Overview

Distribution

Range Description

Breeding colonies are found off the coast of south-east Australia, Tasmania and New Zealand. One small colony is also found further north at Norfolk Island (to Australia). Winters in adjacent waters and up the east and west coasts of Australia as far north as the Tropic of Capricorn (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds is. off se Australia, Tasmania, coasts and is. off N. Zealand.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Australasian Gannet generally feeds over continental shelves or inshore waters, seldom far from land. Its diet is comprised mainly of pelagic fish, especially pilchard, anchovies and jack mackerel, but also squid and garfish. Prey is caught mainly by plunge-diving, but it is also seen regularly attending trawlers. Breeding is highly seasonal (Oct - May), nesting on the ground in small but dense colonies. Adults tend to stay within the vicinity of the colony after breeding with young birds dispersing (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 33 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Morus serrator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAATCGATGATTATTCTCAACCAATCATAAAGACATCGGCACTTTATACCTTATCTTCGGTGCTTGGGCTGGCATGGTTGGAACAGCCCTCAGCCTACTTATTCGGGCAGAACTAGGTCAACCCGGAACATTACTAGGCGATGACCAAATTTACAATGTAATCGTTACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTAGTCCCACTTATAATCGGCGCCCCTGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTACTCCCACCATCCTTCTTACTCCTACTAGCCTCATCCACCGTAGAAGCAGGAGCAGGTACAGGATGAACTGTATATCCCCCACTAGCTGGAAACCTGGCCCACGCCGGAGCCTCAGTTGACCTAGCTATCTTTTCCCTCCATCTCGCGGGTGTGTCCTCAATCCTAGGGGCAATCAATTTCATTACAACCGCTATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACTCCATTATTTGTATGGTCAGTTCTCATTACTGCTGTCCTACTTTTACTCTCCCTCCCAGTCCTCGCTGCCGGTATCACCATACTCCTAACTGACCGAAATCTAAACACCACATTCTTTGACCCAGCTGGAGGAGGAGATCCAGTACTGTATCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTCTACATCTTAATCCTCCCAGGCTTTGGAATTATCTCTCACGTAGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Morus serrator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a small range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Australasian Gannet

The Australasian gannet (Morus serrator or Sula bassana), also known as Australian gannet and Tākapu, is a large seabird of the gannet family Sulidae.

Adults are mostly white, with black flight feathers at the wingtips and lining the trailing edge of the wing. The central tail feathers are also black. The head is yellow, with a pale blue-grey bill edged in black, and blue-rimmed eyes.

Young birds have mottled plumage in their first year, dark above and light below. The head is an intermediate mottled grey, with a dark bill. The birds gradually acquire more white in subsequent seasons until they reach maturity after five years.

Their breeding habitat is on islands and the coast of New Zealand, Victoria and Tasmania, with 87% of the adult population in New Zealand. They normally nest in large colonies on coastal islands. In New Zealand there are colonies of over 10,000 breeding pairs each at Three Kings Islands, Whakaari / White Island and Gannet Island. There is a large protected colony on the mainland at Cape Kidnappers (6,500 pairs). There are also mainland colonies at Muriwai and Farewell Spit, as well as numerous other island colonies.[2]

Gannet pairs may remain together over several seasons. They perform elaborate greeting rituals at the nest, stretching their bills and necks skywards and gently tapping bills together. The adults mainly stay close to colonies, whilst the younger birds disperse.

These birds are plunge divers and spectacular fishers, plunging into the ocean at high speed. They mainly eat squid and forage fish which school near the surface. It has the same colours and similar appearance to the northern gannet.

Numbers of Australasian gannet have been increasing since 1950, although some colonies have disappeared and others have decreased in size.

References[edit]

  1. ^ BirdLife International (2012). "Morus serrator". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Maggy Wassilieff. Gannets and boobies - Gannets: description and habitat, Te Ara - the Encyclopedia of New Zealand. Wellington: Ministry for Culture and Heritage. Updated 13 July 2012.

Gallery[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!