Articles on this page are available in 2 other languages: Spanish (1), Dutch (1) (learn more)

Overview

Brief Summary

The Arctic Tern (Sterna paradisaea) is perhaps best known for its extraordinary annual migration, which is often cited as the longest seasonal distance traveled by any animal. It has long been known that the Arctic Tern breeds in the Arctic and migrates each year to spend the northern winter at high latitudes in the Southern Ocean. Until recently, what has been known about the Arctic Tern's migration has come from limited banding recoveries and at-sea observations. Thanks to new technology, however, far more detailed data on this small (<125 grams) bird's annual migration are now available. Egevang et al. (2010) fitted 11 Arctic Terns with miniature (1.4 gram) geolocators. They found that the annual distances traveled are, in fact, even greater than previously believed--more than 80,000 km annually for some individuals. All tracked terns migrated south to spend the austral summer (December–March) south of 58° S and between 0 and 61° W in the Atlantic sector of the Southern Ocean. This region, which includes the Weddell Sea, is particularly productive, and supports higher densities of a key prey for many seabirds, Antarctic krill (Euphausia superba), than do other regions of the Southern Ocean. All birds began the return migration to breeding colonies in early–mid April, always traveling over deep water at considerable distance from continental shelf margins.

Egevang et al. note that the routes used for both the southbound and northbound migrations showed a high level of congruence with parts of those taken by Manx Shearwater (Puffinus puffinus) and Cory’s Shearwater (Calonectris diomedea), which also winter in the South Atlantic (although considerably farther north than the Arctic Tern). Thus, despite their small size, Arctic Terns apparently exploit the prevailing global wind systems (clockwise in the North, and counter-clockwise in the South Atlantic) much as the substantially larger shearwaters do, as has been previously suggested. These new geotracking studies found that the main wintering region was the marginal ice zone around Antarctica, which agrees with at-sea observations. The mean duration of the northbound migration was about 40 days (range 36 to 46). Mean duration of the southbound migration was about 93 days (range 69 to 103). (Egevang et al. 2010)

Egevang et al. (2010) provide the following summary of key statistics derived from their study, showing mean (range):

Total distance traveled on migration: 70,900 km (59,500–81,600 km)
Distance traveled on southbound migration: 34,600 km (28,800–38,500 km)
Distance traveled per day on southbound migration: 330 km per day (280–390 km per day)
Distance traveled on northbound migration: 25,700 km (21,400–34,900 km)
Distance traveled per day on northbound migration: 520 km per day (390–670 km per day)
Distance traveled within winter site: 10,900 km (2,700–21,600 km)

Perhaps most striking, the tracked birds were found to travel nearly twice the total distance generally cited for the annual Arctic Tern migration (typically quoted as ~ 40,000 km). Given that Arctic Terns can live for more than 30 years, the total distance traveled in a lifetime may exceed 2.4 million km, equivalent to approximately three round-trip journeys to the Moon. (Egevang et al. 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Arctic terns are the champion of all migrating birds. They migrate the furthest south to overwinter, as far as the South Pole ice. In the spring, they return to their breeding grounds in the North Sea area or further northwards. In total, they make an annual trip of around 35,000 kilometers per year! A young Arctic tern supplied with a transmitter in Groningen in the summer of 2011 flew at least 90,000 kilometers in 273 days. If you realize that Arctic terns can reach an age of 30 years and make this trip every year, than this tern possibly flies more than 2.7 million km in its entire life. That is equivalent to approximately 3 return trips to the moon!
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Arctic tern is a long-distance migrant, making a staggering annual round-trip from its Arctic or northern temperate breeding range to the Antarctic where it spends winter (3). This is probably the longest migration undertaken by any bird (2) and means that the Arctic tern sees more sunlight each year than any other animal, as they experience a 'second summer' by travelling south in winter (5). They are very similar in appearance to the common tern (Sterna hirundo), so much so that birdwatchers call unidentified terns 'commic terns', an amalgamation of the two common names (6). Arctic terns are slightly smaller than common terns, and have a shorter bill and longer tail (2). The rump is white, the underparts are darker and the wing lacks the dark wedge on the outer edge, which is a key identifying feature of common terns (6) . During summer, the bill becomes bright red and lacks the black tip seen in common terns (2). Long tail streamers also develop in summer (2). A 'kee-arr' alarm call and a piping 'pi-pi-pi-pi-pi' call are produced (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The Arctic tern tends to arrive back in its breeding habitats after the long migration from May to June (3). Males court females with a 'fish flight', an impressive aerial display which culminates in the male presenting the female with a 'gift' in the form of a fish (6). Nesting tends to occur in a hollow on the ground at a good distance from the shore in short vegetation (4) (6). Pairs, which mate for life, produce between one and three eggs, which are incubated for up to 24 days (3) (6). After a further 24 days or so, the chicks will have fully fledged. The males defend the nests if they are threatened, by diving at potential predators and livestock (6).  Arctic terns are very long-lived species, with a maximum recorded life-span of 29 years (3). This species feeds mainly on fish, particularly sand eels (3) (4), which they catch by making short dives into the water (6). Feeding tends to occur within 3 km of the breeding colony, although they have been recorded to travel 10 km away in order to feed (4). When the breeding season is over, these birds head off once more on their long journey south (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Introduction

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

North America; Oceania; range extends from the Arctic to the Bay of Fundy region
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Arctic Tern has a circumpolar range, breeding in the Arctic and subarctic regions of Europe, Asia and North America as far south as Brittany, France and Massachusetts (USA). It is a transequatorial migrant, and can be found wintering throughout the Southern Ocean to the edge of the Antarctic ice and the southern tips of South America and Africa (del Hoyo et al. 1996). Overall population trends are relatively unknown, though the 2008 breeding season in the north of the United Kingdom was reported to be a failure by the RSPB.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Arctic circumpolar; winters sub-Antarctic and Antarctic seas.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Circumpolar; nests on Northern European islands and peninsulas from Iceland to Northern Russia/Siberia, British Isles, Netherlands, Denmark, Sweden, the Baltic Nations, Northern Alaska, extreme of Northern Canada, Greenland, Newfoundland, and south along Atlantic Coast to Massachussetts; winters in S. Hemisphere in subantarctic and Antarctic waters of Atlantic, Pacific, and Indian Oceans.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from northern Alaska east to northern Ellesmere Island, south to the Aleutian Islands, northwestern British Columbia, northwestern Saskatchewan, northern Ontario, New Brunswick, and along Atlantic coast, locally to Maine and Massachusetts; a disjunct colony exists in Puget Sound, Washington, and solitary nesters in northcentral Montana. Outside North America, nesting occurs in Greenland on all coasts; in the Palearctic north to Iceland, Svalbard, and Franz Josef Land, and south to the Netherlands and sparsely in Belgium, Ireland, and northwestern France; and in northern Russia and widely along Russian far eastern arctic coasts (Wrangel Island, Chukotska and Kamchatka Peninsulas south to Sakhalin Island) (Hatch 2002).

During the nonbreeding season, this species occurs primarily in the antarctic and subantarctic regions of the Southern Hemisphere, with small numbers reported throughout the year from Namibia to Mozambique, southern Australia, and New Zealand (Hatch 2002). Migrants occur widely in areas between the breeding areas and antarctic region.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Arctic terns breed around the Arctic and temperate northern parts of the northern Hemisphere. They travel massive distances to overwinter in the Southern Ocean and Antarctica (4). The population that breeds in Britain and Ireland is at the southern-most limit of its breeding range. This range extends through Greenland and Iceland, along the Baltic and Scandinavian coasts reaching into Siberia. Most of the British breeding population occurs in Scotland, Orkney, Shetland and the Hebrides. Populations also occur in England in the northwest and northeast and there are small numbers in Norfolk and around the southern coast; they also breed in Anglesey in Wales (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Arctic terns are 14-17''(36-43 cm) long with a wingspread of 29-33''(74-84 cm). They are white with black caps and gray mantles, and a deeply-forked tail. In spring and summer, the entire bill is blood-red. Their legs are so short that the birds appear to be crouched when standing.

Average mass: 100 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 39 cm

Weight: 110 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 33-41 cm. Plumage: tail, rump, back and wings pale grey, wingtips darker grey; hind neck white; forehean white, forecrown speckled white; below white; breeding bird has pearl grey below, cheeks white; deeply forked tail extends slightly beyond wing. Immature browner on back. Bare parts: iris dark brown; bill red in breeding and black in non-breeding birds; feet and legs red in breeding and black in non-breeding. Habitat: open ocean and seashores. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type; Type for Sterna paradisaea
Catalog Number: USNM 64404
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): F. Benner
Year Collected: 1873
Locality: Casco Bay, Peak Island, Cumberland, Maine, United States, North America
  • Type: Benner. 1874. Ann. Rep. Smithsonian Inst. For 1873. 60.; Type: Ridgway. July 1874. American Naturalist. 8: 433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The species is a very strong migrant and makes exceptional long-distance movements offshore or along western continental coastlines (del Hoyo et al. 1996, Melville and Shortridge 2006) between its high Arctic breeding grounds and Antarctic wintering grounds (del Hoyo et al. 1996). It breeds between May and July (although the exact timing varies with temperature and food availability) in solitary pairs or colonies of a few to several hundred pairs (usually 2-25) (del Hoyo et al. 1996), and remains gregarious throughout the year especially when roosting, foraging (Snow and Perrins 1998) and on passage (Higgins and Davies 1996). The species generally feeds within 3 km of breeding colonies but may occasionally forage up to 50 km away (del Hoyo et al. 1996). On its wintering grounds in Antarctica it may also forage in association with Antarctic Minke Whale Balaenoptera bonaerensis in the open ocean north of the pack-ice zone (Higgins and Davies 1996). Habitat Breeding The species breeds along northern coastlines (del Hoyo et al. 1996)and on inshore islands (Flint et al. 1984, Snow and Perrins 1998) as well as inland on tundra and forest-tundra (Flint et al. 1984). It shows a preference for habitats with a vegetation cover of less than 40 %, nesting on sand or shingle beaches, ridges (del Hoyo et al. 1996) and spits (Flint et al. 1984), rocky ground (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996) and small islands (Flint et al. 1984, del Hoyo et al. 1996, Snow and Perrins 1998) in lakes and coastal lagoons (del Hoyo et al. 1996). It may also nest on islets or banks along rivers (Snow and Perrins 1998), on swampy tundra (Flint et al. 1984, del Hoyo et al. 1996) and peatlands with bog hummocks (del Hoyo et al. 1996) and reed-covered flats (Flint et al. 1984), or on inland heaths, rough pastures (del Hoyo et al. 1996, Snow and Perrins 1998), meadows (del Hoyo et al. 1996) and sedge grassland (Snow and Perrins 1998) not far from water (Flint et al. 1984). The species also forages offshore, in ice-filled coastal bays or over wet tundra (del Hoyo et al. 1996). Non-breeding On passage it largely flies over open ocean (Snow and Perrins 1998) resting at sea on kelp, logs or flotsam, but may occur inland or along coastlines on beaches, reefs and spits (Higgins and Davies 1996). During the winter the species is pelagic, foraging at the edges of pack-ice, icebergs and ice-floes near shore (especially in channels between ice-floes) (Higgins and Davies 1996) and up to 24 km offshore (Higgins and Davies 1996, del Hoyo et al. 1996) often in association with Antarctic Minke Whale Balaenoptera bonaerensis (Higgins and Davies 1996). It also roosts on ice-floes and icebergs during this season (Higgins and Davies 1996). Diet Its diet consists predominantly of fishas well as crustaceans (especially planktonic species), molluscs, insects (e.g. caterpillars, Chironomidae) and earthworms (del Hoyo et al. 1996). It will also take berries in the early spring on arrival on its breeding grounds but does not readily switch to other prey items when preferred prey supplies fail (del Hoyo et al. 1996). Breeding site The nest is a shallow scrape (del Hoyo et al. 1996) in sand, shingle or turf (Richards 1990) on beaches, ridges (del Hoyo et al. 1996) and spits (Flint et al. 1984), rocky ground (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996), small islands (Flint et al. 1984, del Hoyo et al. 1996, Snow and Perrins 1998) in lakes, coastal lagoons (del Hoyo et al. 1996) and rivers (Snow and Perrins 1998), swampy tundra (Flint et al. 1984, del Hoyo et al. 1996) and peatlands with bog hummocks (del Hoyo et al. 1996) and reed-covered flats (Flint et al. 1984), or on inland heaths, rough pastures (del Hoyo et al. 1996, Snow and Perrins 1998), meadows (del Hoyo et al. 1996) and sedge grassland (Snow and Perrins 1998) not far from water (Flint et al. 1984). It will also nest on artificial structures (del Hoyo et al. 1996). Management information Removing feral American mink Neovison vison from a large archipelago with many small islands in the Baltic Sea resulted in an increase in the breeding density of this species in the area (Nordstrom et al. 2003). Gull control measures may also be practised successfully at some sites to reduce predation and displacement, especially when carried out in conjunction with the use of recordings and models to induce recolonistion of nesting terns (Buckley and Buckley 1984).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

All terns live along seacoasts and around interior lakes and marshes.

Terrestrial Biomes: tundra ; taiga ; forest ; icecap

Aquatic Biomes: lakes and ponds; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2811 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1917 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.542 - 24.813
  Nitrate (umol/L): 0.065 - 29.325
  Salinity (PPS): 6.428 - 36.842
  Oxygen (ml/l): 4.763 - 9.061
  Phosphate (umol/l): 0.086 - 2.073
  Silicate (umol/l): 1.179 - 70.561

Graphical representation

Temperature range (°C): -1.542 - 24.813

Nitrate (umol/L): 0.065 - 29.325

Salinity (PPS): 6.428 - 36.842

Oxygen (ml/l): 4.763 - 9.061

Phosphate (umol/l): 0.086 - 2.073

Silicate (umol/l): 1.179 - 70.561
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: NON-BREEDING: mostly pelagic, rarely in coastal bays and estuaries. Migrates primarily at sea along coasts. BREEDING: Nests on ground on rocky, sandy, gravelly, or grass-covered coasts and islands, in far north on islands in lakes and ponds and in marshes and on riverine gravel bars, sometimes on open tundra (Terres 1980). See Spendelow and Patton (1988) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Britain, this species breeds around the coast (4) in open sand or shingle habitats or in moorland and coastal heathland (3). As they are vulnerable to predation, they often breed on offshore islands areas where there are no mammal predators such as rats and mink (3). In winter this species stays out at sea, resting on floating objects and ice (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in breeding areas April-June (late May to mid-June in Beaufort Sea area), departs by August-September (Bent 1921). Migrates mainly well offshore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Arctic terns hover 30-40 feet over the water on beating wings and then dive suddenly into the water with a splash, often completely submerging to catch small fishes such as capelin, sand launae, sand eel, and small crustaceans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats small fishes and crustaceans obtained by diving from air into surface water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Sterna paradisaea (Sterna paradisaea Arctic tern) preys on:
Sprattus sprattus
Clupea harengus
Anguilla anguilla
Ammodytes tobianus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of nesting occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Global breeding population is estimated at between 1 to 2 million pairs; includes primarily coastal estimates of about 12,800 pairs on the Atlantic U.S. coast; 80,000 pairs in Greenland; 200,000-500,000 pairs in Iceland; 72,000 pairs in Scotland; 70,000 pairs elsewhere in Atlantic Europe; 50,000 pairs in Baltic European countries; several hundred thousand in Russia; and several hundred thousand in Alaska (Lensink 1984, Hatch 2002). Few estimates exist for interior-nesting birds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Visitor
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
408 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 34 years (wild) Observations: As with other terns, these animals are long-lived. No senescence has been demonstrated in the Artic tern (Roger Gosden 1996). A 34-year-old individual was released and appeared in excellent health (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

They nest in colonies defended by the males in the rocky or sandy beaches of the far north. The nest usually consists of a hollow in sand, gravel or moss. In June-July, 2-3 brown or greenish eggs with brown speckles are incubated for 21-22 days. Young fly about 21-28 days after hatching

Average time to hatching: 21 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lays clutch of 2-3 eggs, June-July. Incubation, by both sexes, 20-24 days. Young are tended by both parents, may leave nest soon after hatching but remain nearby, first fly at 20-23 days (then still fed by parents). Nests usually in small scattered colonies, in large dense colonies only at southern edge of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sterna paradisaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sterna paradisaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGATATCGGTACCCTTTACCTAATTTTCGGCGCATGAGCCGGTATAGTGGGCACTGCCCTTAGCCTACTCATTCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGAGATGACCAAATCTATAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGGGGCTTCGGAAACTGATTAGTCCCACTTATAATTGGTGCCCCCGACATGGCATTCCCGCGCATAAACAACATAAGCTTCTGACTGCTTCCTCCATCATTCTTACTTCTCCTAGCCTCTTCTACAGTAGAGGCTGGAGCAGGCACAGGATGAACTGTATACCCCCCTCTAGCTGGTAATCTAGCCCATGCTGGGGCTTCAGTAGACTTGGCAATCTTCTCCCTCCACCTAGCAGGTGTGTCCTCTATCCTGGGTGCTATCAACTTTATCACCACGGCCATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCTCTATTTGTATGATCAGTACTTATCACTGCCGTCCTACTACTACTCTCGCTCCCAGTACTCGCCGCCGGCATCACTATATTATTAACAGACCGAAACCTAAACACAACGTTCTTTGACCCTGCTGGGGGTGGTGACCCTGTACTATATCAACATCTATTCTGATTTTTTGGTCACCCAGAAGTATATATCTTAATCTTACCAGGATTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foxes, raccoons, weasels, rats, gulls, and other seabirds are all predators of terns and their eggs. Massive spraying of marshes with insecticides (DDT) for mosquito control has killed many terns through their consumption of DDT-laden minnows. In the last decade of the 19th century and in the first decade of the present one, plume hunters killed tens of thousands of terns for their plumage for women's hats.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Secure: common, widespread, and abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Amber List (medium conservation concern) (3). Receives general protection in Great Britain under the Wildlife and Countryside Act and listed under Annex I of the EC Birds Directive. Listed as a Species of European Conservation Concern (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.2,000,000 individuals (Wetlands International 2006), while the population in Russia has been estimated at c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is potentially threatened by climate change because it has a geographically bounded distribution: its global distribution is restricted to within c.10o latitude from the polar edge of continent and within which 20-50% of current vegetation type is projected to disappear under doubling of CO2 levels (Birdlife International, unpublished data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: This species is vulnerable to food shortages, predation (including egg predation by humans), pollution, and habitat degradation and loss (Howes and Montevecchi 1993). Disturbance at colony sites could cause desertion or declines (Howes and Montevecchi 1993), but terns have also shown potential for habituation to human activity under certain conditions. Growing gull populations have displaced terns from breeding habitat in some parts of Atlantic Canada and increased predation on young and eggs (Lock 1992). Climatic warming could decrease abundance or change distribution of ice-associated prey species such as the Arctic cod.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is listed on the Birds of Conservation Concern Amber List; its population has experienced periodic declines since the 1980s and low breeding success throughout the 1990s (4). Declines have also occurred elsewhere in Europe. The main threats facing this species include nest predation by hedgehogs, introduced American mink (Mustela vison) and rats, as well as coastal development, disturbance by recreational activities, and a lack of the most important food source, sandeels, possibly caused by over-fishing by humans (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Gull control has been beneficial for this species in Maine (Buckley and Buckley 1984). See Minsky (1981) for discussion of tern management on Cape Cod.

Biological Research Needs: Very little is known about nonbreeders in the antarctic, where most of the mortality occurs. Better information is needed on wintering ecology in the southern hemisphere and threats to breeding populations in the northern hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

38% of the British breeding population occurs within Special Protection Areas (SPAs) and so the species receives a level of protection at these sites (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Once hunted for their feathers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: In Greenland, egg-collecting is an important source of mortality (Evans 1984a).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arctic Tern

The Arctic Tern (Sterna paradisaea) is a seabird of the tern family Sternidae. This bird has a circumpolar breeding distribution covering the Arctic and sub-Arctic regions of Europe, Asia, and North America (as far south as Brittany and Massachusetts). The species is strongly migratory, seeing two summers each year as it migrates along a convoluted route from its northern breeding grounds to the Antarctic coast. Recent studies have shown average annual roundtrip lengths of about 70,900 km (c. 44,300 miles) for birds nesting in Iceland and Greenland[3] and c. 90,000 km (c. 55,900 miles) for birds nesting in the Netherlands.[4] These are by far the longest migrations known in the animal kingdom. The Arctic Tern flies as well as glides through the air, performing almost all of its tasks in the air. It nests once every one to three years (depending on its mating cycle); once it has finished nesting it takes to the sky for another long southern migration.

Arctic Terns are medium-sized birds. They have a length of 33–39 cm (13–15 in) and a wingspan of 76–85 cm (26–30 in). They are mainly grey and white plumaged, with a red beak (as long as the head, straight, with pronounced gonys) and feet, white forehead, a black nape and crown (streaked white), and white cheeks. The grey mantle is 305 mm, and the scapulae are fringed brown, some tipped white. The upper wing is grey with a white leading edge, and the collar is completely white, as is the rump. The deeply forked tail is whitish, with grey outer webs. The hindcrown to the ear-coverts is black.

Arctic Terns are long-lived birds, with many reaching thirty years of age. They eat mainly fish and small marine invertebrates. The species is abundant, with an estimated one million individuals. While the trend in the number of individuals in the species as a whole is not known, exploitation in the past has reduced this bird's numbers in the southern reaches of its range.

Distribution and migration[edit]

The Arctic Tern has a continuous worldwide circumpolar breeding distribution; there are no recognized subspecies. It can be found in coastal regions in cooler temperate parts of North America and Eurasia during the northern summer. While wintering during the southern summer, it can be found at sea, reaching the northern edge of the Antarctic ice.[5]

The Arctic Tern is famous for its migration; it flies from its Arctic breeding grounds to the Antarctic and back again each year, the shortest distance between these areas being 19,000 km (12,000 mi). The long journey ensures that this bird sees two summers per year and more daylight than any other creature on the planet.[6] One example of this bird's remarkable long-distance flying abilities involves an Arctic Tern ringed as an unfledged chick on the Farne Islands, Northumberland, UK, in the northern summer of 1982, which in October 1982, just three months from fledging, reached Melbourne, Australia. Assuming a direct route of flight, the distance covered would have been more than 22,000 km (14,000 mi).[7] Another example is that of a chick ringed in Labrador, Canada, on 23 July 1928. It was found in South Africa four months later.[8]

A 2010 study using tracking devices attached to the birds showed that the above examples are not unusual for the species. In fact, it turned out, previous research had seriously underestimated the annual distances travelled by the Arctic Tern. Eleven birds that bred in Greenland or Iceland covered 70,900 km (44,100 mi)  on average in a year, with a maximum of 81,600 km (50,700 mi). The difference from previous estimates is due to the birds' taking meandering courses rather than following a straight route as was previously assumed. The birds follow a somewhat convoluted course in order to take advantage of prevailing winds.[3] The average Arctic Tern lives about twenty years, and will, based on the above research, travel some 2.4 million km (1.5 million mi) during its lifetime.

A 2013 tracking study of half a dozen Arctic Terns breeding in the Netherlands[4] shows average annual migrations of c. 90,000 km (56,000 mi). On their way south, these birds roughly followed the coastlines of Europe and Africa.[9] Having rounded the southern tip of Africa, they then turned east, some flying approximately halfway to Australia before again turning south to eventually reach Wilkes Land in the north-eastern Antarctic. One bird flew several hundred km along the south coast of Australia before turning east for the Antarctic, while one flew along the entire south coast of Australia, passing between Australia and Tasmania. Having reached the Melbourne area, it turned south and flew in an arc to Wilkes Land in the north-east Antarctic, passing the south-western tip of New Zealand's South Island en route. Once back in the Netherlands, this bird had journeyed c. 91,000 km (57,000 mi), the longest migration yet recorded for any animal.

Arctic Terns usually migrate sufficiently far offshore that they are rarely seen from land outside the breeding season.[10]

Description and taxonomy[edit]

An Arctic Tern in Finland

The Arctic Tern is a medium-sized bird around 33–36 cm (13–15 in) from the tip of its beak to the tip of its tail. The wingspan is 76–85 cm.[10] The weight is 86–127 g (3.0–4.5 oz). The beak is dark red, as are the short legs and webbed feet. Like most terns, the Arctic Tern has high aspect ratio wings and a tail with a deep fork.[10]

The adult plumage is grey above, with a black nape and crown and white cheeks. The upperwings are pale grey, with the area near the wingtip being translucent. The tail is white, and the underparts pale grey. Both sexes are similar in appearance. The winter plumage is similar, but the crown is whiter and the bills are darker.[10]

An Arctic Tern in flight with wings spread

Juveniles differ from adults in their black bill and legs, "scaly" appearing wings, and mantle with dark feather tips, dark carpal wing bar, and short tail streamers.[10] During their first summer, juveniles also have a whiter forecrown.[11]

The species has a variety of calls; the two most common being the alarm call, made when possible predators (such as humans or other mammals) enter the colonies, and the advertising call.[12] The advertising call is social in nature, made when returning to the colony and during aggressive encounters between individuals. It is unique to each individual tern and as such it serves a similar role to the bird song of passerines, identifying individuals. Eight other calls have been described, from begging calls made by females during mating to attack calls made while swooping at intruders.

While the Arctic Tern is similar to the Common and Roseate Terns, its colouring, profile, and call are slightly different. Compared to the Common Tern, it has a longer tail and mono-coloured bill, while the main differences from the Roseate are its slightly darker colour and longer wings. The Arctic Tern's call is more nasal and rasping than that of the Common, and is easily distinguishable from that of the Roseate.[13]

This bird's closest relatives are a group of South Polar species, the South American (Sterna hirundinacea), Kerguelen (S. virgata), and Antarctic (S. vittata) Terns.[14] On the wintering grounds, the Arctic Tern can be distinguished from these relatives; the six-month difference in moult is the best clue here, with Arctic Terns being in winter plumage during the southern summer. The southern species also do not show darker wingtips in flight.

The immature plumages of Arctic Tern were originally described as separate species, Sterna portlandica and Sterna pikei.[15]

Reproduction[edit]

A nesting Arctic Tern at Farne Islands, Northumberland, England.
Chick camouflaged in creek bed (centre of picture), Coppermine River, Nunavut

Breeding begins around the third or fourth year.[16] Arctic Terns mate for life, and in most cases, return to the same colony each year.[17] Courtship is elaborate, especially in birds nesting for the first time.[18] Courtship begins with a so-called "high flight", where a female will chase the male to a high altitude and then slowly descend. This display is followed by "fish flights", where the male will offer fish to the female. Courtship on the ground involves strutting with a raised tail and lowered wings. After this, both birds will usually fly and circle each other.[18]

An Arctic Tern chick on the Farne Islands, Northumberland, England.

Both sexes agree on a site for a nest, and both will defend the site. During this time, the male continues to feed the female. Mating occurs shortly after this.[18] Breeding takes place in colonies on coasts, islands and occasionally inland on tundra near water. It often forms mixed flocks with the Common Tern. It lays from one to three eggs per clutch, most often two.[10]

An Arctic Tern protecting nest near Markarfljot river in south Iceland.

It is one of the most aggressive terns, fiercely defensive of its nest and young. It will attack humans and large predators, usually striking the top or back of the head. Although it is too small to cause serious injury to an animal of a human's size, it is still capable of drawing blood, and is capable of repelling many raptorial birds and smaller mammalian predators such as foxes and cats.[6] Other nesting birds, such as alcids, often incidentally benefit from the protection provided by nesting in an area defended by Arctic Terns.

Arctic Tern nest with two eggs, at Thingvellir National Park, Iceland

The nest is usually a depression in the ground, which may or may not be lined with bits of grass or similar materials. The eggs are mottled and camouflaged.[10] Both sexes share incubation duties. The young hatch after 22–27 days and fledge after 21–24 days.[10] If the parents are disturbed and flush from the nest frequently the incubation period could be extended to as long as 34 days.[12]

When hatched, the chicks are downy. Neither altricial nor precocial, the chicks begin to move around and explore their surroundings within one to three days after hatching.[19] Usually, they do not stray far from the nest. Chicks are brooded by the adults for the first ten days after hatching.[20] Both parents care for hatchlings.[10] Chick diets always include fish, and parents selectively bring larger prey items to chicks than they eat themselves.[12] Males bring more food than females. Feeding by the parents lasts for roughly a month before being weaned off slowly.[10] After fledging, the juveniles learn to feed themselves, including the difficult method of plunge-diving.[21] They will fly south to winter with the help of their parents.[22]

Arctic Terns are long-lived birds that spend considerable time raising only a few young, and are thus said to be K-selected.[23] The maximum recorded life span for the species is 34 years,[24] although the average lifespan is about 20 years[17][25] A study in the Farne Islands estimated an annual survival rate of 82%.[26]

Ecology and behaviour[edit]

The diet of the Arctic Tern varies depending on location and time, but is usually carnivorous. In most cases, it eats small fish or marine crustaceans.[5][10] Fish species comprise the most important part of the diet, and account for more of the biomass consumed than any other food. Prey species are immature (1–2-year old) shoaling species such as herring, cod, sandlances, and capelin.[6] Among the marine crustaceans eaten are amphipods, crabs and krill. Sometimes, these birds also eat molluscs, marine worms, or berries, and on their northern breeding grounds, insects.[19]

Arctic Terns sometimes dip down to the surface of the water to catch prey close to the surface. They may also chase insects in the air when breeding.[19] It is also thought that Arctic Terns may, in spite of their small size, occasionally engage in kleptoparasitism by swooping at birds so as to startle them into releasing their catches.[19] Several species are targeted—conspecifics, other terns (like the Common Tern), and some auk and grebe species.[12]

While nesting, Arctic Terns are vulnerable to predation by cats and other animals.[5] Besides being a competitor for nesting sites, the larger Herring Gull steals eggs and hatchlings. Camouflaged eggs help prevent this, as do isolated nesting sites.[21] While feeding, skuas, gulls, and other tern species will often harass the birds and steal their food.[27] They often form mixed colonies with other terns, such as Common and Sandwich Terns.

Conservation status[edit]

Close-up

Arctic Terns are considered threatened or species of concern in certain states. They are also among the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds applies.[28] The species reduced population in New England in the late nineteenth-century because of hunting for the millinery trade.[12] Exploitation continues today in western Greenland, where the population of the species has been reduced greatly since 1950.[29]

At the southern part of their range, the Arctic Tern has been reducing in numbers. Much of this is due to lack of food.[11] However, most of these birds' range is extremely remote, with no apparent trend in the species as a whole.[19]

Birdlife International has considered the species to be at lower risk since 1988, believing that there are approximately one million individuals around the world.[2]

Cultural depictions[edit]

The Arctic Tern has appeared on the postage stamps of several countries and dependent territories. The territories include the Åland Islands, Alderney, and Faroe Islands. Countries include Canada, Finland, Iceland, and Cuba.[30]

Further reading[edit]

References[edit]

  1. ^ BirdLife International (2012). "Sterna paradisaea". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Birdlife International. "Arctic Tern — BirdLife Species Factsheet". Retrieved 17 August 2006. 
  3. ^ a b "Arctic terns' flying feat". Reuters. 11 January 2010. Retrieved 20 January 2010. 
  4. ^ a b Fijn, R.C.; Hiemstra, D.; Phillips, R.A.; van der Winden, J. (2013). 'Arctic Terns Sterna paradisaea from the Netherlands migrate record distances across three oceans to Wilkes Land, East Antarctica', ARDEA, vol. 101, pp. 3-12 (abstract).
  5. ^ a b c Royal Society for the Protection of Birds. "Arctic tern". Retrieved 17 August 2006. 
  6. ^ a b c S. Cramp, ed. (1985). Birds of the Western Palearctic. pp. 87–100. ISBN 0-19-857507-6. 
  7. ^ A. Heavisides; M.S. Hodgson; I Kerr (1983). Birds in Northumbria 1982. Tyneside Bird Club. 
  8. ^ "Birds of Nova Scotia: Arctic Tern". Nova Scotia Museum of Natural History. Archived from the original on 24 August 2006. Retrieved 22 August 2006. 
  9. ^ Dutch Arctic Terns migrating to Antarctica via Australia (BirdGuides.com) (with map).
  10. ^ a b c d e f g h i j k Del Hoyo, Josep; Elliott, Andrew; Sargatal, Jordi, eds. (1996). Handbook of the Birds of the World vol. 3. Lynx Edicions. p. 653. ISBN 84-87334-20-2. 
  11. ^ a b Steve N.G. Howell; Alvaro Jaramillo (2006). Jonathan Alderfer, ed. National Geographic Complete Birds of North America. National Geographic Society. pp. 272–73. ISBN 0-7922-4175-4. 
  12. ^ a b c d e J.J. Hatch (2002). "Arctic Tern (Sterna paradisaea)". In A. Poole; & F. Gill. The Birds of North America (Philadelphia, PA.: The Birds of North America). p. 707. 
  13. ^ Klaus Malling Olson; Hans Larsson (1995). Terns of Europe and North America. Princeton University Press. ISBN 0-7136-4056-1. 
  14. ^ E.S. Bridge; A.W. Jones; A.J. Baker (2005). "A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: implications for taxonomy and plumage evolution" (PDF). Molecular phylogenetics and Evolution 35 (2): 459–69. doi:10.1016/j.ympev.2004.12.010. PMID 15804415. Archived from the original on 20 July 2006. Retrieved 7 September 2006. 
  15. ^ Kaufman, Kenn (1990) Peterson Field Guides: Advanced Birding, ISBN 0-395-53517-4, Chapter 18, p. 135
  16. ^ Oscar Hawksley (1957). "Ecology of a breeding population of Arctic Terns" (PDF). Bird-Banding 28 (2): 57–92. doi:10.2307/4510623. Retrieved 1 September 2006. 
  17. ^ a b Perrins (2003), p. 267
  18. ^ a b c Perrins (2003), p. 268
  19. ^ a b c d e Kenn Kaufman (1996). Lives of North American birds. Houghton Mifflin. p. 260. ISBN 0-395-77017-3. 
  20. ^ Klaassen, M; Bech, C; Masman, D; Slagsvold, G (1989). "Growth and energetics of Arctic tern chicks (Sterna paradisaea)" (PDF). Auk 106: 240–48. Retrieved 1 September 2006. 
  21. ^ a b Perrins (2003), p. 269
  22. ^ National Audubon Society. "Arctic Tern (Sterna paradisaea)". Archived from the original on 15 June 2006. Retrieved 1 September 2006. 
  23. ^ Elizabeth A. Schreiber; Joanne Burger (2001). Biology of Marine Birds. Boca Raton: CRC Press. ISBN 0-8493-9882-7. 
  24. ^ Jeremy J. Hatch (1974). "Longevity record for the Arctic Tern" (PDF). Bird-Banding 45. pp. 269–270. Retrieved 7 September 2006. 
  25. ^ Terns. Wildlife of Antarctica. Accessed 29 June 2010.
  26. ^ J.M. Cullen (1957). "Plumage, age and mortality in the Arctic Tern". Bird Study 4 (4): 197–207. doi:10.1080/00063655709475891. 
  27. ^ Perrins (2003), p. 271
  28. ^ AEWA. "African Eurasian Waterbird Agreement Annex II: Species list". Retrieved 17 August 2006. 
  29. ^ K. Hansen (2001). "Threats to wildlife in Greenland". Seabird Group Newsletter 89: 1–2. 
  30. ^ Chris Gibbons. "Arctic Tern stamps". Archived from the original on 28 September 2006. Retrieved 24 August 2006. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic; no subspecies are recognized. Protein electrophoresis and phenetic evidence suggest that this species is most closely related to the common tern (Sterna hirundo) and Antarctic tern (S. vittata); a few reports of hybridization with common, roseate (S. dougallii) and Forster's terns (S. forsteri) exist (Hatch 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!