Overview

Distribution

Range Description

Breeding populations of the Little Tern can be found through much of Europe, scattering along the coast and inland in parts of Africa, in much of western, central and the extreme east and south of Asia, and in northern parts of Australasia. Migratory individuals expand the range to include most of the coast of Africa, the Arabian Peninsula, the western coast of India and most of the waters of south-east Asia and Australasia, including New Zealand. One seasonally breeding colony is also present on Hawaii1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The Little Tern is a strongly migratory1 coastal seabird which usually fishes in very shallow water only a few centimetres deep, often over the advancing tideline or in brackish lagoons and saltmarsh creeks. It has the most inshore distribution of all terns. It breeds between May and July2 in solitary pairs3 or small monospecific groups1 usually of 1-15 pairs1,4 (rarely over 40 pairs)1 occasionally amidst colonies of other terns3. Breeding may be timed to coincide with peak fish abundance15. Northern breeders depart the breeding grounds from late-July onwards1,2, travelling first to moulting sites where they form large roosts before continuing southwards9. The species is gregarious throughout the year4 and usually feeds singly, in small groups or larger scattered flocks4 and congregating in many thousands on passage in small wetlands where fish fry are abundant1. Habitat Breeding The species breeds on barren or sparsely vegetated beaches, islands and spits of sand, shingle1, shell fragments, pebbles3, rocks or coral fragments1 on seashores3 or in estuaries, saltmarshes, saltpans, offshore coral reefs1, rivers, lakes1,3 and reservoirs6. It may also nest on dry mudflats in grassy areas1,6 but shows a preference for islets surrounded by saline or fresh water where small fish can be caught without the need for extensive foraging flights4. Non-breeding Outside of the breeding season the species frequents tidal creeks, coastal lagoons and saltpans and may foraging at sea1 up to 15 km offshore5. Diet Its diet consists predominantly of small fish (e.g. Ammodytes spp., roach Rutilus rutilus, rudd Scardinius erythrophthalmus, carp Cyprinus carpio and perch Perca fluviatilis) and crustaceans 3-6 cm long as well as insects, annelid worms and molluscs1. In Scotland, Little Terns feed mainly on small fish and invertebrates, including herring, sandeel, and shrimps (Crangon vulgaris)17. In Portugal, birds were found to feed mainly on sand-smelts (Atherina spp.) and gobies (Pomatoschistus spp.), which were the most abundant fish species in the study areas16. On Rigby Island, Australia, chicks were fed entirely on juvenile fish of the families Clupeidae, Engraulidae, Pomatomidae and Carangidae, including pilchard, southern anchovy and blue sprat18. Breeding site The nest is a bare scrape2 positioned on the ground in less than 15 % vegetation cover1 on beaches of sand, pebbles, shingle, shell fragments, coral fragments or rock1,3 above the high tide-line and often only a few metres away from shallow clear water4. Alternatively in more marshy habitats (e.g. coastal saltmarshes) the species may build a nest of shells or vegetation1. The species nests in small loose colonies, with neighbouring nests usually placed more than 2 m apart1. Foraging range In Spain, 95% of foraging terns were observed less than 4 km away from the nearest colony19. However, the foraging range of individuals varies according to whether they are currently breeding. In Norfolk, UK, birds with an active nest occupied a range of <6.3 km2 with a range span of up to 4.6 km15, whereas failed birds ranged widely, travelling up to 27 km in a single foraging bout15. In Portugal, ranges were found to be significantly greater during incubation (April-May) than during chick rearing (June-July)20. Little Terns prefer channels and lagoons for foraging, rather than deeper marine habitats19,20. They also prefer areas with abundant resources, entrance channels and main lagoon channels with strong currents, and areas with alternative feeding resources nearby20. Areas subjected to strong human pressure20 and salt marshes19 are avoided. The species tends to forage preferentially at low tide20.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 62 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.637 - 27.501
  Nitrate (umol/L): 0.038 - 6.602
  Salinity (PPS): 32.426 - 36.335
  Oxygen (ml/l): 4.637 - 6.474
  Phosphate (umol/l): 0.057 - 0.515
  Silicate (umol/l): 1.678 - 3.994

Graphical representation

Temperature range (°C): 9.637 - 27.501

Nitrate (umol/L): 0.038 - 6.602

Salinity (PPS): 32.426 - 36.335

Oxygen (ml/l): 4.637 - 6.474

Phosphate (umol/l): 0.057 - 0.515

Silicate (umol/l): 1.678 - 3.994
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 23.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sternula albifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROM252-06|SBB 049|Sternula albifrons| AACCGATGATTATTTTCAACAAATCACAAAGATATCGGCACCCTATACTTAATTTTCGGCGCATGAGCCGGTATAGTAGGTACTGCTCTT---AGCCTACTTATTCGTGCAGAACTGGGTCAGCCAGGAACTCTCCTAGGAGAT---GACCAAATCTACAACGTAATCGTCACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTATCATAATCGGTGGCTTCGGAAACTGATTAGTGCCCCTCATA---ATTGGTGCTCCCGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGCTACCCCCATCATTCTTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGTAGGCACAGGATGAACTGTATATCCCCCCCTAGCTGGCAATCTAGCTCATGCTGGAGCTTCAGTAGACTTA---GCAATCTTCTCCCTTCATCTAGCAGGTGTATCCTCTATCCTAGGTGCTATTAATTTCATCACCACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACCCCTCTATTCGTATGATCCGTACTCATCACTGCTGTCCTACTACTACTCTCACTCCCAGTACTCGCCGCT---GGCATTACCATGTTACTAACAGATCGAAACCTAAACACAACATTCTTCGACCCTGCCGGAGGTGGTGACCCTGTACTATACCAGCATCTTTTCTGATTCTTTGGACACCCAGAAGTATATATTTTAATCCTACCAGGCTTTGGAATCATCTCCCACGTCGTAACATACTATGCAGGCAAAAAA---GAGCCATTTGGCTATATAGGAATAGTGTGAGCTATGCTATCTATTGGATTCCTAGGCTTCATTGTATGAGCTCATCACATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sternula albifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Species: 26
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status in Egypt

Migrant breeder, regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The species is threatened by habitat destruction7 such as the development and industrial reclamation of coastal breeding habitats1, 7 (e.g. for the development of new harbour facilities)7. It is also highly vulnerable to human disturbance (including birdwatchers) at coastal and inland nesting sites which can lead to nest failures1, 7. Pesticide pollution (e.g. organochlorine pollutants, mercury and DDT)7, 10, 12 and artificially induced water-level fluctuations in saltmarshes7 may also pose a threat to the species's reproductive success7, 10, 12. The species also suffers from local egg collecting7 and is susceptible to avian influenza so may be threatened by future outbreaks of the virus8.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Protective measures such as fencing-off sensitive nesting areas, erecting warning signs and wardening are effective measures of increasing the breeding success of this species on sandy beaches2,11. There is also evidence that earlier breeders benefit more (i.e. have higher reproductive success) from protective measures, suggesting that conservation efforts can be maximised if concentrated earlier in the season11. Breeding pairs are also known to be attracted to coastal locations where artificial nesting sites have been constructed (e.g. beaches of bare shingle and islands or rafts covered with sparse vegetation)13. A conservation scheme for the protection of gull and tern breeding colonies in coastal lagoons and deltas (e.g. Po Delta, Italy) involves protection from human disturbance, prevention of erosion of islet complexes, habitat maintenance and the creation of new islets for nest sites14. The scheme particularly specifies that small bare islets of 0.1-0.8 ha with very reduced vegetation cover (less than 30 %) and sward heights less than 20 cm should be maintained or created as additional nesting sites for this species14.

Conservation Actions Proposed

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Tern

The Little Tern, Sternula albifrons or Sterna albifrons, is a seabird of the tern family Sternidae. It was formerly placed into the genus Sterna, which now is restricted to the large white terns (Bridge et al., 2005). The former North American (S. a. antillarum) and Red Sea S. a. saundersi subspecies are now considered to be separate species, the Least Tern (Sternula antillarum) and Saunders's Tern (Sternula saundersi).

This bird breeds on the coasts and inland waterways of temperate and tropical Europe and Asia. It is strongly migratory, wintering in the subtropical and tropical oceans as far south as South Africa and Australia.

There are three subspecies, the nominate albifrons occurring in Europe to North Africa and western Asia; guineae of western and central Africa; and sinensis of East Asia and the north and east coasts of Australia (Higgins and Davies, 1996).

The Little Tern breeds in colonies on gravel or shingle coasts and islands. It lays two to four eggs on the ground. Like all white terns, it is defensive of its nest and young and will attack intruders.

Like most other white terns, the Little Tern feeds by plunge-diving for fish, usually from saline environments. The offering of fish by the male to the female is part of the courtship display.

This is a small tern, 21–25 cm long with a 41–47 cm wingspan. It is not likely to be confused with other species, apart from Fairy Tern and Saunders's Tern, because of its size and white forehead in breeding plumage. Its thin sharp bill is yellow with a black tip and its legs are also yellow. In winter, the forehead is more extensively white, the bill is black and the legs duller. The call is a loud and distinctive creaking noise.

Non-breeding plumage S. a. sinensis with Crested Terns

Little Tern on European rivers

At the beginning of the 19th century the Little Tern was a common bird of European shores, rivers and wetlands, but in the 20th century populations of coastal areas decreased because of habitat loss, pollution and human disturbance.

The loss of inland populations has been even more severe, since due to dams, river regulation and sediment extraction it has lost most of its former habitats. The Little Tern population has declined or become extinct in many European countries, and former breeding places on large rivers like the Danube, Elbe and Rhine ceased. Nowadays, only few river systems in Europe possess suitable habitats; the Loire/Allier in France, the Vistula/Odra in Poland, the Po/Ticino in Italy, the Daugava in Latvia, the Nemunas in Lithuania, the Sava in Croatia and the Drava in Hungary and Croatia. The status of the Little Tern on the rivers Tagus and lower Danube is uncertain.

The Drava population is one of the most threatened. Old fashioned water management practices, including river regulation and sediment extraction, endanger the remaining pairs. Only 15 pairs still breed on extensive sand or gravel banks along the border between Hungary and Croatia. The WWF and its partners are involved in working for the protection of this bird and this unique European river ecosystem. The Little Tern is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!