Overview

Distribution

Range Description

The Black-legged Kittiwake nests along coastlines in much of the north Pacific and Atlantic oceans, and also breeds on inlands off the northern coast of Russia and on the northern coast of Norway. It winters at sea, ranging across much of the north Atlantic and Pacific oceans1. Overall population trends are unknown, though failed breeding seasons in 2008 and in some cases significant population declines have been observed in the United Kingdom by the RSPB.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

In North America, the Black-legged Kittiwake spans both coasts, as far north as the ice-free waters of Alaska in the west and the Great Banks of Newfoundland in the east. It lives as far south as Baja, California in the west and the tip of Florida in the east. Outside of America it can be found in nearly every coastal area of the world, given the proper habitat is available. This includes the coast of Norway, Britian, France, and the former Soviet Union, along with China, Japan, Korea, Central Europe, and nw. Africa.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Breeding range is circumpolar and primarily includes islands and suitable shores of the Arctic Ocean, southward to the Aleutian Islands and southern Alaska, southeastern Canada, France, Kuril Islands, and Sakhalin, Russia. During the nonbreeding season, the western (Pacific) population occurs primarily from the pack ice edge south to Baja California, Mexico; also along the northern coast of china to Japan, with small numbers in Korea and Turkestan. Eastern populations winter offshore from Newfoundland south to Florida and the Gulf coast. European populations winter south to northwestern Africa. The species occurs casually in Hawaii, interior North America, and Italy (Baird 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumpolar (almost). North Pacific south to Japan and Baja California. Northern Atlantic south to New Jersey, mostly remaining north of 40° N.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Black-legged Kittiwake is a small gull, with a pearl gray back and wings and a stark white head and underside. The tips of the tail feathers are black. The adult bill is uniformly greenish-yellow. In spite of its name, its legs can be orange or red, although they are most commonly black.

Average mass: 317 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 43 cm

Weight: 421 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 39-46 cm, Wingspan: 90-92 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is migratory and disperses after breeding from coastal areas to the open ocean1. It returns to its breeding grounds from January where it breeds from mid-May to mid-June in huge single- or mixed-species colonies1 that often exceed 100,000 pairs1, 4. Breeding may occur later after periods of cold weather and many individuals do not remain on the breeding grounds during such conditions1. The species begins to disperse from the breeding colonies between July and August, often moulting in large flocks of several thousand individuals on beaches between the breeding grounds and the open sea2. Non-breeders may also remain at sea during the breeding season4. Outside of the breeding season the species often occurs singly or in pairs4 but may also occur in small flocks or as dispersed aggregations3, 4. Habitat Breeding It nests on high, steep coastal cliffs with narrow ledges in areas with easy access to freshwater1. Non-breeding The species moults on sandy beaches2 and on passage it may concentrate at sea on continental shelves, areas of upwelling1 and at rich fish banks2. During the winter the species is highly pelagic, usually remaining on the wing out of sight of land1. Diet Its diet consists predominantly of marine invertebrates (e.g. squid and shrimps) and fish, although during the breeding season it may also take intertidal molluscs, crustaceans1 (e.g. crayfish)3, earthworms, small mammals and plant matter (e.g. aquatic plants, potato tubers and grain)1. At sea during the winter it will also take planktonic invertebrates and often exploits sewage outfalls and fishing vessels1. Breeding site The nest is a compacted mass of mud4, grass and feathers3 usually built on a narrow ledge on high, steep coastal cliffs1. Occasionally the species may also nest on glaciers or snow banks (where these have covered traditional cliff nesting sites), on buildings and piers, or on flat, rocky or sandy sites up to 20 km inland1. It breeds in very large colonies with neighbouring nests spaced evenly 30-60 cm apart (where site availability allows)4, and generally feeds within 50 km of the breeding colony1.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Black-legged Kittiwake nests on ledges of offshore islands, sea stacks, or inaccessible areas of coastal mainland. It also nests on steep earthen slopes, large boulders, glaciers, and cliff-like man-made structures, such as shipwrecks and skyscrapers. A true shoreline species, it rarely comes very far inland, even in the winter.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 164328 specimens in 1 taxon.
Water temperature and chemistry ranges based on 105902 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 26.556
  Nitrate (umol/L): 0.038 - 16.868
  Salinity (PPS): 6.218 - 36.400
  Oxygen (ml/l): 4.607 - 9.061
  Phosphate (umol/l): 0.062 - 1.130
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -1.109 - 26.556

Nitrate (umol/L): 0.038 - 16.868

Salinity (PPS): 6.218 - 36.400

Oxygen (ml/l): 4.607 - 9.061

Phosphate (umol/l): 0.062 - 1.130

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: NON-BREEDING: primarily pelagic, sometimes along seacoasts, bays and estuaries, casually on large inland bodies of water (AOU 1983).

BREEDING: Nests on ledges of steep cliffs along coasts or on islands, often in association with other seabirds; sometimes on ledges of buildings. Nest is a cup-like structure of seaweeds, mosses, grasses, and mud.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Offshore, cold and warm water, prefers areas of upwellings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Occurs in winter in southern part of breeding range; migratory status in those areas? Arrives in breeding areas late February-early March in south, April-May in north (Terres 1980). Fall migration from Beaufort Sea region apparently begins in late August (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Move offshore after breeding season.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Unlike many gulls, the Black-legged Kittiwake does not feed at dumps. Rather, it feeds on the water surface. An opportunistic feeder, it feeds on small surface fish and invertebrates. It prefer fishs, and the species consumed most often are capelin, sandlance, arctic cod, pollock, saffron cod, small trout, and young salmon.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on small fishes, mollusks, crustaceans, and plankton. Feeds from surface, mostly at sea; follows ships in large flocks and eats refuse. Drinks salt water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mostly fish. Also eats crustaceans, marine worms, mollusks, squid, insects, sometimes plant material.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: The large global population is estimated at 17 to 18 million birds (Wetlands International 2002). The Pacific subspecies has a breeding population of about 2.6 million individuals at colonies in the eastern North Pacific and adjacent seas (Baird 1994). The western North Atlantic population (Arctic Canada to Gulf of St. Lawrence) is estimated at 900,000 birds, and the western Greenland breeding population includes 300,000-600,000 individuals (Wetlands International 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ravens regularly prey on eggs and chicks and at least sometimes on adults. Adult annual survivorship was about 80% in one study (Aebischer 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
307 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28.5 years (wild) Observations: In the wild, these animals have been observed to become better breeders with time but they also show a decrease in reproductive performance in their last year before they die. The latter could be caused by disease rather than ageing since it was observed in breeders of all ages (Coulson and Fairweather 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Pairs are generally monogamous, although males attempt to mate with other partners. In a study done in Britian, 64% of pairs remained together from one breeding season to the next. Due to their global distribution, it is difficult to give precise copulation, incubation, and hatching dates for kittiwakes. Black-legged Kittiwakes nest on cliffs, and the male retains the same nest site from year to year. After the nest is ready, 1 to 3 eggs are laid. The male and female incubate the eggs for about 25 days. At this time the chicks hatch. The parents seem to share the responsibilities for the chicks evenly, with both sexes feeding and brooding the young.

Average time to hatching: 27 days.

Average eggs per season: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs laid mostly in June at Semidi Islands, Alaska (Hatch and Hatch 1988). Clutch size 1-3 (usually 2). Incubation by both sexes, 23-32 days (Terres 1980) (also reported as 25-31 days). Young tended by both adults, depart nest at 36-53 days (average 42, see Hatch and Hatch 1990); can fly at about 38-48 days (Terres 1980); fledging begins in August in Alaska (Hatch and Hatch 1988). Rarely more than 1 young survives to fledging (Braun and Hunt 1983). Nests in large colonies. In western Alaska, reproductive success generally was low or nil in years with cold spring weather (Murphy et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

First breeds at 3-5 years old. Nests built on cliff edges by both partners. 1-3 eggs incubated by both sexes for 25-28 days. Young do not leave nest until capable of flight, around 34-58 days old. Young are fed by both parents.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rissa tridactyla

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROM450-06|AJB 5531|Rissa tridactyla| AATCGATGATTATTTTCAACAAATCACAAAGACATCGGCACCTTATACCTAATCTTCGGCGCATGAGCTGGCATAGTGGGTACTGCCCTT---AGCCTACTCATTCGTGCAGAACTTGGCCAACCCGGAACCCTCTTAGGAGAC---GACCAGATCTACAACGTAATTGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATGATCGGGGGATTCGGAAATTGACTAGTTCCACTTATA---ATCGGTGCTCCTGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGTTACCCCCATCATTCCTACTCCTCTTAGCCTCTTCCACAGTAGAAGCCGGAGCCGGCACAGGGTGAACAGTATATCCCCCCCTAGCTGGTAACCTAGCCCATGCTGGAGCTTCAGTAGATCTA---GCAATTTTCTCCCTCCACTTAGCAGGTGTATCCTCCATTCTAGGTGCCATTAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCCCTATTCGTATGATCTGTGCTCATCACTGCCGTCCTATTACTACTTTCACTTCCAGTGCTTGCTGCA---GGCATCACTATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGAGGAGGTGACCCCGTACTATATCAACACCTCTTCTGATTCTTTGGTCACCCCGAAGTATACATCCTAATCCTACCAGGCTTTGGAATCATTTCTCATGTTGTAACATACTACGCAGGTAAAAAA---GAACCATTCGGCTATATAGGAATAGTCTGAGCCATACTATCCATTGGATTCCTAGGTTTCATTGTCTGAGCCCACCACATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rissa tridactyla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2009
    Least Concern
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although there is no special status for the Black-legged Kittiwake, fishing poses a possible threat to population size. As fish stocks decline along coastal areas, species that are kittiwake prey are being harvested. This may lead to disasterous effects on the population of kittiwakes, which often depending largely on one major source for food.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Winter visitor? and Regular passage visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Secure: widespread and abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The species is threatened by the depletion of food resources (e.g. through over-fishing)6, 7, marine oil spills1, 6 and chronic oil pollution6. It is also susceptible to avian influenza so may be threatened by future outbreaks of the virus5. The species is potentially threatened by climate change because it has a geographically bounded distribution: its global distribution is restricted to within c.10o latitude from the polar edge of continent and within which 20-50% of current vegetation type is projected to disappear under doubling of CO2 levels (BirdLife International, unpublished data). Utilisation The species is hunted in Greenland1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Potential threats include contamination of breeding and foraging habitat (e.g., from oil spills, contaminants such as mercury, and pesticides), depletion of prey species by commercial fisheries, and natural mortality from predation on eggs, chicks and adults, or chick death by falling from nests in breeding colonies (Baird 1994). These threats are neither widespread nor imminent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Extensively hunted in Greenland (Evans 1984a).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-legged Kittiwake

in Seward, Alaska

The Black-legged Kittiwake (Rissa tridactyla) is a seabird species in the gull family Laridae.

This species was first described by Linnaeus in his Systema naturae in 1758 as Larus tridactylus.[1]

In North America, this species is known as the Black-legged Kittiwake to differentiate it from the Red-legged Kittiwake, but in Europe, where it is the only member of the genus, it is often known just as Kittiwake.

The adults is 37–41 cm (15–16 in) in length with a wingspan of 91–105 cm (36–41 in) and a body mass of 305–525 g (10.8–18.5 oz).[2] It has a white head and body, grey back, grey wings tipped solid black, and have black legs and a yellow bill. Occasional individuals have pinky-grey to reddish legs, inviting confusion with Red-legged Kittiwake. In winter, this species acquires a dark grey smudge behind the eye and a grey hind-neck collar. The name is derived from its call, a shrill 'kittee-wa-aaake, kitte-wa-aaake'.

It is a coastal breeding bird around the north Pacific and north Atlantic oceans, found most commonly in North America and Europe. It breeds in large colonies on cliffs and is very noisy on the breeding ground. Cliff nesting for gulls occurs only in the Rissa species, and the Kittiwake is capable of utilizing the very sheerest of vertical cliffs, as is evident in their nesting sites on Staple Island in the outer Farne Islands (Hogan, 2005). One to two buff spotted eggs are laid in the nest lined with moss or seaweed. The downy young of Kittiwakes are white, since they have no need of camouflage from predators, and do not wander from the nest like Larus gulls for obvious safety reasons.

At fledging, the juveniles differ from the adults in having a black 'W' band across the length of the wings and whiter secondary and primary feathers behind the black 'W', a black hind-neck collar and a black terminal band on the tail. The old fisherman's name of "tarrock" for juvenile Kittiwakes is still occasionally used.

They are fish feeders, and are more pelagic than Larus gulls outside the breeding season. They do not scavenge at tips like some other gull species.

There are two races of Black-legged Kittiwake:

Gallery

References

  1. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.. Holmiae. (Laurentii Salvii).. pp. 136. "L, albicans dorso canescente, rectricibus excepto extimo nigris, pedibus tridaclylis." 
  2. ^ [1] (2011).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Two races: Rissa tridactyla tridactyla (in Europe); and R. t. pollicaris (from the North Pacific). No information is available on genetic differences between subspecies, but R. t. pollicaris generally has a longer bill, slightly larger size, a better developed hind toe/claw, and more black in the primaries (Baird 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!