Overview

Distribution

Range

Africa south of the Sahara and se Iraq; formerly Egypt.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Sacred ibises are native and abundant in sub-Saharan Africa and southeast Iraq. There are introduced populations in Spain, Italy, France, and the Canary Islands from individuals that escaped from captivity and began breeding successfully.

Biogeographic Regions: palearctic (Introduced , Native ); ethiopian (Native )

  • Cramp, S., K. Simmons. 1977. Handbook of the Birds of Europe, the Middle East, and North Africa: Vol. 1. Oxford: Oxford University Press.
  • Yesou, P., P. Clergeau. 2005. Sacred Ibis: a New Invasive Species in Europe. Birding World, 18/12: 517-526.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sub-Saharan Africa: all S of Sahara except parts of Namibia, W South Africa, NE Somalia (aethiopicus); W Madagascar (bernieri); Aldabra (abbotti); feral population on E Canary Is.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pure to dirty white feathers cover most of the body. Blue-black scapular plumes form a tuft that falls over the short, square-shaped tail and closed wings. The flight feathers are white with dark blue-green tips. Sacred ibises have long necks and bald, dull grey-black heads. The eyes are brown with a dark red orbital ring and the bill is long, downwardly curving, and with slit-like nostrils. Red bare skin is visible on the side of the breast and on the underwings. The legs are black with a red tinge. There is no seasonal variation or sexual dimorphism other than that males are slightly larger than females.

Juveniles have feathered heads and necks that are mottled white with black streaks. Their scapular feathers are greenish-brown and there is more black on their outer primaries and primary coverts. The underwing coverts have dark streaks. The tail is white with brown corners.

Average mass: 1.5 kg.

Range length: 65 to 75 cm.

Range wingspan: 112 to 124 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 64-89 cm. Plumage: white. Immature as adult. Bare parts: iris brown, ringed with red when breeding; facial skin: head and neck black; bill black with horn tip; feet and legs black tinged red. Habitat: coastal lagoons, tidal flats, offshore islands and highly varied inland habitats. <388><393><391>
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is an intra-African migrant, making nomadic or partially migratory movements of several hundred kilometres to breed during the rains (Brown et al. 1982, del Hoyo et al. 1992). Populations north of the equator migrate northwards and those south of the equator migrate southwards (Brown et al. 1982, del Hoyo et al. 1992), both groups returning towards the equator at the end of the breeding season (Brown et al. 1982). Some populations (e.g. in southern Africa) may also be sedentary (Hockey et al. 2005). The species starts to breed during or shortly after the rains, although in flooded areas it also breeds during the dry season, usually nesting in large mixed-species colonies of 50-2,000 pairs (del Hoyo et al. 1992). It is a very gregarious species, often flying more than 30 km away from the colony to feed (Brown et al. 1982, Hockey et al. 2005). The species also roosts nightly in large numbers at breeding sites, on islets in rivers or flood-lands, on trees near dams, or in villages (Brown et al. 1982). Habitat The species mainly inhabits the margins of inland freshwater wetlands, sewage works (del Hoyo et al. 1992), saltpans (Martin and Randall 1987), farm dams (Hockey et al. 2005), rivers in open forest (Brown et al. 1982), grasslands, and cultivated fields, as well as coastal lagoons, intertidal areas, offshore islands (del Hoyo et al. 1992) and mangroves (Langrand 1990) (especially in the dry season) (Hancock et al. 1992). It may also occur in more human environments such as farmyards, abattoirs and refuse dumps on the outskirts of towns (del Hoyo et al. 1992). Diet Its diet consists largely of insects including grasshoppers, locusts, crickets, and aquatic beetles, although it will also take crustaceans, worms, molluscs, fish, frogs, lizards, small mammals, the eggs of Great White Pelican Pelecanus onocrotalus and crocodiles, nestling Cape Cormorants Phalacrocorax capensis, carrion, offal and seeds (Brown et al. 1982, Hancock et al. 1992, del Hoyo et al. 1992). Breeding site The nest is a large platform of sticks and branches built in trees or bushes, or placed on the ground on rocky islands (Brown et al. 1982, del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sacred ibises inhabit a wide range of habitats, although generally they are found in close proximity to rivers, streams, and coastlines. Their native range is sub-tropical to tropical, but they are found in more temperate areas where introduced. They often nest on rocky marine islands and have adapted to living in towns and villages.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

  • Kopij, G. 1999. Breeding Ecology of the Sacred Ibis Threskiornis aethipicus in the Free State, South Africa. South African journal of Wildlife Research, 29/2: 25-30.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Movements and dispersal

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Sacred ibises feed during the day primarily in flocks by wading in shallow wetlands. Occasionally they will feed on dry land close to water. They may fly a distance of 10 km to foraging grounds. They feed primarily on insects, arachnids, annelids, crustaceans, and mollusks. They have been observed eating frogs, reptiles, fish, young birds, eggs, and carrion as well. In more cultivated areas, they have been known to eat human refuse. This has been observed in France where they are becoming an invasive pest species.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Sacred ibises are important wading birds throughout their range in Africa, consuming a wide variety of smaller animals, keeping their populations in check. In Europe, their adaptable nature has made sacred ibises an invasive species, sometimes feeding on rare birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

There are few reports of predation on sacred ibises. As adults these birds are very large, discouraging most predation. Young sacred ibises are guarded carefully by their parents, but may be subject to predation by large raptors.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Sacred ibises are generally quiet birds. During the breeding season they produce a variety of vocalizations. In antagonistic situations, both sexes utter a variety of squeals, moans, and wheezes, sometimes described as: “whoot-whoot-whoot-whooeeoh” or “pyuk-pyuk-pek-pek-peuk”. Females make a series of “whaank” noises after the nest is built to attract the male, this is usually followed by copulation. Adults make a “turrooh” or “keerrooh” to call their offspring back to the nest. Adults make a high pitched “chrreeee-chree-ah-chreeee” to call offspring for feeding. They have also been observed making a loud croak during flight.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sacred ibises may live up to 20 years.

Typical lifespan

Status: wild:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37 years (captivity) Observations: One specimen lived for 37 years in captivity (Brouwer et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sacred ibises form seasonally monogamous breeding pairs that nest in large nesting colonies.

During the breeding season large groups of males select a spot to settle and form pairing territories. In these territories males stand with wings held downwards and rectrices spread. In the following several days females arrive in the nesting colony, along with more males. Newly arriving males go to the established territories of settler males and compete for the territory. Fighting males may strike at each other with their bills and make squealing noises. Females choose among males and their pairing territories and pairs are formed. Once the pair is formed, the couple moves to a nearby nesting area selected by the female. Fighting behavior may continue in the nesting area between neighboring individuals of either sex. Individuals will stand with wings outstretched and head lowered with bill open towards other individuals. Individuals that are very close to each other may adopt a similar stance, but with bill pointed upwards, nearly touching, while making calls.

During pair formation the female approaches the male and, if she is not chased away, they face one another and bow with necks outstretched forward and towards the ground. After this they assume a standing posture and intertwine their necks and bills. This may be followed by more bowing or extensive self-preening. The pair then establishes a nest territory where copulation occurs. During copulation, females crouch so males may straddle them, the male may grab the females bill and shake it side to side. After copulation the pair again assumes a standing position and extensively preen themselves at the nest site.

Mating System: monogamous

Sacred ibises breed yearly in large nesting colonies. In Africa breeding occurs from March to August, in Iraq breeding is reported from April to May. Females lay from 1 to 5 (average 2) eggs, which are incubated for about 28 days. The eggs are oval shaped or slightly round, with a rough texture. The eggs are dull white with a blue tinge and sometimes dark red spots. Eggs are from 43 to 63 mm. Fledging occurs 35 to 40 days after hatching and the young become independent soon after fledging.

Breeding interval: Sacred ibises breed once yearly.

Breeding season: In Africa breeding occurs from March to August, in Iraq breeding is reported from April to May.

Range eggs per season: 1 to 5.

Average eggs per season: 2.

Range time to hatching: 21 to 29 days.

Average time to hatching: 28 days.

Range fledging age: 35 to 40 days.

Range time to independence: 44 to 48 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Incubation lasts for around 21 to 29 days, with most incubated around 28 days by both male and female, alternating at least once every 24 hours.  After hatching one parent is present at the nest at all times for the first 7 to 10 days. The young are fed many times a day by partial regurgitation from parents. Young leave the nests after 2 to 3 weeks and form groups close to the colony. They are fed by parents once a day after leaving the nest. The fledgling period lasts from 35 to 40 days and individuals leave the colony at 44 to 48 days after hatching.

After eggs hatch, the parents identify and feed only their own offspring. When parents return to feed offspring, they give a short “keerooh” call. The offspring recognizes the parental call and may run, jump, or fly to the parent for food. If other young approach the parent, they will be chased away. When the offspring learns to fly, it may circle the colony until the parent returns to feed it, or even chase the parent around before feeding.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Cramp, S., K. Simmons. 1977. Handbook of the Birds of Europe, the Middle East, and North Africa: Vol. 1. Oxford: Oxford University Press.
  • Kopij, G. 1999. Breeding Ecology of the Sacred Ibis Threskiornis aethipicus in the Free State, South Africa. South African journal of Wildlife Research, 29/2: 25-30.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Threskiornis aethiopicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATATTTAATCTTCGGCGCATGAGCTGGCATAGTTGGAACTGCACTCAGTCTACTTATTCGCGCAGAACTGGGCCAGCCCGGAACTCTCTTAGGAGACGACCAAATCTATAATGTAATCGTCACGGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGCGGATTTGGCAACTGACTAGTCCCACTTATAATCGGTGCGCCCGACATAGCATTCCCACGTATAAACAACATAAGTTTCTGACTATTGCCACCCTCATTCCTACTCCTCCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGATGAACTGTATACCCACCACTTGCCGGCAACCTCGCTCATGCTGGAGCCTCAGTCGACCTAGCTATCTTCTCGCTTCACTTAGCAGGTGTCTCATCCATCCTAGGAGCAATCAACTTTATCACAACTGCTATTAACATAAAACCACCCGCCCTCTCACAATACCAAACTCCCCTATTCGTCTGATCAGTCCTAATCACTGCCGTCCTACTGCTACTCTCACTACCAGTCCTTGCTGCTGGTATCACCATACTACTAACAGACCGAAATCTAAATACCACATTCTTCGACCCAGCCGGAGGAGGGGATCCTGTCCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Threskiornis aethiopicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Former breeder and accidental visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sacred ibises are not considered threatened in their native range. They have become a conservation problem in Europe, where they have been reported feeding on threatened native species as well as encroaching on the habitats of native species. This has become a concern for European conservationists trying to protect native threatened species.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The population on Aldabra Island has declined due to hunting and disturbance by temporary workers (del Hoyo et al. 1992). The species is also susceptible to avian botulism, so may be threatened by future outbreaks of the disease (van Heerden 1974). Utilisation The eggs and young of this species are collected by local people in Madagascar (Langrand 1990, Hancock et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sacred ibises do not impact humans directly, but where they are introduced they may become a nuisance or may prey on bird species that are threatened or protected.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Ancient Egyptians revered sacred ibises. They mummified many of these birds and buried them in the tombs of deceased pharaohs, though they are now rare in Egypt. Sacred ibises are also important members of native ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

African Sacred Ibis

The African sacred ibis (Threskiornis aethiopicus) is a species of ibis. Its sister species is the Australian white ibis.

Description[edit]

An adult individual is 68 cm long with all-white body plumage apart from dark plumes on the rump. The bald head and neck, thick curved bill and legs are black. The white wings show a black rear border in flight. Sexes are similar, but juveniles have dirty white plumage, a smaller bill and some feathering on the neck.

Flying in South Africa

This bird is usually silent, but occasionally makes some croaking noises, unlike its vocal relative, the Hadada ibis.

Habitat and distribution[edit]

A wading bird of the ibis family, Threskiornithidae, the sacred ibis breeds in Sub-Saharan Africa, southeastern Iraq, and formerly in Egypt, where it was venerated and often mummified as a symbol of the god Thoth. The African sacred ibis occurs in marshy wetlands and mud flats, both inland and on the coast. It will also visit cultivation and rubbish dumps.

Reproduction[edit]

Young sacred ibis in Tanzania

The bird nests in tree colonies, often with other large wading birds such as herons. It builds a stick nest often in a baobab tree and lays two or three eggs.

Diet[edit]

It feeds on various fish, frogs, small mammals, reptiles and smaller birds as well as insects. It may also probe into the soil with its long bill for invertebrates such as earthworms.

As an introduced species[edit]

The African sacred ibis has been introduced into France, Italy, Spain, Taiwan, and the United States (south Florida).

The introduced and rapidly growing populations in southern Europe are seen as a potential problem, since these large predators can devastate breeding colonies of species such as terns. They also compete successfully for nest sites with cattle and little egrets. The adaptable ibises supplement their diet by feeding at rubbish tips, which helps them to survive the winter in these temperate regions.

Conservation[edit]

The African sacred ibis is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

In myth and legend[edit]

Copenhagen Museum
Wooden body with copper-bronze parts, Ptolemaic period, 330–304 BC

Venerated and often mummified by Ancient Egyptians as a symbol of the god Thoth, the ibis was, according to Herodotus and Pliny the Elder, also invoked against incursions of winged serpents. Herodotus wrote:

There is a region moreover in Arabia, situated nearly over against the city of Buto, to which place I came to inquire about the winged serpents: and when I came thither I saw bones of serpents and spines in quantity so great that it is impossible to make report of the number, and there were heaps of spines, some heaps large and others less large and others smaller still than these, and these heaps were many in number.

The region in which the spines are scattered upon the ground is of the nature of an entrance from a narrow mountain pass to a great plain, which plain adjoins the plain of Egypt; and the story goes that at the beginning of spring winged serpents from Arabia fly towards Egypt, and the birds called ibises meet them at the entrance of this country and do not suffer the serpents to go by but kill them. On account of this deed it is (say the Arabians) that the ibis has come to be greatly honored by the Egyptians, and the Egyptians also agree that it is for this reason that they honor these birds.

In more mythical stories, it was also said that the flies that brought pestilence died immediately upon propitiatory sacrifices of this bird.[2]

References[edit]

  1. ^ BirdLife International (2012). "Threskiornis aethiopicus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Pliny, Natural History Book X Chapter 41)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!