Articles on this page are available in 2 other languages: Spanish (1), Dutch (1) (learn more)

Overview

Brief Summary

The Arctic Tern (Sterna paradisaea) is perhaps best known for its extraordinary annual migration, which is often cited as the longest seasonal distance traveled by any animal. It has long been known that the Arctic Tern breeds in the Arctic and migrates each year to spend the northern winter at high latitudes in the Southern Ocean. Until recently, what has been known about the Arctic Tern's migration has come from limited banding recoveries and at-sea observations. Thanks to new technology, however, far more detailed data on this small (<125 grams) bird's annual migration are now available. Egevang et al. (2010) fitted 11 Arctic Terns with miniature (1.4 gram) geolocators. They found that the annual distances traveled are, in fact, even greater than previously believed--more than 80,000 km annually for some individuals. All tracked terns migrated south to spend the austral summer (December–March) south of 58° S and between 0 and 61° W in the Atlantic sector of the Southern Ocean. This region, which includes the Weddell Sea, is particularly productive, and supports higher densities of a key prey for many seabirds, Antarctic krill (Euphausia superba), than do other regions of the Southern Ocean. All birds began the return migration to breeding colonies in early–mid April, always traveling over deep water at considerable distance from continental shelf margins.

Egevang et al. note that the routes used for both the southbound and northbound migrations showed a high level of congruence with parts of those taken by Manx Shearwater (Puffinus puffinus) and Cory’s Shearwater (Calonectris diomedea), which also winter in the South Atlantic (although considerably farther north than the Arctic Tern). Thus, despite their small size, Arctic Terns apparently exploit the prevailing global wind systems (clockwise in the North, and counter-clockwise in the South Atlantic) much as the substantially larger shearwaters do, as has been previously suggested. These new geotracking studies found that the main wintering region was the marginal ice zone around Antarctica, which agrees with at-sea observations. The mean duration of the northbound migration was about 40 days (range 36 to 46). Mean duration of the southbound migration was about 93 days (range 69 to 103). (Egevang et al. 2010)

Egevang et al. (2010) provide the following summary of key statistics derived from their study, showing mean (range):

Total distance traveled on migration: 70,900 km (59,500–81,600 km)
Distance traveled on southbound migration: 34,600 km (28,800–38,500 km)
Distance traveled per day on southbound migration: 330 km per day (280–390 km per day)
Distance traveled on northbound migration: 25,700 km (21,400–34,900 km)
Distance traveled per day on northbound migration: 520 km per day (390–670 km per day)
Distance traveled within winter site: 10,900 km (2,700–21,600 km)

Perhaps most striking, the tracked birds were found to travel nearly twice the total distance generally cited for the annual Arctic Tern migration (typically quoted as ~ 40,000 km). Given that Arctic Terns can live for more than 30 years, the total distance traveled in a lifetime may exceed 2.4 million km, equivalent to approximately three round-trip journeys to the Moon. (Egevang et al. 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Arctic terns are the champion of all migrating birds. They migrate the furthest south to overwinter, as far as the South Pole ice. In the spring, they return to their breeding grounds in the North Sea area or further northwards. In total, they make an annual trip of around 35,000 kilometers per year! A young Arctic tern supplied with a transmitter in Groningen in the summer of 2011 flew at least 90,000 kilometers in 273 days. If you realize that Arctic terns can reach an age of 30 years and make this trip every year, than this tern possibly flies more than 2.7 million km in its entire life. That is equivalent to approximately 3 return trips to the moon!
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Arctic tern is a long-distance migrant, making a staggering annual round-trip from its Arctic or northern temperate breeding range to the Antarctic where it spends winter (3). This is probably the longest migration undertaken by any bird (2) and means that the Arctic tern sees more sunlight each year than any other animal, as they experience a 'second summer' by travelling south in winter (5). They are very similar in appearance to the common tern (Sterna hirundo), so much so that birdwatchers call unidentified terns 'commic terns', an amalgamation of the two common names (6). Arctic terns are slightly smaller than common terns, and have a shorter bill and longer tail (2). The rump is white, the underparts are darker and the wing lacks the dark wedge on the outer edge, which is a key identifying feature of common terns (6) . During summer, the bill becomes bright red and lacks the black tip seen in common terns (2). Long tail streamers also develop in summer (2). A 'kee-arr' alarm call and a piping 'pi-pi-pi-pi-pi' call are produced (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The Arctic tern tends to arrive back in its breeding habitats after the long migration from May to June (3). Males court females with a 'fish flight', an impressive aerial display which culminates in the male presenting the female with a 'gift' in the form of a fish (6). Nesting tends to occur in a hollow on the ground at a good distance from the shore in short vegetation (4) (6). Pairs, which mate for life, produce between one and three eggs, which are incubated for up to 24 days (3) (6). After a further 24 days or so, the chicks will have fully fledged. The males defend the nests if they are threatened, by diving at potential predators and livestock (6).  Arctic terns are very long-lived species, with a maximum recorded life-span of 29 years (3). This species feeds mainly on fish, particularly sand eels (3) (4), which they catch by making short dives into the water (6). Feeding tends to occur within 3 km of the breeding colony, although they have been recorded to travel 10 km away in order to feed (4). When the breeding season is over, these birds head off once more on their long journey south (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Introduction

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range Description

The Arctic Tern has a circumpolar range, breeding in the Arctic and subarctic regions of Europe, Asia and North America as far south as Brittany, France and Massachusetts (USA). It is a transequatorial migrant, and can be found wintering throughout the Southern Ocean to the edge of the Antarctic ice and the southern tips of South America and Africa (del Hoyo et al. 1996). Overall population trends are relatively unknown, though the 2008 breeding season in the north of the United Kingdom was reported to be a failure by the RSPB.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; range extends from the Arctic to the Bay of Fundy region
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; range extends from the Arctic to the Bay of Fundy region
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar; nests on Northern European islands and peninsulas from Iceland to Northern Russia/Siberia, British Isles, Netherlands, Denmark, Sweden, the Baltic Nations, Northern Alaska, extreme of Northern Canada, Greenland, Newfoundland, and south along Atlantic Coast to Massachussetts; winters in S. Hemisphere in subantarctic and Antarctic waters of Atlantic, Pacific, and Indian Oceans.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from northern Alaska east to northern Ellesmere Island, south to the Aleutian Islands, northwestern British Columbia, northwestern Saskatchewan, northern Ontario, New Brunswick, and along Atlantic coast, locally to Maine and Massachusetts; a disjunct colony exists in Puget Sound, Washington, and solitary nesters in northcentral Montana. Outside North America, nesting occurs in Greenland on all coasts; in the Palearctic north to Iceland, Svalbard, and Franz Josef Land, and south to the Netherlands and sparsely in Belgium, Ireland, and northwestern France; and in northern Russia and widely along Russian far eastern arctic coasts (Wrangel Island, Chukotska and Kamchatka Peninsulas south to Sakhalin Island) (Hatch 2002).

During the nonbreeding season, this species occurs primarily in the antarctic and subantarctic regions of the Southern Hemisphere, with small numbers reported throughout the year from Namibia to Mozambique, southern Australia, and New Zealand (Hatch 2002). Migrants occur widely in areas between the breeding areas and antarctic region.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Arctic circumpolar; winters sub-Antarctic and Antarctic seas.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar. High Canadian Arctic to east coast of Canada and New England. Greenland, Iceland and the British Isles. Northern Russia. Winters in Antarctica, some in southern Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Arctic terns breed around the Arctic and temperate northern parts of the northern Hemisphere. They travel massive distances to overwinter in the Southern Ocean and Antarctica (4). The population that breeds in Britain and Ireland is at the southern-most limit of its breeding range. This range extends through Greenland and Iceland, along the Baltic and Scandinavian coasts reaching into Siberia. Most of the British breeding population occurs in Scotland, Orkney, Shetland and the Hebrides. Populations also occur in England in the northwest and northeast and there are small numbers in Norfolk and around the southern coast; they also breed in Anglesey in Wales (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Arctic terns are 14-17''(36-43 cm) long with a wingspread of 29-33''(74-84 cm). They are white with black caps and gray mantles, and a deeply-forked tail. In spring and summer, the entire bill is blood-red. Their legs are so short that the birds appear to be crouched when standing.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 100 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 39 cm

Weight: 110 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 33-38 cm, Wingspan: 79-81 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 33-41 cm. Plumage: tail, rump, back and wings pale grey, wingtips darker grey; hind neck white; forehean white, forecrown speckled white; below white; breeding bird has pearl grey below, cheeks white; deeply forked tail extends slightly beyond wing. Immature browner on back. Bare parts: iris dark brown; bill red in breeding and black in non-breeding birds; feet and legs red in breeding and black in non-breeding. Habitat: open ocean and seashores. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Length: 33-41 cm. Plumage: tail, rump, back and wings pale grey, wingtips darker grey; hind neck white; forehean white, forecrown speckled white; below white; breeding bird has pearl grey below, cheeks white; deeply forked tail extends slightly beyond wing. Immature browner on back. Bare parts: iris dark brown; bill red in breeding and black in non-breeding birds; feet and legs red in breeding and black in non-breeding. Habitat: open ocean and seashores. Palearctic migrant. <389><391><393>
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type; Type for Sterna paradisaea
Catalog Number: USNM 64404
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): F. Benner
Year Collected: 1873
Locality: Casco Bay, Peak Island, Cumberland, Maine, United States, North America
  • Type: Benner. 1874. Ann. Rep. Smithsonian Inst. For 1873. 60.; Type: Ridgway. July 1874. American Naturalist. 8: 433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type; Type for Sterna paradisaea
Catalog Number: USNM 64404
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): F. Benner
Year Collected: 1873
Locality: Casco Bay, Peak Island, Cumberland, Maine, United States, North America
  • Type: Benner. 1874. Ann. Rep. Smithsonian Inst. For 1873. 60.; Type: Ridgway. July 1874. American Naturalist. 8: 433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The species is a very strong migrant and makes exceptional long-distance movements offshore or along western continental coastlines (del Hoyo et al. 1996, Melville and Shortridge 2006) between its high Arctic breeding grounds and Antarctic wintering grounds (del Hoyo et al. 1996). It breeds between May and July (although the exact timing varies with temperature and food availability) in solitary pairs or colonies of a few to several hundred pairs (usually 2-25) (del Hoyo et al. 1996), and remains gregarious throughout the year especially when roosting, foraging (Snow and Perrins 1998) and on passage (Higgins and Davies 1996). The species generally feeds within 3 km of breeding colonies but may occasionally forage up to 50 km away (del Hoyo et al. 1996). On its wintering grounds in Antarctica it may also forage in association with Antarctic Minke Whale Balaenoptera bonaerensis in the open ocean north of the pack-ice zone (Higgins and Davies 1996). Habitat Breeding The species breeds along northern coastlines (del Hoyo et al. 1996)and on inshore islands (Flint et al. 1984, Snow and Perrins 1998) as well as inland on tundra and forest-tundra (Flint et al. 1984). It shows a preference for habitats with a vegetation cover of less than 40 %, nesting on sand or shingle beaches, ridges (del Hoyo et al. 1996) and spits (Flint et al. 1984), rocky ground (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996) and small islands (Flint et al. 1984, del Hoyo et al. 1996, Snow and Perrins 1998) in lakes and coastal lagoons (del Hoyo et al. 1996). It may also nest on islets or banks along rivers (Snow and Perrins 1998), on swampy tundra (Flint et al. 1984, del Hoyo et al. 1996) and peatlands with bog hummocks (del Hoyo et al. 1996) and reed-covered flats (Flint et al. 1984), or on inland heaths, rough pastures (del Hoyo et al. 1996, Snow and Perrins 1998), meadows (del Hoyo et al. 1996) and sedge grassland (Snow and Perrins 1998) not far from water (Flint et al. 1984). The species also forages offshore, in ice-filled coastal bays or over wet tundra (del Hoyo et al. 1996). Non-breeding On passage it largely flies over open ocean (Snow and Perrins 1998) resting at sea on kelp, logs or flotsam, but may occur inland or along coastlines on beaches, reefs and spits (Higgins and Davies 1996). During the winter the species is pelagic, foraging at the edges of pack-ice, icebergs and ice-floes near shore (especially in channels between ice-floes) (Higgins and Davies 1996) and up to 24 km offshore (Higgins and Davies 1996, del Hoyo et al. 1996) often in association with Antarctic Minke Whale Balaenoptera bonaerensis (Higgins and Davies 1996). It also roosts on ice-floes and icebergs during this season (Higgins and Davies 1996). Diet Its diet consists predominantly of fishas well as crustaceans (especially planktonic species), molluscs, insects (e.g. caterpillars, Chironomidae) and earthworms (del Hoyo et al. 1996). It will also take berries in the early spring on arrival on its breeding grounds but does not readily switch to other prey items when preferred prey supplies fail (del Hoyo et al. 1996). Breeding site The nest is a shallow scrape (del Hoyo et al. 1996) in sand, shingle or turf (Richards 1990) on beaches, ridges (del Hoyo et al. 1996) and spits (Flint et al. 1984), rocky ground (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996), small islands (Flint et al. 1984, del Hoyo et al. 1996, Snow and Perrins 1998) in lakes, coastal lagoons (del Hoyo et al. 1996) and rivers (Snow and Perrins 1998), swampy tundra (Flint et al. 1984, del Hoyo et al. 1996) and peatlands with bog hummocks (del Hoyo et al. 1996) and reed-covered flats (Flint et al. 1984), or on inland heaths, rough pastures (del Hoyo et al. 1996, Snow and Perrins 1998), meadows (del Hoyo et al. 1996) and sedge grassland (Snow and Perrins 1998) not far from water (Flint et al. 1984). It will also nest on artificial structures (del Hoyo et al. 1996). Management information Removing feral American mink Neovison vison from a large archipelago with many small islands in the Baltic Sea resulted in an increase in the breeding density of this species in the area (Nordstrom et al. 2003). Gull control measures may also be practised successfully at some sites to reduce predation and displacement, especially when carried out in conjunction with the use of recordings and models to induce recolonistion of nesting terns (Buckley and Buckley 1984).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2811 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1917 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.542 - 24.813
  Nitrate (umol/L): 0.065 - 29.325
  Salinity (PPS): 6.428 - 36.842
  Oxygen (ml/l): 4.763 - 9.061
  Phosphate (umol/l): 0.086 - 2.073
  Silicate (umol/l): 1.179 - 70.561

Graphical representation

Temperature range (°C): -1.542 - 24.813

Nitrate (umol/L): 0.065 - 29.325

Salinity (PPS): 6.428 - 36.842

Oxygen (ml/l): 4.763 - 9.061

Phosphate (umol/l): 0.086 - 2.073

Silicate (umol/l): 1.179 - 70.561
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

All terns live along seacoasts and around interior lakes and marshes.

Terrestrial Biomes: tundra ; taiga ; forest ; icecap

Aquatic Biomes: lakes and ponds; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: NON-BREEDING: mostly pelagic, rarely in coastal bays and estuaries. Migrates primarily at sea along coasts. BREEDING: Nests on ground on rocky, sandy, gravelly, or grass-covered coasts and islands, in far north on islands in lakes and ponds and in marshes and on riverine gravel bars, sometimes on open tundra (Terres 1980). See Spendelow and Patton (1988) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2811 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1917 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.542 - 24.813
  Nitrate (umol/L): 0.065 - 29.325
  Salinity (PPS): 6.428 - 36.842
  Oxygen (ml/l): 4.763 - 9.061
  Phosphate (umol/l): 0.086 - 2.073
  Silicate (umol/l): 1.179 - 70.561

Graphical representation

Temperature range (°C): -1.542 - 24.813

Nitrate (umol/L): 0.065 - 29.325

Salinity (PPS): 6.428 - 36.842

Oxygen (ml/l): 4.763 - 9.061

Phosphate (umol/l): 0.086 - 2.073

Silicate (umol/l): 1.179 - 70.561
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tundra lakes in summer, open ocean, rocky coastlines and islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Britain, this species breeds around the coast (4) in open sand or shingle habitats or in moorland and coastal heathland (3). As they are vulnerable to predation, they often breed on offshore islands areas where there are no mammal predators such as rats and mink (3). In winter this species stays out at sea, resting on floating objects and ice (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in breeding areas April-June (late May to mid-June in Beaufort Sea area), departs by August-September (Bent 1921). Migrates mainly well offshore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Extensive migration south to Antarctica.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Arctic terns hover 30-40 feet over the water on beating wings and then dive suddenly into the water with a splash, often completely submerging to catch small fishes such as capelin, sand launae, sand eel, and small crustaceans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats small fishes and crustaceans obtained by diving from air into surface water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds mainly on fish, crustaceans and insects. Also eats mollusks, marine worms, earthworms, and berries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Sterna paradisaea (Sterna paradisaea Arctic tern) preys on:
Sprattus sprattus
Clupea harengus
Anguilla anguilla
Ammodytes tobianus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of nesting occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Global breeding population is estimated at between 1 to 2 million pairs; includes primarily coastal estimates of about 12,800 pairs on the Atlantic U.S. coast; 80,000 pairs in Greenland; 200,000-500,000 pairs in Iceland; 72,000 pairs in Scotland; 70,000 pairs elsewhere in Atlantic Europe; 50,000 pairs in Baltic European countries; several hundred thousand in Russia; and several hundred thousand in Alaska (Lensink 1984, Hatch 2002). Few estimates exist for interior-nesting birds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Visitor
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Category

Visitor
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
408 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 34 years (wild) Observations: As with other terns, these animals are long-lived. No senescence has been demonstrated in the Artic tern (Roger Gosden 1996). A 34-year-old individual was released and appeared in excellent health (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

They nest in colonies defended by the males in the rocky or sandy beaches of the far north. The nest usually consists of a hollow in sand, gravel or moss. In June-July, 2-3 brown or greenish eggs with brown speckles are incubated for 21-22 days. Young fly about 21-28 days after hatching

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 21 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lays clutch of 2-3 eggs, June-July. Incubation, by both sexes, 20-24 days. Young are tended by both parents, may leave nest soon after hatching but remain nearby, first fly at 20-23 days (then still fed by parents). Nests usually in small scattered colonies, in large dense colonies only at southern edge of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 3-4 years old. Nests are built by both sexes on open ground among colonies. 1-3 eggs, incubated by both partners for 20-24 days. Young are fed by both parents. First flight occurs around 21-28 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sterna paradisaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGATATCGGTACCCTTTACCTAATTTTCGGCGCATGAGCCGGTATAGTGGGCACTGCCCTTAGCCTACTCATTCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGAGATGACCAAATCTATAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGGGGCTTCGGAAACTGATTAGTCCCACTTATAATTGGTGCCCCCGACATGGCATTCCCGCGCATAAACAACATAAGCTTCTGACTGCTTCCTCCATCATTCTTACTTCTCCTAGCCTCTTCTACAGTAGAGGCTGGAGCAGGCACAGGATGAACTGTATACCCCCCTCTAGCTGGTAATCTAGCCCATGCTGGGGCTTCAGTAGACTTGGCAATCTTCTCCCTCCACCTAGCAGGTGTGTCCTCTATCCTGGGTGCTATCAACTTTATCACCACGGCCATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCTCTATTTGTATGATCAGTACTTATCACTGCCGTCCTACTACTACTCTCGCTCCCAGTACTCGCCGCCGGCATCACTATATTATTAACAGACCGAAACCTAAACACAACGTTCTTTGACCCTGCTGGGGGTGGTGACCCTGTACTATATCAACATCTATTCTGATTTTTTGGTCACCCAGAAGTATATATCTTAATCTTACCAGGATTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sterna paradisaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)