Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

The little tern is the smallest European tern and also a very brave bird. It chooses to make its nest in places where other birds wouldn't dare. That limits any competition. Little terns often lay their eggs in nothing more than a hollow in the sand. By nesting in such risky places, the colonies often lose eggs during high tide and the chicks turn numb due to a lack of shelter. By nesting in small colonies, they spread the risk.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

The Little Tern is a slender, very small, migratory or partly migratory seabird. Grey plumage covers most of the body with the tips of the wings and the head beingpredominately black. The wings are very narrow and the tail is moderately long and deeply forked. The tip of the tail falls short of the wing tips at rest. During the breeding season, the legs, feet and bill change from black to yellow. Further, the heads of breeding birds have a black cap that contrasts with a white forehead. The Little Tern is very similar in size and shape to the Fairy Tern Sterna nereis. The species is very vocal. The usual flight call is a repetitive shrill high-pitched kik or kip or a high-pitched, slightly rasping, disyllabic gi-wick or kid-ik.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Breeding populations of the Little Tern can be found through much of Europe, scattering along the coast and inland in parts of Africa, in much of western, central and the extreme east and south of Asia, and in northern parts of Australasia. Migratory individuals expand the range to include most of the coast of Africa, the Arabian Peninsula, the western coast of India and most of the waters of south-east Asia and Australasia, including New Zealand. One seasonally breeding colony is also present on Hawaii (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    * albifrons Pallas, 1764 - Europe through W Asia E to Nepal, and presumably this race also in Kenya (breeding at L Turkana), and in W Indian Ocean (Seychelles and Comoro Is, where resident, but breeding not confirmed); winters on coasts from Africa E to W India. * guineae Bannerman, 1931 - Ghana to Gabon, with marginal population in Mauritania and Senegal which may be this race or nominate. * innominata Zarudny & Loudon, 1902 - islands in Persian Gulf. * pusilla Temminck, 1840 - NE India and Myanmar, islands off Sumatra and Java, and probably this race in Sri Lanka. * sinensis Gmelin, 1789 - SE Russia, China, Japan, SE Asia, Philippines and New Guinea; recent colonist to Micronesia (Saipan) E to Hawaii most likely this race, and possibly also some birds in Australia, New Britain and nearby waters; N populations mostly winter in Malaysia. * placens Gould, 1871 - E Australia and E Tasmania.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length 200-280mm Wingspan 450-550mm Tail 80-110mm Bill 26-32mm Tarsus 16-18mm Weight 50g

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The Little Tern is a slender, very small, migratory or partly migratory seabird. Grey plumage covers most of the body with the tips of the wings and the head beingpredominately black. The wings are very narrow and the tail is moderately long and deeply forked. The tip of the tail falls short of the wing tips at rest. During the breeding season, the legs, feet and bill change from black to yellow. Further, the heads of breeding birds have a black cap that contrasts with a white forehead. The Little Tern is very similar in size and shape to the Fairy Tern Sterna nereis. The species is very vocal. The usual flight call is a repetitive shrill high-pitched kik or kip or a high-pitched, slightly rasping, disyllabic gi-wick or kid-ik.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The Little Tern is a strongly migratory (del Hoyo et al. 1996) coastal seabird which usually fishes in very shallow water only a few centimetres deep, often over the advancing tideline or in brackish lagoons and saltmarsh creeks. It has the most inshore distribution of all terns. It breeds between May and July (Richards 1990) in solitary pairs (Flint et al. 1984) or small monospecific groups (del Hoyo et al. 1996) usually of 1-15 pairs (del Hoyo et al. 1996, Snow and Perrins 1998) (rarely over 40 pairs) (del Hoyo et al. 1996) occasionally amidst colonies of other terns (Flint et al. 1984). Breeding may be timed to coincide with peak fish abundance (Perrow et al 2006). Northern breeders depart the breeding grounds from late-July onwards (Richards 1990, del Hoyo et al. 1996), travelling first to moulting sites where they form large roosts before continuing southwards (Tavecchia et al. 2006). The species is gregarious throughout the year (Snow and Perrins 1998) and usually feeds singly, in small groups or larger scattered flocks (Snow and Perrins 1998) and congregating in many thousands on passage in small wetlands where fish fry are abundant (del Hoyo et al. 1996). Habitat Breeding The species breeds on barren or sparsely vegetated beaches, islands and spits of sand, shingle (del Hoyo et al. 1996), shell fragments, pebbles (Flint et al. 1984), rocks or coral fragments (del Hoyo et al. 1996) on seashores (Flint et al. 1984) or in estuaries, saltmarshes, saltpans, offshore coral reefs (del Hoyo et al. 1996), rivers, lakes (Flint et al. 1984, del Hoyo et al. 1996) and reservoirs (de Silva 1991). It may also nest on dry mudflats in grassy areas (de Silva 1991, del Hoyo et al. 1996) but shows a preference for islets surrounded by saline or fresh water where small fish can be caught without the need for extensive foraging flights (Snow and Perrins 1998). Non-breeding Outside of the breeding season the species frequents tidal creeks, coastal lagoons and saltpans and may foraging at sea (del Hoyo et al. 1996) up to 15 km offshore (Urban et al. 1986). Diet Its diet consists predominantly of small fish (e.g. Ammodytes spp., roach Rutilus rutilus, rudd Scardinius erythrophthalmus, carp Cyprinus carpio and perch Perca fluviatilis) and crustaceans 3-6 cm long as well as insects, annelid worms and molluscs (del Hoyo et al. 1996). In Scotland, Little Terns feed mainly on small fish and invertebrates, including herring, sandeel, and shrimps (Crangon vulgaris) (BirdLife International 2000). In Portugal, birds were found to feed mainly on sand-smelts (Atherina spp.) and gobies (Pomatoschistus spp.), which were the most abundant fish species in the study areas (Catry et al 2006). On Rigby Island, Australia, chicks were fed entirely on juvenile fish of the families Clupeidae, Engraulidae, Pomatomidae and Carangidae, including pilchard, southern anchovy and blue sprat (Taylor and Roe 2004). Breeding site The nest is a bare scrape (Richards 1990) positioned on the ground in less than 15 % vegetation cover (del Hoyo et al. 1996) on beaches of sand, pebbles, shingle, shell fragments, coral fragments or rock (Flint et al. 1984, del Hoyo et al. 1996) above the high tide-line and often only a few metres away from shallow clear water (Snow and Perrins 1998). Alternatively in more marshy habitats (e.g. coastal saltmarshes) the species may build a nest of shells or vegetation (del Hoyo et al. 1996). The species nests in small loose colonies, with neighbouring nests usually placed more than 2 m apart (del Hoyo et al. 1996). Foraging range In Spain, 95% of foraging terns were observed less than 4 km away from the nearest colony (Bertolero et al 2005). However, the foraging range of individuals varies according to whether they are currently breeding. In Norfolk, UK, birds with an active nest occupied a range of <6.3 km2 with a range span of up to 4.6 km (Perrow et al 2006), whereas failed birds ranged widely, travelling up to 27 km in a single foraging bout (Perrow et al 2006). In Portugal, ranges were found to be significantly greater during incubation (April-May) than during chick rearing (June-July) (Paiva et al 2007). Little Terns prefer channels and lagoons for foraging, rather than deeper marine habitats (Bertolero et al 2005, Paiva et al 2007). They also prefer areas with abundant resources, entrance channels and main lagoon channels with strong currents, and areas with alternative feeding resources nearby (Paiva et al 2007). Areas subjected to strong human pressure (Paiva et al 2007) and salt marshes (Bertolero et al 2005) are avoided. The species tends to forage preferentially at low tide (Paiva et al 2007).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 62 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.637 - 27.501
  Nitrate (umol/L): 0.038 - 6.602
  Salinity (PPS): 32.426 - 36.335
  Oxygen (ml/l): 4.637 - 6.474
  Phosphate (umol/l): 0.057 - 0.515
  Silicate (umol/l): 1.678 - 3.994

Graphical representation

Temperature range (°C): 9.637 - 27.501

Nitrate (umol/L): 0.038 - 6.602

Salinity (PPS): 32.426 - 36.335

Oxygen (ml/l): 4.637 - 6.474

Phosphate (umol/l): 0.057 - 0.515

Silicate (umol/l): 1.678 - 3.994
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is almost exclusively coastal with sheltered environments preferred. However, the species may also occur several kilometers from the sea in harbours, inlets and rivers. The Little Tern nests in small, scattered colonies on sandy beaches or shingle pits. These nesting sites are particularly vulnerable to human disturbance, predation and natural catastrophes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Preferring small fish but also eating crustaceans, insects, annelids and molluscs . The species forages by plunging in the shallow water of channels and estuaries, and in the surf on beaches.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 23.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both parents incubate a clutch of 1-3 eggs for a period of 17-22 days. The newly hatched young is also cared for by both parents during the fledging period of 17–19 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sternula albifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGATTATTTTCAACAAATCACAAAGATATCGGCACCCTATACTTAATTTTCGGCGCATGAGCCGGTATAGTAGGTACTGCTCTTAGCCTACTTATTCGTGCAGAACTGGGTCAGCCAGGAACTCTCCTAGGAGATGACCAAATCTACAACGTAATCGTCACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTATCATAATCGGTGGCTTCGGAAACTGATTAGTGCCCCTCATAATTGGTGCTCCCGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGCTACCCCCATCATTCTTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGTAGGCACAGGATGAACTGTATATCCCCCCCTAGCTGGCAATCTAGCTCATGCTGGAGCTTCAGTAGACTTAGCAATCTTCTCCCTTCATCTAGCAGGTGTATCCTCTATCCTAGGTGCTATTAATTTCATCACCACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACCCCTCTATTCGTATGATCCGTACTCATCACTGCTGTCCTACTACTACTCTCACTCCCAGTACTCGCCGCTGGCATTACCATGTTACTAACAGATCGAAACCTAAACACAACATTCTTCGACCCTGCCGGAGGTGGTGACCCTGTACTATACCAGCATCTTTTCTGATTCTTTGGACACCCAGAAGTATATATTTTAATCCTACCAGGCTTTGGAATCATCTCCCACGTCGTAACATACTATGCAGGCAAAAAAGAGCCATTTGGCTATATAGGAATAGTGTGAGCTATGCTATCTATTGGATTCCTAGGCTTCATTGTATGAGCTCATCACATATTTACAGTCGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sternula albifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Migrant breeder, regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.190,000-410,000 individuals (Wetlands International 2006), while national population estimates include: c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China; c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in Taiwan; c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Korea and c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Japan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is threatened by habitat destruction (Barcena et al. 1984) such as the development and industrial reclamation of coastal breeding habitats (Barcena et al. 1984, del Hoyo et al. 1996) (e.g. for the development of new harbour facilities) (Barcena et al. 1984). It is also highly vulnerable to human disturbance (including birdwatchers) at coastal and inland nesting sites which can lead to nest failures (Barcena et al. 1984, del Hoyo et al. 1996). Pesticide pollution (e.g. organochlorine pollutants, mercury and DDT) (Barcena et al. 1984, Thyen et al. 2000, Choi et al. 2001) and artificially induced water-level fluctuations in saltmarshes (Barcena et al. 1984) may also pose a threat to the species's reproductive success (Barcena et al. 1984, Thyen et al. 2000, Choi et al. 2001). The species also suffers from local egg collecting (Barcena et al. 1984) and is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Protective measures such as fencing-off sensitive nesting areas, erecting warning signs and wardening are effective measures of increasing the breeding success of this species on sandy beaches(Richards 1990, Medeiros et al. 2007). There is also evidence that earlier breeders benefit more (i.e. have higher reproductive success) from protective measures, suggesting that conservation efforts can be maximised if concentrated earlier in the season (Medeiros et al. 2007). Breeding pairs are also known to be attracted to coastal locations where artificial nesting sites have been constructed (e.g. beaches of bare shingle and islands or rafts covered with sparse vegetation) (Burgess and Hirons 1992). A conservation scheme for the protection of gull and tern breeding colonies in coastal lagoons and deltas (e.g. Po Delta, Italy) involves protection from human disturbance, prevention of erosion of islet complexes, habitat maintenance and the creation of new islets for nest sites (Fasola and Canova 1996). The scheme particularly specifies that small bare islets of 0.1-0.8 ha with very reduced vegetation cover (less than 30 %) and sward heights less than 20 cm should be maintained or created as additional nesting sites for this species (Fasola and Canova 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Little tern

The little tern (Sternula albifrons or Sterna albifrons) is a seabird of the tern family Sternidae. It was formerly placed into the genus Sterna, which now is restricted to the large white terns.[3] The former North American (S. a. antillarum) and Red Sea S. a. saundersi subspecies are now considered to be separate species, the least tern (Sternula antillarum) and Saunders's tern (Sternula saundersi).

This bird breeds on the coasts and inland waterways of temperate and tropical Europe and Asia. It is strongly migratory, wintering in the subtropical and tropical oceans as far south as South Africa and Australia.

There are three subspecies, the nominate albifrons occurring in Europe to North Africa and western Asia; guineae of western and central Africa; and sinensis of East Asia and the north and east coasts of Australia.[4]

The little tern breeds in colonies on gravel or shingle coasts and islands. It lays two to four eggs on the ground. Like all white terns, it is defensive of its nest and young and will attack intruders.

Like most other white terns, the little tern feeds by plunge-diving for fish, usually from saline environments. The offering of fish by the male to the female is part of the courtship display.

This is a small tern, 21–25 cm long with a 41–47 cm wingspan. It is not likely to be confused with other species, apart from fairy tern and Saunders's tern, because of its size and white forehead in breeding plumage. Its thin sharp bill is yellow with a black tip and its legs are also yellow. In winter, the forehead is more extensively white, the bill is black and the legs duller. The call is a loud and distinctive creaking noise.

Little tern (centre) in Olango Island Group, Philippines
Non-breeding plumage of S. a. sinensis with crested terns behind

Populations on European rivers[edit]

At the beginning of the 19th century the little tern was a common bird of European shores, rivers and wetlands, but in the 20th century populations of coastal areas decreased because of habitat loss, pollution and human disturbance.

The loss of inland populations has been even more severe, since due to dams, river regulation and sediment extraction it has lost most of its former habitats. The Little Tern population has declined or become extinct in many European countries, and former breeding places on large rivers like the Danube, Elbe and Rhine ceased. Nowadays, only few river systems in Europe possess suitable habitats; the Loire/Allier in France, the Vistula/Odra in Poland, the Po/Ticino in Italy, the Daugava in Latvia, the Nemunas in Lithuania, the Sava in Croatia and the Drava in Hungary and Croatia. The status of the little tern on the rivers Tagus and lower Danube is uncertain.

The Drava population is one of the most threatened. Old fashioned water management practices, including river regulation and sediment extraction, endanger the remaining pairs. Only 15 pairs still breed on extensive sand or gravel banks along the border between Hungary and Croatia. The WWF and its partners are involved in working for the protection of this bird and this unique European river ecosystem. The little tern is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References[edit]

  1. ^ BirdLife International (2012). "Sterna albifrons". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Sternula albifrons on Avibase
  3. ^ Bridge, E. S.; Jones, A. W. & Baker, A. J. (2005): A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: implications for taxonomy and plumage evolution. Molecular Phylogenetics and Evolution 35:459–469. PDF fulltext
  4. ^ Higgins, P.J. & S.J.J.F. Davies (eds) 1996. Handbook of Australian, New Zealand and Antarctic Birds. Volume 3: Snipe to Pigeons. Oxford University Press, Melbourne. ISBN 0-19-553070-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!