Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Breeding occurs in coastal areas in Alaska throughout the Aleutian Islands as far west as Attu Island, north to the southeastern Chukchi Sea and east to the Alaska Peninsula, Yakutat, and Glacier Bay (see Haney et al. 1991). Breeding in Asia is mostly confined to regions in or near the Sea of Okhotsk and western Bering Sea; recorded from the Commander Islands, Koraginsky Island, the Kamchatka Peninsula, and Sakhalin Island (Haney et al. 1991). The range during the nonbreeding season is not well known; the species is thought to be wide-ranging at sea; likely it has a tropical western Pacific distribution; recorded in the Philippines (Lee 1992). Recent observations in coastal waters around Hong Kong in spring and fall and Singapore and the Indonesian islands of Karimuna and Bintan between October and April indicate that at least part of the population migrates through and winters in these areas. Other observations suggest that coastal waters of Java, Bali, and Suwalesi may form an additional part of the winter range (Hill and Bishop 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Aleutian Tern breeds in the north Pacific Ocean on the coasts of Sakhalin and Kamchatka, Russia, on the Bering and Pacific coasts of Alaska (USA) and on the Aleutian Islands (USA). It is strongly migratory, wintering off Indonesia and Malaysia1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alaska and Siberia; winters to Singapore and Indonesia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 34 cm

Weight: 120 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Sterna aleutica Baird
Catalog Number: USNM 52517
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): F. Bischoff
Year Collected: 1868
Locality: Kodiak Island, Kodiak Island Division, Alaska, United States, North America
  • Type: Baird. (Not Earlier Than October 22) 1869. Trans. Chicago Acad. Sci. 1 (2): 321, pl. 31, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: NON-BREEDING: pelagic.

BREEDING: Nests on grassy or mossy flats, on small offshore islands and coastal spits, around lagoons or near river mouths; nests frequently are mixed with those of arctic terns. Nests usually on sand spits, sandbar islands, sand dunes, and flat vegetated summits of more rugged islands; on low wet coastal marsh and tundra in some areas; on dry sites covered by thick mats of rotted wood or other vegetation (Haney et al. 1991). Colony locations frequently shift from year to year among traditionally used sites, such that local populations may fluctuate greatly (Haney et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found over the waters of the Arctic and subarctic coastal plains. It feeds mainly on small fish which it catches by surface-dipping. Laying mainly occurs in June, usually in small monospecific colonies on a variety of habitats up to 20 km inland (del Hoyo et al. 1996).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in eastern Alaska in late April, in western and northern Alaska mid-May to early June; flocks begin to form in staging areas from late July to early August, prior to departure for wintering areas (Haney et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Summer diet includes mainly small fishes such as capelin and sand lance, also sticklebacks, salmon smolts, smelt, Pacific sandfish, greenling, and euphausiids (Haney et al. 1991). In summer, forages mostly in shallow water such as tide rips near colonies within 1-10 km of land but also well out to sea. Flies at moderate heights, swoops down to surface-pick for prey items (Haney et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 100,000 individuals

Comments: Global population estimated at 17,000-20,000 individuals (USFWS 2006). Alaska breeding population estimated at 9,500 birds (USFWS 2006). Siberian population was estimated at about 13,000 individuals in the early 1990s (Haney et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Forages singly, in monospecific flocks, or in mixed-species flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Lays clutch of usually 2 eggs, mid- or late May to late June. Incubation averages 22 days. Hatching occurs mid-June to late July. Young fledge in 4 weeks, mid-July to late August. Young may remain at nest for 1-2 weeks after they are able to fly. Only one brood per season. Reportedly does not attempt to renest if eggs are taken. Nests in loose colonies of a few to over 500 pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Onychoprion aleuticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATACTTAATTTTCGGCGCATGAGCTGGTATAGTAGGTACTGCCCTCAGCCTACTCATTCGCGCAGAATTAGGCCAACCAGGAACTCTCTTAGGGGATGACCAAATCTATAACGTAATTGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTAATGCCAATCATAATTGGTGGTTTCGGAAACTGATTAGTACCACTTATAATCGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGTTTCTGACTACTACCTCCATCATTTTTACTCCTCCTAGCCTCCTCCACAGTAGAGGCCGGAGCCGGAACAGGATGAACTGTATACCCTCCCCTAGCTGGTAATCTAGCCCATGCTGGAGCTTCAGTAGACCTAGCAATCTTCTCCCTTCATCTAGCAGGTGTATCCTCTATCCTAGGTGCTATCAACTTTATCACCACGGCCATTAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCACTGTTCGTATGATCTGTACTTATCACTGCCGTCCTACTATTACTCTCACTCCCAGTACTCGCTGCTGGCATCACTATACTATTAACAGACCGAAACCTAAACACAACATTCTTTGATCCTGCTGGAGGTGGCGACCCTGTACTATATCAACACCTCTTCTGATTCTTTGGCCACCCAGAAAGTCTAAANNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Onychoprion aleuticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4B - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.30,000-35,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.50-1,000 individuals on migration in China and c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Due to this tern's tendency to concentrate in a few areas, contamination as a result of oil spills is a potential threat. Heavy predation by birds and mammals and mortality associated with exposure to inclement weather may contribute to low reproductive success. Species is sensitive to disturbance at nesting colonies; complete colony abandonment has been observed following a single visit by humans (Haney et al. 1991). Most colonies are isolated and rarely visited, so human disturbance is only a local problem. On nonbreeding range, threats include human overfishing of prey species, uncontrolled waste disposal, and land-based pollution (Haney et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Information is needed on survival, food habits, and habitat use in nonbreeding range. A banding program at breeding colonies is needed to determine colony fidelity and lifetime reproductive success (North 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Aleutian Tern

The Aleutian tern (Onychoprion aleuticus, formerly Sterna aleutica - see Bridge et al., 2005) is a seabird of the tern family Sternidae.

This species breeds in colonies on coasts and islands in Alaska and easternmost Siberia. It is strongly migratory, wintering off Indonesia and Malaysia. Large numbers appear off China during passage periods.

It is a very rare vagrant to western Europe, with just one record, on the Farne Islands off Northumberland, England on 28–29 May 1979.

It lays 2-3 eggs in a ground scrape. It sometimes nests among Arctic terns, which, like most white terns, are fiercely defensive of their nest and young and will attack large predators.

Like most other terns, the Aleutian tern feeds by plunge-diving for fish, usually from saline environments. The offering of fish by the male to the female is part of the courtship display.

This is a medium-sized tern, with a short, pointed bill and a long, deeply forked tail. It has a black cap with a white forehead, dark gray mantle and underparts and a mostly pale underwing with a dark secondary bar. It has a white rump and tail, black legs and a black bill.

The call is a musical whee-hee-hee.

References[edit]

  • Bridge, E. S.; Jones, A. W. & Baker, A. J. (2005): A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: implications for taxonomy and plumage evolution. Molecular Phylogenetics and Evolution 35: 459–469. PDF fulltext
  • Collinson, M. (2006). Splitting headaches? Recent taxonomic changes affecting the British and Western Palaearctic lists. British Birds 99(6): 306-323.
  • del Hoyo, J.; Elliott, A. & Sargatal, J. (editors) (1996): Handbook of birds of the world, Volume 3: Hoatzin to Auks. Lynx Edicions, Barcelona. ISBN 84-87334-22-9
  • Harrison, Peter (1988): Seabirds (2nd edition). Christopher Helm, London ISBN 0-7470-1410-8
  • National Geographic Society (2002): Field Guide to the Birds of North America. National Geographic, Washington DC. ISBN 0-7922-6877-6
  • Sibley, David Allen (2000): The Sibley Guide to Birds. Alfred A. Knopf, New York. ISBN 0-679-45122-6
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic. Sterna camtschatica Finch, 1882 is a synonym used by some authors, especially in Russian literature (North 1997). Based on similar head patterns, this species may form superspecies with the gray-backed tern (S. lunata) and bridled tern (S. anaethetus); Aleutian and gray-backed tern also have similar foot and bill structure (Cramp 1985). This species formerly (AOU 1983, 1998) was included in the genus Sterna, but it is now placed in Onychoprion on the basis of genetic data that correspond to plumage patterns (Bridge et al. 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!