Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Sternula antillarum

A small (9 inches) tern, the Least Tern in summer is most easily identified by its black cap and white forehead, deeply-forked tail, black-tipped yellow bill, and dark wing tips. In winter, this species becomes duller on the head and face, becoming dark-billed and pale headed while retaining black eye-patches connected to a dull black hood. This species’ small size and yellow bill help distinguish it from other tern species occurring in its range. Male and female Least Terns are similar to one another in all seasons. The Least Tern breeds along coasts and large rivers across the United States. In winter, birds breeding in the U.S.spend the winter from Mexico south to southern South America. Other populations breed in Mexico, Central America, and parts of the Caribbean, many of which are non-migratory. Least Terns primarily breed sandy beaches, islands, and mud flats. In winter, this species may be found along beaches or in near-shore waters. Least Terns mainly eat small fish, but may eat small invertebrates, primarily crustaceans, as they become available. Least Terns may be most easily seen standing or walking along the shore or on the beach, where their dark wing tips and (in summer) yellow bill may be most apparent. With the aid of binoculars, it may also be possible to observe this species feeding by diving headfirst into the water. Least Terns are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Pacific coast, central California to southern Baja California and Chiapas (Garcia and Ceballos 1995); since 1970, most nesting has occurred from Santa Barbara to San Diego County, California. Interior U.S.: locally along the Colorado, Red, Arkansas, Missouri, Ohio, and Mississippi river systems; formerly more widespread and common; has been eliminated from much of former habitat; now breeds locally in this region, north to Montana and North Dakota, east to southwestern Indiana, central Kentucky, and western Tennessee, west to eastern Colorado. Atlantic-Gulf coast: Maine south to Florida and west to Tamaulipas, coast of Yucatan Peninsula, and in West Indies (Bahamas [Sprunt 1984], Greater and Lesser Antilles [van Halewyn and Norton 1984]); islands off coast of Belize, Honduras, and Venezuela; and Bermuda (Thompson 1995, AOU 1998). About 2/3 of world population breeds in the southeastern U.S.; largest colony is at Gulfport, Mississippi (Clapp and Buckley 1984). NON-BREEDING: regularly along Pacific coast from southern Mexico to Peru and eastern coasts of Mexico, Central America, and South America to Brazil and northern Argentina (Thompson et al. 1997, AOU 1998). May remain in wintering areas during first year (Thompson et al. 1995). Casual in Hawaii (Whitman 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Least Tern breeds along almost the entire coast of North America, excluding Alaska and Canada, on the northern coast of Central America and locally on the northern coast of South America. It also breeds inland along rivers in central North America. It is migratory, wintering on the southern coast of Central America, and the northern and Atlantic coast of South America as far south as central Brazil (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic, Pacific, and Gulf coasts of North America, into interior along major river systems.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 23 cm

Weight: 43 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 22.5 cm, Wingspan: 50 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from other sympatric terns in being much smaller (averages 23 cm long vs. 37 cm in common tern [STERNA HIRUNDO]). No other sympatric tern has, in breeding plumage, a combination of a white forehead, yellowish legs, and pale gray mantle. In winter plumage, differs from winter Forster's tern (STERNA FORSTERI) in being much smaller, differs from winter black tern (CHLIDONIAS NIGER) in having yellowish feet and legs (dark in the black tern).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: BREEDING: Seacoasts, beaches, bays, estuaries, lagoons, lakes, and rivers (AOU 1983). Rests and loafs on sandy beaches, mudflats, and salt-pond dikes (Stiles and Skutch 1989). In California, may roost at night on sandy beaches away from nesting areas for several weeks before nesting. Nests usually in shallow depression on level ground on sandy or gravelly beaches and banks of rivers or lakes, typically in areas with sparse or no vegetation (usually less than 20% vegetation cover, often 10% or less; Bent 1921, Craig 1971, Jernigan et al. 1978, Thompson and Slack 1982, Faanes 1983, Gochfeld 1983, USFWS 1990); also on dredge spoils; on mainland or on barrier island beaches; and on flat gravel-covered rooftops of buildings (especially in the southeastern U.S.) or other similarly barren artificial sites (AOU 1983). Good nesting areas tend to be well beyond the high tide mark, have shell particles/stones/debris for egg camouflage (Burger and Gochfeld 1990), be out of the way of off-road vehicles and public recreation areas, not subject to unusual predation pressure, and adjacent to plentiful sources of small fishes. Colonies on small islands usually experience less mammalian predation (Burger 1984). Good roof-top sites provide some shade for chicks.

Adults do not require cover during the breeding season, but chicks may use sparse vegetation and debris for shade and protection (Hardy 1957, Blodgett 1978). Parents may lead chicks toward the periphery of the colony into more heavily vegetated areas (Akers 1975), where the young utilize debris and vegetation for cover (Hardy 1957). In coastal areas, beach grass (AMMOPHILA BREVILIGULATA) is the commonly associated vegetation. Along river systems, willow (SALIX spp.) is the common vegetation adjacent to sites (Sidle, pers. comm.). On Oklahoma salt flats, almost 60% of the nests were within 5 cm of debris (Grover and Knopf 1982).

Interior populations nest mainly on riverine sandbars or salt flats that become exposed during periods of low water (Hardy 1957). As a result of vegetational succession and/or erosion, preferred nesting habitat typically is ephemeral. Hardy (1957) implied that breeding in riverine situations depends on the presence of sandbars, favorable water levels during nesting season, and sufficient food. Nests are usually located at higher elevations and away from the water. Water levels determine the size of sand bars and the extent of nesting areas (USFWS 1990). Dams above colonies generally lower habitat quality by eliminating the spring floods that are necessary for alluvium deposition and the scouring of vegetation. Ducey (1982) reported successful breeding at two privately-owned sand and gravel companies along the Platte River in Nebraska. As old breeding sites became unsuitable due to vegetation encroachment, the terns simply moved to more recently created sand deposits. See also Ziewitz et al. (1992) for information on nesting habitat in the Platte River in Nebraska. Populations in Kansas have nested on oil well sites (Schulenberg and Ptacek 1984).

Since least terns always nest near water, they are vulnerable to flood inundation and seem to seek high ground. In coastal Texas, Thompson and Slack (1982) documented that the densest nesting area in 67% of the colonies was above the midpoint of available elevations. Gochfeld (1983) found that terns on Long Island avoid beaches that have less than 32.8 feet (10 m) of width beyond the hightide mark. Interior least tern nests on salt plains in Oklahoma were located an average of 110.5 m away from the nearest water (Grover and Knopf 1982). However, nests on the Platte River in Nebraska, were located at an average of 18.9 m away from the nearest river channel on sand bars that averaged 58.9 m wide (Faanes 1983).

NON-BREEDING: flocks have been found at sea, often far from land, in southeastern Caribbean and adjacent Atlantic off Guianas (van Halewyn and Norton 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species can be found on lakes, rivers and estuaries, strictly on the coast in some regions (e.g. California) but inland in others (e.g. Florida). It feeds on small fish fry, shrimps, marine worms and occasionally flying ants and other insects. Prey are usually caught by plunge-diving up to 10m, preceeded by prolonged hovering, and it also occasionally peforms surface-dipping and aerial hawking. The breeding season begins between April and mid-June depending on locality, and it breeds in a large variety of habitats, from baren sandy beaches to parking lots and roof tops. Individuals form colonies usually between 5 and 200 pairs strong. It is a highly migratory species, though some populations in the north of South America, and on the Pacific coast of Mexico may be year-round residents (del Hoyo et al. 1996).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 65 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 24.203 - 27.711
  Nitrate (umol/L): 0.253 - 1.328
  Salinity (PPS): 33.535 - 35.931
  Oxygen (ml/l): 4.463 - 4.982
  Phosphate (umol/l): 0.056 - 0.385
  Silicate (umol/l): 0.936 - 3.015

Graphical representation

Temperature range (°C): 24.203 - 27.711

Nitrate (umol/L): 0.253 - 1.328

Salinity (PPS): 33.535 - 35.931

Oxygen (ml/l): 4.463 - 4.982

Phosphate (umol/l): 0.056 - 0.385

Silicate (umol/l): 0.936 - 3.015
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Saltwater beaches, bays, and salt flats, also along large rivers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeders from the U.S. Atlantic coast migrate through the Caribbean region (van Halewyn and Norton 1984). Arrives in northeastern U.S. mainly in May; departs in August or generally not later than mid-September (Bull 1974, Dorr 1976).

Arrives in northern breeding areas on west coast mostly in April; most have departed for south by November (or as early as August); wintering area is unknown but probably is in western Mexico.

Wintering area for the breeding population in the interior U.S. is unknown (perhaps coastal Central America/northern South America?) (Matthews and Moseley 1990). Most arrive in Iowa/Nebraska in May.

Migrates in Costa Rica late-August to late October, and April (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Moves south to tropical waters in winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly small fishes (generally less than 9 cm long), sometimes crustaceans or insects, obtained by diving from air into shallow water usually less than 4 m deep (Moseley 1976). Interior populations depend almost entirely on cyprinids. Feeding in newly plowed fields has been observed in Texas; apparently beetle larvae were being captured (McDaniel and McDaniel, 1963, Auk 80:544).

When breeding, usually forages within a few hundred meters of colony, but occoasionally up to 3-12 kilometers away (summarized by Thompson et al. 1997). Coastal breeding populations may forage in marine, estuarine, or nearby freshwater habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mainly feeds on fish, crustaceans and insects, including some mollusks and marine worms when necessary.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Widely distributed, but difficult to estimate because nesting habitat is ephemeral and nesting sites may change location from year to year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Gulf and Atlantic coast populations included about 43,000 breeding birds in the mid-1980s (USFWS 1987). Atlantic coast population from Maine to Virginia was 9341 breeding pairs in 1986 (Engstrom et al. 1990). Long Island (New York) population was about 2500-3600 pairs in 47-59 colonies in the mid-1980s (MacLean et al. 1991). In the Florida Keys in the late 1980s, there were 37 colonies on 16 keys. Interior population was about 5000 pairs in 1990 (USFWS), estimated at 6,833 birds [pairs?] in 1991 (Kirsch and Sidle 1994). California population was about 1700 pairs in 1992 (Massey, pers. comm. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In California, usually nests in same area in successive years; tends to return to natal site to nest (Atwood and Massey 1988). On Long Island, New York, tends to nest in same area in successive years if physical conditions are conducive to nesting (MacLean et al. 1991).

NON-BREEDING: usually singly or in small loose groups; in larger flocks when migrating. Foraging may occur singly, in pairs, or in small flocks (Erwin 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Courtship behavior includes chases, vocalizations, and sometimes presentation of a fish to the female by the male. Lays eggs mostly in May-June (July-August nests probably are renests). Renesting may occur after egg loss associated with heavy rains and/or flooding (Jernigan et al. 1978, Blus and Prouty 1979). Clutch size usually is 2-3 (most often 2 in California, New York, and Mississippi), rarely up to 4-5 (Hardy 1957, Swickard 1974, Houde 1977, Hays 1980, Faanes 1983). Incubation usually lasts 20-25 days (also reported as 21-22 days), by both sexes but mostly by female. Hatching success varies greatly and is affected by factors such as weather, tides, predation, and human disturbance; may be high under optimal conditions. Young are tended by both parents, leave nest after a few days, brooded for several days, fly at about 3-4 weeks, dependent for a few weeks more. Reproductive success rarely exceeds one chick per pair (Kress et al. 1983). First breeds generally when about one year old, sometimes not until two years old (Massey and Atwood 1981). Maximum known natural longevity 21 years (Massey and Atwood 1978, Clapp et al. 1982). In recent years, colonies generally have included not more than 20 pairs, sometimes up to about 75 pairs (Ehrlich et al. 1992), rarely up to several hundred pairs. Colony may be divided into subcolonies (Massey 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nest is built on open ground among colony usually. 1-3 eggs, incubated by both partners for 20-25 days. Young are fed by both parents. Capable of flight around 19-20 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sternula antillarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAACCGATGACTATTTTCAACAAACCACAAAGATATCGGCACTCTATACTTAATTTTCGGCGCATGAGCTGGTATAGTAGGTACTGCTCTTAGCTTACTTATTCGTGCAGAACTGGGTCAACCAGGAACTCTCCTAGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCCATCATAATTGGTGGCTTCGGAAACTGACTAGTACCTCTCATAATTGGTGCCCCCGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGCTGCCCCCATCATTCTTACTCCTCCTAGCCTCTTCCACCGTAGAAGCTGGAGTAGGTACAGGATGAACCGTATATCCTCCCCTAGCTGGCAATCTAGCCCATGCTGGAGCTTCAGTAGACTTAGCAATCTTCTCCCTTCATCTAGCAGGTGTATCTTCCATCCTAGGTGCTATTAATTTCATCACCACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCTCTGTTCGTATGATCTGTACTCATCACTGCTGTCCTACTACTACTCTCACTCCCAGTGCTCGCCGCTGGCATTACCATGTTATTAACAGACCGAAACCTAAACACAACATTCTTCGACCCTGCTGGAGGTGGTGACCCTGTGTTATACCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTATATATTTTAATCCTACCAGGCTTTGGCATCATCTCCCACGTCGTAACATACTATGCAGGTAAGAAAGAACCATTTGGCTACATAGGAATAGTATGAGCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sternula antillarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4B - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widely distributed, but numbers are reduced and/or declining in some areas. Nesting colonies are sensitive to disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endangered in several parts of its range, probably due to human impact in nesting areas (beaches).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: North American Breeding Bird Survey (BBS) data indicate a significant decline in North America, 1978-1988 (Sauer and Droege 1992). Gulf and Atlantic coast populations apparently were stable in the mid-1980s (USFWS 1987). Atlantic coast population from Maine to Virginia apparently increased from 6740 breeding pairs in 1977 to 9341 pairs in 1986; however, the increase may have been caused in part by improved and expanded monitoring efforts; colonies with population decreases outnumbered colonies with increases 166 to 106 (Engstrom et al. 1990). In Massachusetts, increased from 1000+ pairs in 1974 to over 2415 pairs in 1984, due mainly to active management (Blodgett, pers. comm.). As of the early 1990s, populations in Massachusetts and Long Island (New York) appeared to be relatively stable (Raithel, pers. comm.). In Florida, Gulf Coast population increased from 250 pairs in two colonies in 1983 to 1012 pairs in eight colonies in 1990 (Gore 1991). Populations in the Florida Keys were stable from the mid-1970s through the 1980s (Hovis and Robson 1989). Interior population declined through at least the early 1980s; decline has taken place over many decades. Many populations are not fledging enough young to successfully increase local populations, but there appears to be immigration from Gulf populations and a good deal of movement among interior populations. Local populations fluctuate substantially (Kirsch and Sidle 1994). USFWS (1990) categorized the status of the interior population as "improving." California population has responded well to management, and populations are continuing to increase; population increased from 600 pairs in 1970 to 1700 pairs in 1992 (Massey, pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Populations were decreased greatly by formerly extensive plume hunting. Current major problems are human use and development of nesting habitat and predation on adults, eggs, and young by birds and mammals (see Burger and Gochfeld 1990). Some habitat is lost due to encroachment of vegetation, but this may be offset by habitat created when storm overwash removes vegetation from portions of barrier beaches or creates overwash fans of sandy/gravelly substrate. Storms during spring tides sometimes wash out nests. Replacement of gravel-covered roofs by plastic-covered roofs, together with increasing human use of beaches, may seriously limit the availability of productive nesting sites in the southeastern U.S. (Gore and Kinnison 1991). Birds and mammals prey on eggs and young, and ants may prey on young in pipped eggs and on newly hatched young (Moseley 1976). Ghost crabs (OCYPODE QUADRATA) may be important predators of eggs and chicks in South Carolina (Blus and Prouty 1979). Other predators in various regions include coyote (CANIS LATRANS), red fox (VULPES VULPES), mink, weasels, raccoon (PROCYON LOTOR), striped skunk (MEPHITIS MEPHITIS), opossum (DIDELPHIS VIRGINIANA), domestic cats and dogs, feral hogs (SUS SCROFA), Norway rat, black rat, various gulls, night-herons, American kestrel (FALCO SPARVERIUS), northern harrier (CIRCUS CYANEUS) red-shouldered hawk (BUTEO LINEATUS), fish crow (CORVUS OSSIFRAGUS), and grackles (Whitman 1988, Burger and Gochfeld 1990, Thompson et al. 1997). In New Jersey, Burger (1984) found that mainland colonies with over 80 birds suffer more from predators than colonies with fewer than 80 birds, perhaps because the former are large enough to make their presence known to predators. Larger colonies may incur greater losses to predation than do smaller colonies because the former are more stable and hence known to predators (Burger 1984). On two South Carolina barrier islands, harsh weather was the primary cause of unsuccessful nesting (Cowgill 1989). Bird banding, photography, and other activities that cause young to scatter or keep adults away from nests for substantial periods of time may result in increased mortality (Zickefoose 1985). Wayward young may be attacked by nonparental adults. Exposed eggs or young may succumb to overheating and be subject to increased predation. Potential threats include chemical spills and pesticide or heavy metal pollution. Decline of interior nesting populations has been coincident with human modification of river flow (e.g., reduction of spring floods by dams) and bank stabilization and channelization, resulting in reduced availability of bare island/sandbar nesting habitat; loss of aquatic habitat diversity and resulting changes in fish species composition and abundance also may have contributed to the reduced tern population (Figg 1993). Desalination projects may reduce shallow water fish populations and thus decrease tern food resources (Schulenberg and Ptacek 1984). In arid regions, irrigation may be a threat by lowering water levels/flows and reducing river areas when terns are breeding (Schulenberg and Ptacek 1984). Grazing cattle may trampled eggs (Schulenberg and Ptacek 1984). Heavy rains and other severe weather have resulted in significant nesting losses along the Cimarron River in Kansas and on salt plains in Oklahoma (Grover and Knopf 1982). Colonies reduced by severe weather may incur increased predation (Schulenberg and Ptacek 1984). Interior populations nest mainly on riverine sandbars or salt flats that become exposed during periods of low water (Hardy 1957). As a result of vegetational succession and/or erosion, preferred nesting habitat typically is ephemeral. Hardy (1957) implied that breeding in riverine situations depends on the presence of sandbars, favorable water levels during nesting season, and sufficient food. Nests are usually located at higher elevations and away from the water. Water levels determine the size of sand bars and the extent of nesting areas (USFWS 1990). Dams above colonies generally lower habitat quality by eliminating the spring floods that are necessary for alluvium deposition and the scouring of vegetation. Ducey (1982) reported successful breeding at two privately-owned sand and gravel companies along the Platte River in Nebraska. As old breeding sites became unsuitable due to vegetation encroachment, the terns simply moved to more recently created sand deposits. See also Ziewitz et al. (1992) for information on nesting habitat in the Platte River in Nebraska. Populations in Kansas have nested on oil well sites (Schulenberg and Ptacek 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Recent population trends and the tern's ability to relocate due to habitat disturbance or succession indicate the potential for recovery from low population numbers. In Massachusetts, population increases in the 1970s and 1980s were attributed to active management (Blodgett, pers. comm.). The ability of terns to seek alternative colony sites (e.g., roof tops and dredge spoils) is an asset to its recovery. New nesting habitat can be created with dredge spoils (Whitman 1988). New nesting islands have been created in the Platte River in Nebraska (1991, End. Sp. Tech. Bull. 16[5]:14). Islands made from dredge spoils, if isolated from terrestrial predators and human disturbance, have good potential for successful tern reproduction. Expanding populations along the Gulf coast of Florida in the 1980s made use of artificial nesting substrates. Twenty percent of the colonies were on dredged material, land cleared for construction, or other altered habitat, and 56% were on roof tops (Gore 1991). Fifty-nine percent of the colonies in the Florida Keys were on dredge spoils, and 38% on rooftops. Dredge spoil islands are often excellent locations for colonies, exhibiting habitat characteristics that attract terns. However, the substrate composition of dredge spoil has presented problems in Texas. Natural sites largely consist of sand and shell fragments and less than 10% silt and clay. Most dredge-spoil deposition sites are composed of a mix of a variety of particles and greater than 45% silt and clay. The fine silts and clay in some dredge spoil sites sometimes promote "egg sticking" which occurs during wet periods and causes egg loss. These "artificial" substrates contain sufficient sand to stimulate terns to select the site for nesting, but the finer texture of the silt particles reduces drainage (Thompson and Slack 1982). Furthermore, dredge spoil sites are short-lived and typically undergo rapid succession Burger 1984).

Increases in the California least tern population in recent decades followed listing as an endangered species and active management (USFWS 1984); this subspecies has a strong recovery potential in California with ongoing management.

Conservation recovery plans and the requirement of hydrologic project review should aid in the population recovery of interior populations. In at least one instance, a hydro project actually aided tern recovery: the Arcadia Diversion in Oklahoma caused the formation of sandbars and facilitated renewed tern nesting (USFWS 1984).

The recovery goal for the interior subspecies is as follows (USFWS 1990): (1) Adult birds in the Missouri River system will increase to 2,100 and remain stable for 10 years. (2) Current numbers of adults birds (2,200-2,500) on the lower Mississippi River will remain stable for 10 years. (3) Adult birds in the Arkansas River system will increase to 1,600 and remain stable for 10 years. (4) Adult birds in the Red River system will increase to 300 and remain stable for 10 years. (5) Current numbers of adult birds in the Rio Grande system (500) will remain stable for 10 years.

To mitigate the effects of disturbance, predation, and flooding, decoys with recorded least tern vocalizations have been used as attractants to stimulate least tern colonization at alternative nesting sites (Kotliar and Burger 1984). Decoys have potential to be instrumental in reestablishing colonies and establishing new colonies. Arbuckle (1983) was able to relocate one out of two least tern colonies using decoys. In California, decoys have been successfully used to attract least terns to newly created sites (Massey 1981).

Management Requirements: Least terns need protection through management against the effects of human disturbance, predation, vegetative encroachment, loss of habitat, flooding and foul weather. Terns nesting on publicly owned areas are vulnerable to the effects of public recreational use. The following commonly utilized management procedures, used in combination, are effective in eliminating the majority of disturbances. (1) Psychological fencing. This protective fencing is constructed of fence posts connected by two strands of bailing twine; one strand is near the top of the fence post and the other is in the middle (Caljouw, pers. comm.). If possible, the fence should be placed at least 50 m outside of colony nests. For coastal nesting populations, Buckley and Buckley (1976) suggest restriction of foot travel within 1000 feet of any active colony. Blodgett (1978) suggested a 50 meter distance between a protective fence and actual nests, and a 70 meter distance between ORV trails and nests. In order to solve the problem of maintaining a fence that was high enough to avoid tidal washout, yet low enough on the beach to act as a buffer between terns and people, Maine Audubon erected a double row of fencing; an original buffer zone fence was erected, and then a stake and twine fence with signs a distance away from the inner fence. This system, designed according to the architecture of the beach, proved effective. (2) An education campaign. This would include brochures and media coverage in the local newspapers and on TV stations, as well as signs on fence posts that inform the public about the tern. Wardens may be hired to patrol the area, answer questions, and enforce restrictions when necessary. In instances where a beach is narrow and does not allow for a safe distance between nests and fencing, signs with bold print should be erected, so as not to attract people to the signs near the nests (Caljouw, pers. comm.). (3) ORV traffic lanes at least 20 m from fencing boundary (Blodgett 1978). (4) Strict dog and cat leash laws (Blodgett 1978). Systematic removal of feral cats. (5) A sufficient number of maintained garbage cans for the disposal of predator-attracting trash.

Predation by large mammals, rats, and avian birds takes a heavy toll on least tern colonies. Large mammals can be trapped or excluded by snow fencing, chicken wire, or electric fence (Minsky 1980). The electric fence tends to short circuit on vegetation and requires maintenance. At Gooserocks beach in Maine, where cat tracks were noted near the colony, "Kitty Rope" was erected to deter cat predation. No cat predation occurred during the single season of use of Kitty Rope at this site (Arbuckle, pers. comm.). Rat control can be accomplished by fumigating their burrows (Kotliar 1984). In order to protect chicks from avian predation by kestrels and harriers, Jenks (1980) devised a chick shelter constructed with 11 wooden snow fence slats wired together into a conical shape. On Nantucket Island, Massachusetts, where such shelters were used, chicks sought refuge in them in during instances of disturbances by humans or dogs. In addition to providing protection for chicks, the shelters also provide necessary shade.

Vegetation encroachment degrades least tern habitat. Along river systems, growing willow species destroy nesting grounds. On the Platte river, these trees are mechanically removed with a bushog (Sidle, pers. comm.). Buckley and Buckley (1976) note that fire is a potential management tool which has been infrequently used, largely because its natural occurrence and significance has not been investigated in mid-western locations. Site specific historical and ecological investigations should be conducted preceding its use. Soots and Landin (1978) note that annual species rapidly colonize burned areas. In many areas vegetation is removed by hand. Addition of dredge spoils on spoil and vegetated beach areas may impede succession (Soots and Landin 1978). However it is important that the substrate not be too silty in order to avoid the egg stick syndrome. A deposition with over 20% shells could interfere with nest construction (Kotliar 1984).

Storms and foul weather can impact a chick population through cold winds and wetness. Adults cannot bring back food during heavy storms. On beaches devoid of vegetation, the provision of shrubs and driftwood can provide important shelter from a storm (Haddon and Knight 1983). Grover and Knopf (1982) compared the number of nesting interior least terns between two types of experimental plots, one with no debris and one with double the average amount of debris. They found no difference between them. However, this experiment was marred by low sample sizes and heavy flooding. Adding debris may increase the attractiveness of a sandbar to breeding terns.

Management techniques that may be effective in reducing the impact of high water include raising nests on shingle and sand-filled boxes, moving nests to higher ground, and collecting eggs for the duration of floods (Haddon and Knight 1983). Another technique involves using concrete manhole pipes, sand bags, rubble, shingle, searlewave screens, and stakes to actually raise the island (Haddon and Knight 1983). Although these techniques are highly intensive and require many man-hours, they save eggs and/or nests that otherwise would be flooded. Arbuckle (1983) believed the potential for successfully moving nests to avoid tidal losses, or vehicle/pedestrian traffic is great. In Maine, adults showed high fidelity to nests and chicks by returning to nest sites after leaving for several hours during adverse conditions. They also searched for and began brooding eggs that were neither their own or in the same location, but were in the same vicinity. In egg movement experiments, after eggs had been moved 10 feet from the original scrapes, the incubating adult returned to the original nest, and then flew off, attacking the observer, unaware of the new nest location (Arbuckle 1984). When eggs were moved to within 7 feet and then 5 feet of the original location, this behavior was repeated until the birds resumed incubation. All terns settled down within six minutes of the time that their eggs were moved to the final location. Sixty-four per cent of the birds settled on their eggs at a distance of 5 feet from the original nest and eighteen percent settled at 7 feet. Another eighteen percent of the birds would not incubate again until the eggs were moved back to the original location. No nests were deserted.

In Kansas, management plans have been formulated to compensate for habitat loss on river systems by using sand to construct raised nesting sites above high water levels (Schulenberg and Ptacek 1984). Ziewitz et al. (1992) recommended the creation of sandbars to provide suitable nesting substrate in the Platte River in Nebraska.

Fencing can be erected to prevent chicks from falling off gravel roof nesting areas (Hovis and Robson 1989, Gore 1991).

Biological Research Needs: Winter range needs to be delineated and characterized. Accurate estimates of post-fledging survival rates are needed to help assess population trends (Kirsch and Sidle 1994). Research is also needed on the amount of interchange between interior and Gulf populations. Potential problems associated with pesticide and heavy metal accumulation should be examined (Williams, pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected by private land owners and on some national seashores by fencing. Endangered species (F.R. 5/28/85).

Needs: It is important to protect actual and potential habitat, not just previous nesting sites; colonies tend to shift with vegetational encroachment and other changes. Habitat should be maintained throughout the range to ensure that birds can nest somewhere when conditions in certain areas are poor (e.g., Midwest flooding in 1993) (Kirsch and Sidle 1994).

River systems should be protected from dams and other hydrological developments; river flows must be protected to create and isolate breeding habitat. Shallow water feeding grounds should also be protected. Active colonies need to be protected from human intrusion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Protect occurrences by managing against the effects of human disturbance, predation, and vegetation encroachment. Review future hydrology projects along river systems. Protect prime habitat and experiment with artificial habitat. Locate roof top colonies, and inform building owners.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Least tern

The least tern (Sternula antillarum, formerly Sterna antillarum) is a species of tern that breeds in North America and locally in northern South America. It is closely related to, and was formerly often considered conspecific with, the little tern of the Old World. Other close relatives include the yellow-billed tern and Peruvian tern, both from South America.

It is a small tern, 22–24 cm long, with a wingspan of 50 cm, and weighing 39–52 g. The upper parts are a fairly uniform pale gray, and the underparts white. The head is white, with a black cap and line through the eye to the base of the bill, and a small white forehead patch above the bill; in winter, the white forehead is more extensive, with a smaller and less sharply defined black cap. The bill is yellow with a small black tip in summer, all blackish in winter. The legs are yellowish. The wings are mostly pale gray, but with conspicuous black markings on their outermost primaries. In behavior, it flies over water with fast, jerky wingbeats and a distinctive hunchback appearance, with the bill pointing slightly downward.

It is migratory, wintering in Central America, the Caribbean and northern South America. Many spend their whole first year in their wintering area.[2] It has occurred as a vagrant to Europe, with one record in Great Britain.

It differs from the little tern mainly in that its rump and tail are gray, not white, and it has a different, more squeaking call; from the yellow-billed tern in being paler gray above and having a black tip to the bill; and from Peruvian Tern in being paler gray above and white (not pale gray) below and having a shorter black tip to the bill.

Subspecies[edit]

The differences among the three subspecies may not be as much as had been thought. [3][4]

Parent feeding a small chick in Florida, USA

Conservation and status[edit]

S. a. antillarum[edit]

The population is about 21,500 pairs; it is not currently considered federally threatened, though it is considered threatened in many of the states in which it breeds. Threats include egg and fledgling predators, high tides and recreational use of nesting beaches.

S. a. athalassos[edit]

The interior subspecies, with a current population of about 7000 pairs, was listed as an endangered subspecies in 1985 (estimated 1000 breeding pairs), due to loss of habitat caused by dams, reservoirs, channelization, and other changes to river systems.

S. a. brownii[edit]

The western population, the California least tern, was listed as an endangered species in 1972 with a population of about 600 pairs. With aggressive management, mainly by exclusion of humans via fencing, the Californian population has rebounded in recent years to about 4500 pairs, a marked increase from 582 pairs in 1974 when census work began, though it is still listed as an endangered subspecies. However, see Draheim et al. 2010, 2012.[10][11] The California subspecies breeds on beaches and bays of the Pacific Ocean within a very limited range of southern California, in San Francisco Bay and in northwestern Mexico. While numbers have gradually increased with its protected status, it is still vulnerable to predators, natural disasters or further disturbance by humans. Recent threats include the Gull-billed Tern ( Sterna nilotica), which can decrease reproductive success in a colony to less than 10%.[5]

Nesting and breeding behavior[edit]

The least tern arrives at its breeding grounds in late April. The breeding colonies are not dense and may appear along either marine or estuarine shores, or on sandbar islands in large rivers, in areas free from humans or predators. Courtship typically takes place removed from the nesting colony site, usually on an exposed tidal flat or beach. Only after courtship has confirmed mate selection does nesting begin by mid-May and is usually complete by mid-June. Nests are situated on barren to sparsely vegetated places near water, normally on sandy or gravelly substrates. In the southeastern United States, many breeding sites are on white gravel rooftops.[6] In the San Francisco Bay region, breeding typically takes place on abandoned salt flats. Where the surface is hard, this species may use an artificial indentation (such as a deep dried footprint) to form the nest basin.

The nest density may be as low as several per acre, but in San Diego County, densities of 200 nests per acre have been observed. Most commonly the clutch size is two or three, but it is not rare to consist of either one or four eggs. Both female and male incubate the eggs for a period of about three weeks, and both parents tend the semiprecocial young. Young birds can fly at age four weeks. After formation of the new families, groupings of birds may appear at lacustrine settings in proximity to the coast. Late-season nesting may be renests or the result of late arrivals. In any case, the bulk of the population has left the breeding grounds by the end of August.

Feeding and roosting characteristics[edit]

The least tern hunts primarily in shallow estuaries and lagoons, where smaller fishes are abundant. It hovers until spotting prey, and then plunges into the water without full submersion to extract meal. The most common prey recently for both chicks and adults are silversides smelt (Atherinops spp.) and anchovy (Anchoa spp.) in southern California,[7] as well as shiner perch, and small crustaceans elsewhere. Adults in southern California eat kelpfish [most likely Giant Kelpfish, Heterostichus rostratus].[7] Insects are known to be eaten during El Nino events.[8][9] In southern California, Least Terns feed in bays and lagoons, near shore, and > 24 km from shore in the open ocean. [7] Elsewhere, they feed in proximity to lagoons or bay mouths.

Adults do not require cover, so that they commonly roost and nest on the open ground. After young chicks are three days old, they are brooded less frequently by parents and require wind blocks and shade, and protection from predators. In some colonies in southern California, Spanish roof tiles are placed in colonies so chicks can hide there. Notable disruption of colonies can occur from predation by burrowing owls, gull-billed terns and American kestrels.[10] Depredation by domestic cats has been observed in at least one colony.[11] Predation on inland breeding terns by coyotes, bobcats, feral dogs and cats, great blue herons, Mississippi kites, and owls has also been documented (Jones 1997-2006).[12][13]

References[edit]

  1. ^ BirdLife International (2012). "Sterna antillarum". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Thompson, Bruce C., Jerome A. Jackson, Joannna Burger, Laura A. Hill, Eileen M. Kirsch and Jonathan L. Atwood. 1997. Least Tern (Sterna antillarum), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: doi:10.2173/bna.290
  3. ^ Draheim, H.; P. Baird; S. Haig (2012). "Temporal Analysis of mtDNA Variation Reveals Decreased Genetic Diversity in Least Terns". The Condor 114 (1): 145–154. doi:10.1525/cond.2012.110007. 
  4. ^ Draheim, H.; M. Miller; P. Baird; S. Haig (2010). "Subspecific Status and Population Genetic Structure ofLeast Terns (Sternula antillarum) Inferred by Mitochonrial DNA Control-Region Sequences and Microsatellite DNA". The Auk 127 (4): 807−819. doi:10.1525/auk.2010.09222. 
  5. ^ Marschalek, D. 2009. California Least Tern Breeding Survey 2009 Season. Unpubl.Rept. California Department of Fish and Game (CDFG).
  6. ^ BIOONE Online Journals - Roof-top Selection by Least Terns in Pinellas County, Florida
  7. ^ a b c Baird, P. 2009. "Foraging Study of California Least Terns in San Diego Bay and Near ocean Waters," Unpubl. Rept. U.S. Navy, San Diego California.
  8. ^ Baird, P., S. Hink, D. Robinette, V. Wawerchak 1997. "Monitoring of the Least Tern Colony during the X Games in Mission Bay Park, 1997." Unpubl. Rept. submitted to ESPN.
  9. ^ Baird, P., S. Hink, D. Robinette, V. Wawerchak. 1998. "Monitoring of the Least Tern Colony during the X Games in Mission Bay Park, 1998." Unpubl. Rept. submitted to ESPN.
  10. ^ L. Collins and S. Bailey, California least tern nesting season at Alameda Naval Air Station, 1980 Admin. Rep. 25pp.
  11. ^ California Wildlife, Volume II, Birds, ed, by David C. Zeiner, William F. Laudenslayer and Kenneth E. Meyer, published by the California Department of Fish and Game, Nov. 1988
  12. ^ Draheim, H.; P. Baird; S. Haig (2012). "Temporal Analysis of mtDNA Variation Reveals Decreased Genetic Diversity in Least Terns". The Condor 114 (1): 145–154. doi:10.1525/cond.2012.110007. 
  13. ^ Draheim, H.; M. Miller; P. Baird; S. Haig (2010). "Subspecific Status and Population Genetic Structure ofLeast Terns (Sternula antillarum) Inferred by Mitochonrial DNA Control-Region Sequences and Microsatellite DNA". The Auk 127 (4): 807−819. doi:10.1525/auk.2010.09222. 

Sources[edit]

  • National Geographic Society (2002): Field Guide to the Birds of North America. National Geographic, Washington DC. ISBN 0-7922-6877-6
  • Audubon Handbook: Western Birds (1988) McGraw Hill Book Company, ISBN 0-07-019977-9
  • Massey, B. (1974) Breeding Biology of the California least tern, Proceedings Linn. Society, New York 72:1-24
  • Gary Deghi, C. Michael Hogan, et al., Biological Assessment for the Proposed Tijuana/San Diego Joint International Wastewater Treatment Plant, Publication of the U.S. Environmental Protection Agency Region IX, Earth Metrics Incorporated, Burlingame, CA with Harvey and Stanley, Alviso, CA
  • Olsen and Larsson, Terns of Europe and North America ISBN 0-7136-4056-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly (AOU 1983, 1998) included in the genus Sterna but separated on the basis of genetic data that correspond to plumage patterns (Bridge et al. 2005).

Often has been considered conspecific with Old World S. albifrons (AOU 1983). Appears to constitute a superspecies with S. albifrons, S. superciliaris, S. lorata, and S. saundersi (AOU 1998). Massey (1976) evaluated morphological, vocal, and behavioral characteristics and concluded that nominal subspecies antillarum and browni are indistinguishable. Thompson et al. (1992) examined morphological and electrophoretic variation and found little evidence of differentiation among populations of the nominal subspecies antillarum, athalassos, and browni; they recommended that the subspecific taxonomy of the S. antillarum complex be reassessed. Johnson et al. (1998) used a quantitative colorimetry analysis to study variation among antillarum, athalassos, and browni and found differences significant enough to warrant the validity of the taxa and their importance as entities for conservation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!