, estuaries, or in open habitats on islands in large bodies of water. They forage over water and nest on sandy, muddy, or pebbly shores or areas with little vegetation on islands. Nesting on islands minimizes risks of predation to eggs and nestlings. They migrate along similar habitats as in their wintering and breeding ranges.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine

Terrestrial Biomes: desert or dune

Aquatic Biomes: coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1544 specimens in 1 taxon.
Water temperature and chemistry ranges based on 120 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.186 - 27.711
  Nitrate (umol/L): 0.116 - 3.951
  Salinity (PPS): 30.381 - 36.003
  Oxygen (ml/l): 4.593 - 7.553
  Phosphate (umol/l): 0.092 - 0.674
  Silicate (umol/l): 0.946 - 16.169

Graphical representation

Temperature range (°C): 6.186 - 27.711

Nitrate (umol/L): 0.116 - 3.951

Salinity (PPS): 30.381 - 36.003

Oxygen (ml/l): 4.593 - 7.553

Phosphate (umol/l): 0.092 - 0.674

Silicate (umol/l): 0.946 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Seacoasts, bays, estuaries, lakes, marshes, and rivers.

Nests on sandy or gravelly beaches and shell banks along coasts or large inland lakes; sometimes with other water birds. Pacific coast populations formerly nested mainly in inland marshes, now mainly on human-created habitats (e.g., salt pond dikes and levees) along coast; nests on dredge-spoil islands in North Carolina and Florida. See Spendelow and Patton (1988) for further details. In northeastern Lake Michigan, tended to use same colony site in successive years unless previous reproductive effort was unsuccessful (Cuthbert 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Juveniles in western North America disperse northward before migrating south to wintering areas, remain in wintering area through second winter, thereafter make annual migrations between breeding and wintering areas (Gill and Mewaldt 1983).

Great Lakes population winters along shores of Gulf of Mexico (Evers 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Caspian terns eat mainly fish, with some crayfish and insects occasionally. They forage by flying above shallow water, usually along a shoreline. As most Sterna do, they fly with their heads down, peering into the water, when they see prey, they may hover for a moment before making a sharp dive. They may just skim the surface when they dive or they may almost completely submerge themselves for a few seconds. They usually eat their prey as soon as it is captured but may take some fish back to a nest. They may wash fish before offering it to young and often clean their bill in water after feeding young. Fish prey includes Cymatogaster aggregata, Engraulis mordax, Alosa pseudoharengus, Osmerus mordax, Perca flavescens, Amblopites rupestris, Atherinopsis californiensis, Atherinops affinis, Leptocottus armatus, and juvenile Oncorhynchus.

Animal Foods: fish; insects; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Caspian terns eat primarily fish, with some crayfish and insects taken occasionally. They forage by flying above shallow water (0.5 to 5 m deep) at heights of 3 to 30 m, usually along a shoreline. As most terns do, they fly with their heads down, peering into the water, when they see prey, they may hover for a moment before making a sharp dive. They may just skim the surface when they dive or they may almost completely submerge themselves for a few seconds. They usually eat their prey as soon as it is captured but may take some fish back to a nest. They may wash fish before offering it to young and often clean their bill in water after feeding young. Dominant fish prey varies regionally, but includes shiner perch (Cymatogaster aggregata), anchovies (Engraulis mordax), alewife (Alosa pseudoharengus), rainbow smelt (Osmerus mordax), yellow perch (Perca flavescens), rock bass (Amblopites rupestris), jacksmelt (Atherinopsis californiensis), topsmelt (Atherinops affinis), staghorn sculpin (Leptocottus armatus), and juvenile salmon (Oncorhynchus).

Animal Foods: fish; insects; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly fishes obtained at surface of water by diving from air; sometimes feeds from surface like a gull and eats eggs and young of other terns and gulls (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Caspian terns are predators of small or young fish in coastal areas, they may be especially important predators in areas near breeding colonies. Caspian terns must compete for limited nesting habitats, including competing with Larus species. Caspian terns are parasitized by lice and internal worms.

Mutualist Species:

  • western gulls (Larus_occidentalis)
  • glaucous-winged gulls (Larus_glaucescens)
  • herring gulls (Larus_argentatus)

Commensal/Parasitic Species:

  • nematode (Cosmocephalus species)
  • lice (Actornithophilus_funebre)
  • lice (Degeeriella_praestans)
  • lice (Menophon)
  • lice (Philopterus_melanocephalus)
  • cestodes (Dibothriocephalus_oblongatum)
  • cestodes (Schistocephalus_solidus)
  • cestodes (Paricterotaenia species)
  • trematodes (Diplostomum species)
  • trematodes (Cotylurus species)
  • trematodes (Ornithobilharzia species)
  • trematodes (Clinostomum species)
  • trematodes (Stephanoprora species)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most predation is on eggs and hatchlings, which may be taken by a wide variety of predators. Reported predators on eggs and hatchlings include Larus, Bubo virginianus, Corvus corvax, Felis catus, Canis lupus familiaris, Canis latrans, Vulpes vulpes, Mephitis mephitis, Procyon lotor, Esox lucius, and Crotalus atrox. Adult Caspian terns may fall prey to birds of prey, such as Haliaeetus leucocephalus, and terrestrial predators when roosting or on a nest, such as Canis latrans and Vulpes vulpes. When a predator approaches a nesting colony, Caspian terns raise an alarm call and will often join together to mob the predator. They are aggressive and will chase any large bird that is close to a colony. Their diving attacks can be very effective, resulting in bloody wounds. However, their habit of taking flight to mob a predator may also leave eggs and nestlings vulnerable. Predators sometimes grab eggs and nestlings from exposed nests when the adults have flown away. Chicks crouch in the nest scrape and difficult to see, but will be detected by predators using scent or warmth to find prey.

Known Predators:

  • gull species (Larus)
  • great horned owls (Bubo_virginianus)
  • common ravens (Corvus_corvax)
  • domestic cats (Felis_catus)
  • dogs (Canis_lupus_familiaris)
  • coyotes (Canis_latrans)
  • red foxes (Vulpes_vulpes)
  • striped skunks (Mephitis_mephitis)
  • raccoons (Procyon_lotor)
  • northern pike (Esox_lucius)
  • western diamondback rattlesnakes (Crotalus_atrox)
  • bald eagles (Haliaeetus_leucocephalus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Caspian terns are predators of small or young fish in coastal areas, they may be especially important predators in areas near breeding colonies. Caspian terns must compete for limited nesting habitats, including competing with gull species (Larus occidentalis, Larus glaucescens, and Larus argentatus). Parasites of Caspian terns include lice (Actornithophilus funebre, Degeeriella praestans, Menophon, and Philopterus melanocephalus) and cestodes (Dibothriocephalus oblongatum, Schistocephalus solidus, and Paricterotaenia species), trematodes (Diplostomum, Cotylurus, Ornithobilharzia, Clinostomum, and Stephanoprora species), and a nematode (Cosmocephalus species).

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most predation is on eggs and hatchlings, which may be taken by a wide variety of avian, terrestrial, and aquatic predators. Reported predators on eggs and hatchlings include gull species (Larus), great horned owls (Bubo virginianus), common ravens (Corvus corvax), domestic cats (Felis catus), dogs (Canis lupus familiaris), coyotes (Canis latrans), red foxes (Vulpes vulpes), striped skunks (Mephitis mephitis), raccoons (Procyon lotor), northern pike (Esox lucius), and western diamondback rattlesnakes (Crotalus atrox). Adult Caspian terns may fall prey to avian predators, such as bald eagles (Haliaeetus leucocephalus) and terrestrial predators when roosting or on a nest (Canis latrans, Vulpes vulpes).

When a predator approaches a nesting colony, Caspian terns raise an alarm call and will often join together to mob the predator. They are aggressive and will chase any large bird that is close to a colony. Their diving attacks can be very effective, resulting in bloody wounds. However, their habit of taking flight to mob a predator may also leave eggs and nestlings vulnerable. Predators have been observed taking advantage of terns flying to grab eggs and nestlings from exposed nests. Chicks simply crouch in the nest scrape, and are cryptically colored, but will be detected by predators using scent or warmth to find prey.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: often rests with flocks of other terns. At a colony at the mouth of the Columbia River, 50% of adults foraged within 8 kilometers and 90% foraged within 21 kilometers (Collis et al. 1999); at other colonies, some adults travel long distances to obtain food; up to 50 kilometers on Lake Michigan (Cuthbert and Wires 1999) and 29-60 kilometers in another reported case (Gill 1976). At expanding colonies on the Pacific Coast, birds exhibited low natal philopatry (Collis et al. 1999), but elsewhere adults show strong fidelity to colonies (Cuthbert 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Caspian terns, like most Sterna, use a variety of calls. Young begin to call from within the egg and use an "i-i-i" call to beg for food. Caspian terns use various calls to maintain contact, express alarm, advertise that they are bringing fish back to the nest, and to beg. Most calls are hoarse and sound like "ra" or "rau." During courtship, they make steep dives that produce a soft, buzzing sound with their wings. Caspian terns communicate through visual displays and body posturing as well.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Caspian terns, like most terns, use a variety of vocalizations. Young begin to call from within the egg and use an "i-i-i" call to beg for food. Caspian terns use various calls to maintain contact, express alarm, advertise that they are bringing fish back to the nest, and to beg. Most calls are hoarse and variations on a "ra" or "rau." During courtship, they make steep dives that produce a soft, buzzing sound with their wings.

Caspian terns communicate through visual displays and body posturing as well. Aggression is displayed with a "head up" posture, with the head held towards the other tern and the feathers ruffled. The head is then bowed forward, showing off the black cap. Appeasement is conveyed with the head held straight up and wings out.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

As in most other animals, most deaths occur within a few months of hatching. Adults have high survival rates and can live more than 26 years in the wild.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

As in most other animals, most mortality occurs within a few months of hatching (62% in some areas). Adults have high survival rates and can live more than 26 years in the wild.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Caspian terns form mated pairs that stay together for the breeding season. Some pairs remain together for many years, but only 25% of pairs mate again the next year in some populations. Pairs are formed soon after birds arrive on the breeding grounds, although some pairs form during migration or on the wintering range. Males attract mates with a "fish flight." Males capture a fish and then fly with it over a group of terns. Females and males join in the display, flying with the male as he repeatedly passes over the group. He then lands near a female and makes bowing movements with his head. Females may ignore the male, try to steal the fish, or beg for the fish. Pairs perform a "high flight" display together to cement the bond, ascending and diving together as they vocalize. Symbolic construction of nest scrapes is also part of the courtship ritual.

Mating System: monogamous

Caspian terns arrive on the breeding grounds from late March to late May. Pairs begin to form nest scrapes soon after they arrive on the breeding grounds. They breed in late May and early June, laying from 1 to 3 buffy, splotched eggs. Eggs are laid every 2 to 3 days in a simple depression scraped in the ground and incubation begins immediately with the first egg. Caspian terns have 1 brood yearly. Incubation is from 25 to 28 days and young begin to fly at 37 days after hatching. Most individuals don't breed until they are 3 years old.

Breeding interval: Caspian terns breed once yearly.

Breeding season: Caspian terns breed in late May or June.

Range eggs per season: 1 to 3.

Range time to hatching: 25 to 28 days.

Average fledging age: 37 days.

Range age at sexual or reproductive maturity (female): 2 (low) years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 3 years.

Both parents incubate the eggs. A parent will bring a fish and offer it to their mate on the nest, then take over incubating. Females tend to spend more time caring for eggs and young. Parents protect their young from heat by standing above them to provide shade. Young are semiprecocial when hatched, with downy feathers but relying on their parents for feeding. They remain in or near the nest for about a week after hatching. They are fed fish by parents soon after hatching and they begin to accompany parents on foraging trips within a week or so of learning to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caspian terns are monogamous, with pairs staying together at least for the breeding season. Some pairs remain together for many years, but only 25% of pairs mate again the next year in some populations. Pairs are formed soon after birds arrive on the breeding grounds, although some pairs form during migration or on the wintering range. Males attract mates with a "fish flight." Males capture a fish and then fly with it over a group of terns. Females and males join in the display, flying with the male as he repeatedly passes over the group. He then lands near a female and makes bowing movements with his head. Females may ignore the male, try to steal the fish, or beg for the fish. This display is usually repeated several times before the male will feed the fish to the female, at which point the bond is formed and they copulate. Pairs perform a "high flight" display together to cement the bond, ascending and diving together as they vocalize. Symbolic construction of nest scrapes is also part of the courtship ritual.

Mating System: monogamous

Caspian terns arrive on the breeding grounds from late March to late May. Pairs begin to form nest scrapes soon after they arrive on the breeding grounds. They breed in late May and early June, laying from 1 to 3 buffy, splotched eggs. Eggs are laid every 2 to 3 days in a simple scrape nest and incubation begins immediately with the first egg. Caspian terns have 1 brood yearly. Incubation is from 25 to 28 days and fledging occurs 37 days after hatching. Most individuals don't breed until they are 3 years old, although some attempt breeding in their 2nd year.

Breeding interval: Caspian terns breed once yearly.

Breeding season: Caspian terns breed in late May or June.

Range eggs per season: 1 to 3.

Range time to hatching: 25 to 28 days.

Average fledging age: 37 days.

Range age at sexual or reproductive maturity (female): 2 (low) years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 3 years.

Both parents incubate the eggs and alternate frequently throughout the day. A parent will relieve the other by bringing and offering a fish. Then the incubating parent takes the fish and moves off the nest. Females tend to spend more time caring for eggs and young. Parents protect their young from heat by standing above them to provide shade. Young hatch in the order they were laid and are semiprecocial when hatched, with downy feathers and reliant on the parents for feeding. They remain in or near the nest for about a week after hatching. They are fed fish by parents soon after hatching and they begin to accompany parents on foraging trips within a week or so of fledging. Caspian terns have the longest period of dependency of any tern species.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Along the U.S. mid-Atlantic coast, nesting begins by late May or early June. Clutch size usually is 2-3. Incubation, by both sexes, lasts 20-22 days. Young are tended by both parents, leave nest in a few days, first fly at 4-5 weeks. Parental care (feeding) may extend up to 5-7 months after fledging. Nests singly or usually in colonies of up to several thousand pairs (5000+ at Sand Island, Washington).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydroprogne caspia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTCTCATCAAACCACAAAGATATCGGCACCTTATACCTAATTTTCGGTGCATGAGCTGGCATAGTAGGCACCGCCCTTAGCCTGCTCATTCGTGCAGAACTAGGTCAACCAGGAACCCTCCTAGGAGACGACCAAATCTATAATGTAATCGTCACTGCCCATGCCTTCGTAATAATTTTCTTCATAGTGATACCTATCATAATCGGGGGTTTCGGAAACTGATTAGTTCCACTTATAATTGGTGCCCCGGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCGTTCCTACTTCTCCTAGCCTCCTCCACAGTAGAAGCTGGGGCAGGTACAGGATGAACCGTATACCCTCCCCTAGCTGGCAACCTAGCCCATGCTGGAGCTTCAGTGGACTTGGCAATCTTCTCCCTCCATCTAGCAGGTATCTCATCTATCCTAGGTGCCATCAACTTTATCACTACAGCTATTAACATAAAACCCCCTGCCCTTTCACAATATCAGACCCCCCTATTTGTGTGATCTGTACTTATCACTGCCGTCCTATTACTACTCTCACTCCCAGTACTTGCTGCCGGCATCACTATACTGTTAACAGACCGAAACCTAAACACAACATTCTTTGACCCCGCTGGAGGTGGTGACCCCGTACTATATCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTATATATCTTAATCCTACCAGGCTTTGGAATTATCTCCCACGTCGTAGCATACTACGCAGGTAAAAAAGAACCATTTGGTTACATAGGAATAGTGTGAGCCATATTATCCATCGGATTCTTAGGTTTCATTGTATGAGCCCATCACATATTCACAGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hydroprogne caspia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Caspian tern populations have declined in some parts of their range, especially in Europe and Africa where some populations have gone extinct. Populations in North America have increased because measures were taken to protect breeding areas and habitat. They are considered threatened in some states, including Michigan. They are considered "least concern" by the IUCN Red List because of their large geographic range and population sizes.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caspian tern populations have declined in some parts of their range, especially in Europe and Africa where some populations have been extirpated. Populations in North America have largely increased because of measures taken to protect breeding areas and habitat. However, they are considered threatened in some states, including Michigan. They are considered "least concern" by the IUCN Red List because of their large geographic range and population sizes.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: threatened

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range, increasing numbers in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is currently threatened by the loss and deterioration of breeding habitat through accelerated vegetation succession (possibly through the introduction of exotic plant species)10 and may be threatened in the future by habitat loss through inundation as a result of sea-level rise10. The species is vulnerable to human disturbance at nesting colonies8 especially during the early-courtship and incubation periods10, and exposure to bioaccumulated contaminants (e.g. organochlorines or methylmercury) in fish could be lowering the species's reproductive success1. Newcastle disease7, 10 and avian botulism may also threaten concentrated local populations (although these diseases are unlikely to threaten the global population as a whole)10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Disturbance and development of nesting habitat are major threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Nesting sites can be augmented by providing artificially created ones (see GHABCOM).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Protection of nesting habitat is a major concern.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Caspian terns on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Caspian tern eggs were once collected for food. They are colorful and fascinating members of native coastal faunas worldwide.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Caspian terns on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Caspian tern eggs were once collected for food. They are colorful and fascinating members of native coastal faunas worldwide.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Caspian Tern

The Caspian Tern (Hydroprogne caspia, formerly Sterna caspia;[1] syn. Hydroprogne tschegrava, Helopus caspius) is a species of tern, with a subcosmopolitan but scattered distribution. Despite its extensive range, it is monotypic of its genus, and has no subspecies accepted either.[2] In New Zealand it is also known by the Maori name Taranui.

Contents

Description [edit]

It is the world's largest tern with a length of 48–60 cm (19–24 in), a wingspan of 127–145 cm (50–57 in) and a weight of 530–782 g (19–27.6 oz).[2][3] Adult birds have black legs, and a long thick red-orange bill with a small black tip. They have a white head with a black cap and white neck, belly and tail. The upper wings and back are pale grey; the underwings are pale with dark primary feathers. In flight, the tail is less forked than other terns and wing tips black on the underside.[2] In winter, the black cap is still present (unlike many other terns), but with some white streaking on the forehead. The call is a loud heron-like croak.[4]

Distribution and habitat [edit]

Their breeding habitat is large lakes and ocean coasts in North America (including the Great Lakes), and locally in Europe (mainly around the Baltic Sea and Black Sea), Asia, Africa, and Australasia (Australia and New Zealand). North American birds migrate to southern coasts, the West Indies and northernmost South America. European and Asian birds spend the non-breeding season in the Old World tropics. African and Australasian birds are resident or disperse over short distances.[2]

The global population is about 50,000 pairs; numbers in most regions are stable, but the Baltic Sea population (1400–1475 pairs in the early 1990s) is declining and of conservation concern.[2][5]

The Caspian Tern is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Behaviour [edit]

Feeding [edit]

They feed mainly on fish, which they dive for, hovering high over the water and then plunging. They also occasionally eat large insects, the young and eggs of other birds and rodents. They may fly up to 60 km from the breeding colony to catch fish; it often fishes on freshwater lakes as well as at sea.[2][4]

Breeding [edit]

Breeding is in spring and summer, with one to three pale blue green eggs, with heavy brown spotting, being laid. They nest either together in colonies, or singly in mixed colonies of other tern and gull species. The nest is on the ground among gravel and sand, or sometimes on vegetation; incubation lasts for 26–28 days. The chicks are variable in plumage pattern, from pale creamy to darker grey-brown; this variation assists adults in recognizing their own chicks when returning to the colony from feeding trips. Fledging occurs after 35–45 days.[2]

References [edit]

  1. ^ Bridge, E. S., Jones, A. W., & Baker, A. J. (2005). A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: implications for taxonomy and plumage evolution. Molecular Phylogenetics and Evolution 35: 459–469. PDF pdf file
  2. ^ a b c d e f g del Hoyo J., Elliott, A., & Sargatal, J., eds. (1996). Handbook of the Birds of the World 3: 645. Lynx Edicions ISBN 84-87334-20-2.
  3. ^ [1]
  4. ^ a b Mullarney, K., Svensson, L., Zetterström, D., & Grant, P. J. (1999). Collins Bird Guide. Collins ISBN 0-00-219728-6.
  5. ^ Snow, D. W., & Perrins, C. M. (1998). The Birds of the Western Palearctic Concise Edition OUP ISBN 0-19-854099-X.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly (AOU 1983, 1998) included in the genus Sterna but separated on the basis of genetic data that correspond to plumage patterns (Bridge et al. 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!