Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

The adult Magellanic penguin spends the greater part of the year securing a mate and raising chicks. The adults arrive at the nesting sites in September where, if already in a breeding pair, they engage in the repair of the nest, or if lacking a partner, they commence courtship behaviour (2) (4). This involves the male making a loud braying call to advertise for a mate, followed by walking in a circle around an interested female, and finally engaging in flipper patting, in which the male's flippers are vigorously vibrated against the female's body. Once formed, the breeding pairs are long-lasting and are maintained by behaviours such as mutual preening (4). The nests of Magellanic penguins comprise either a simple scrape, often hidden under vegetation, or where soil conditions permit, a burrow, which may be up to 1 metre long ending in a round chamber. After mating, a clutch of two eggs is usually laid, which are incubated by both parent birds, with each taking an initial long shift of just over 2 weeks, while the other forages in the ocean (4). These foraging trips may be incredibly wide ranging, with some individuals tracked as far as 600 kilometres from the breeding colony (5). Towards the end of the 39 to 42 day incubation period the incubation shifts become much shorter. Once hatched the young are brooded for 29 days, during which time they grow a rudimentary layer of feathers that helps them to maintain their body temperature independently. The parents then leave the young unattended and only return to feed them every one to three days (4). During this time, the burrows provide better nesting grounds than surface nests, as they help protect against the wind and rain, although they do, on occasion, become flooded, often resulting in the death of the chicks due to hypothermia (2). After 40 to 70 days (between late Jan and early March) the chicks fledge, and the adults moult their feathers in preparation for returning to the sea. The newly-fledged juveniles and adults then spend May to August following the northward movements of anchovies —their preferred prey— through the ocean, but will also take other fish, squid and crustaceans (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Magellanic penguin is named in honour of the maritime explorer Ferdinand Magellan, who first recorded it during an expedition in 1519 (3). A medium-sized penguin, this species can be identified by the distinctive white bands which loop over the eye, down the side of the neck and meet at the throat (4). A thick, black band also runs adjacent to the border of the breast and belly, extending down the flanks to the thighs (2) (4) Aside from these markings, the colouration of the Magellanic penguin is almost entirely uniform black on the upperparts and white on the breast and belly. However, during the breeding season, the adults lose feathers from around the eye and bill, leaving a distinctive patch of pink skin, with an area of dark pigment in the centre. The Magellanic penguin produces a loud call, similar to that of a donkey bray, which is used most commonly by the males when seeking a mate, but also during other activities such as territorial disputes (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

Spheniscus magellanicus breeds on the Atlantic and Pacific coasts of South America, in Argentina (at 63 sites), Chile (at least 10 locations), and the Falkland Islands (Malvinas)1, with some migrating north to southern Brazil2. A juvenile was discovered in El Salvador in 200710. The world population is estimated at 1,300,000 pairs: 950,000 along the Argentinian coast, 100,000+ in the Falklands (Malvinas) and 200,000+ in Chile1. Population trends differ between colonies. The two largest colonies in Argentina have both shown decreases during the last decade, but other small colonies have grown9.In Argentina, the Caleta Valdes colony increased from two pairs in the early 1960s to 26,000 pairs in the early 1990s; the Isla Deseado colony more than doubled between 1986 and 1996; the colony at Punta Tumbo has decreased almost 30% since 1987 owing to higher juvenile and young adult mortality; and the Cabo Virgenes colony has remained stable for at least the last 10 years1. It is reported that the Falkland Islands colonies have declined almost 50% since the 1980s, but data are insufficient to substantiate this4,7. Overall, trends are uncertain but there are significant declines in some areas and substantial mortality owing to a variety of ongoing threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Magellanic penguins live and breed in the Neotropical region along the southern coast of South America. They are found from about 30°south in Chile to 40° north in Argentina, and the Falkland Islands. Some populations on the Atlantic coast migrate north up to the Tropic of Capricorn.

Biogeographic Regions: neotropical (Native )

  • 2011. "Species factsheet: Spheniscus magellanicus" (On-line). BirdLife International. Accessed March 19, 2011 at http://www.birdlife.org.
  • 2010. "Spheniscus magellanicus" (On-line). IUCN Red List. Accessed February 24, 2011 at http://www.iucnredlist.org/apps/redlist/details/144812/0.
  • Boersma, D. 2009. "Magellanic Penguin" (On-line). Penguin Sentinenels. Accessed February 24, 2011 at http://mesh.biology.washington.edu/penguinProject/Magellanic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

During the breeding season, colonies of Magellanic penguins can be found along the Atlantic and Pacific coasts of southern South America, as far north as Golfo San Matías in Argentina and Puerto Montt in Chile. Colonies also occur on several offshore islands, including the Falklands (2) (5). Outside the breeding season, this species takes to the ocean, migrating north as far as Peru and Southern Brazil (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Magellanic penguins' weights vary with the season. They tend to weigh the most directly prior to molt (which begins in March) since they are preparing to fast for the following few weeks. Males have a mean weight of 4.7 kg and females weigh a mean of 4.0 kg. The mean flipper length for males and females is 15.6 cm and 14.8 cm, respectively. The average beak length is 5.8 cm for males and 5.4 cm for females. Males and females have webbed feet that are, on average, 12.2 cm and 11.5 cm long, respectively. Adults and juveniles both have black bills, black backs, and white fronts. Adults have a symmetrical white band that originates at each eye, arches back on the sides of their heads, and comes together above their necks. Adults also have two black bands underneath their neck; juveniles only have one band. Juveniles display a range of white to dark gray patches on their cheeks. Juveniles have two layers of down before they develop their adult plumage.

Range mass: 2.5 to 7.5 kg.

Range length: 11.2 to 16.9 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Magellanic Penguins tracked by satellite and global location sensor tags during incubation typically foraged more than 100 km, and sometimes as much as 600 km from various colonies in Argentina13. Individuals show high site fidelity, with nearly all birds returning to the colony in which they were born, and most adults using the same burrow year after year14.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Magellanic penguins primarily inhabit temperate regions of South America, but during the non-breeding season may follow oceanic currents northward into more tropical latitudes. During the breeding season, Magellanic penguins nest on shoreline grassland habitats that provide adequate, shrubby vegetative cover, but are near the ocean so parents can easily forage. This species may also nest within burrows on cliff faces. When not breeding, Magellanic penguins live pelagic lifestyle and spend nearly all of their time off the southern coast of South America. Individuals typically travel anywhere from 100 to 1,000 km off shore. While at sea, this species has been recorded to dive to depths of up to 76.2 meters.

Range depth: 76.2 (high) m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • 2011. "Magellanic Penguin" (On-line). Wildlife Conservation Society. Accessed February 24, 2011 at http://www.wcs.org/saving-wildlife/birds/magellanic-penguin.aspx.
  • Boersma, P., D. Stokes, P. Yorio. 1990. Penguin Biology: Reproductive variability and historical change of Magellanic penguins (Spheniscus magellanicus) at Punta Tombo, Argentina. San Diego: Academic Press.
  • Stokes, D., P. Boersma. 1991. Effects of substrate on the distribution of Magellanic Penguin Burrows. The Auk, 108: 923-933. Accessed February 24, 2011 at http://www.jstor.org/pss/4088322.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.060 - 9.650
  Nitrate (umol/L): 8.380 - 26.041
  Salinity (PPS): 32.635 - 33.891
  Oxygen (ml/l): 6.231 - 7.787
  Phosphate (umol/l): 1.263 - 1.689
  Silicate (umol/l): 4.322 - 23.798

Graphical representation

Temperature range (°C): 0.060 - 9.650

Nitrate (umol/L): 8.380 - 26.041

Salinity (PPS): 32.635 - 33.891

Oxygen (ml/l): 6.231 - 7.787

Phosphate (umol/l): 1.263 - 1.689

Silicate (umol/l): 4.322 - 23.798
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

During the breeding season, the Magellanic penguin can be found nesting in grassland, amongst bushes, and on coasts and cliff faces (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Magellanic penguins are piscivores. While their basic diet consists mainly of pelagic fish, their particular choice of prey varies on where they reside. Penguins that inhabit northern colonies, such as San Lorenzo, Punca Clara, Punta Loberia, feed primarily on anchovies. In the southern colonies of Monte Leon and Punta Dungeness, penguins prey on squid (Loligo and Illex species), sprats and hagfish. They can dive more than 76.2 meters while hunting.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore )

  • Laurenti, S., H. Gallelli. 1999. Feeding preferences of the Magellanic penguin over its breeding range in Argentina. Waterbirds: The International Journal of Waterbird Biology, 22: 104-110. Accessed February 23, 2011 at http://www.jstor.org/pss/1521999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

At all life stages, Magellenic penguins are a valuable food source for various terrestrial and aquatic animals. As predators themselves, Magellanic penguins keep local populations of small fish and squid balanced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Penguin eggs and young chicks are prime targets for kelp gulls, lesser grisons and large hairy armadillos. While on land, red foxes, gray foxes, pampas cats and pumas prey on older penguin chicks, juveniles, and adults. Sea dwelling predators, including giant petrels, South American sea lions and orcas, feed on fledglings, juveniles, and adults.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Magellanic penguins perform a variety of vocalizations and are able to discriminate between conspecific calls. Such calls include ecstatic display calls, mutual display calls, fight calls and contact calls. Males perform ecstatic display calls in the beginning of breeding season to attract a mate and during altercations with other males. These calls are described as "braying" for their similarity to the calls of donkeys. Both males and females use a mutual display call when they meet at their nest in the beginning of the breeding season and when they switch duties during incubation. Females respond more strongly to their mates' calls than to other male calls. The females stand up, look around and sometimes call back. Chicks can also discriminate between their parents' mutual calls and the mutual calls of another set of parents.

Mated pairs also use tactile and visual displays to communicate with each other and strengthen their bond. To show interest in a female, the male will walk circles around a potential mate and then pat her rapidly with his flippers. A mated pair will remain together for many years, and often perform mutual preening to uphold their bond.

Studies have suggested that penguins, in general, rely heavily upon their sense of sight to obtain food and navigate underwater. It has been suggested that these birds can see at least a portion of the ultraviolet spectrum. Study of the retina has also revealed that it lacks the ability to perceive the color red, and that they are very adept at perceiving blue or green spectra. This likely is connected to the fact that in the deep ocean, there is an abundance of blue and green coloration while red is rather rare. It has also been suggested that penguins' eyes are specially adapted to aquatic environments, as they share similar sensitivities with the eyes of fish.

Like most birds, Magellanic penguins perceive their environments through visual, tactile, auditory and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: ultraviolet

  • Clark, J., P. Boersma, D. Olmsted. 2006. Name that tune: call discrimination and individual recognition in Magellanic penguins. Animal Behvaiour, 72: 1114-1148. Accessed February 24, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W9W-4KXVD2D-1&_user=1086025&_coverDate=11%2F30%2F2006&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000051441&_version=1&_urlVersion=0&_userid=1086025&md5=bea9b388a03557e6644833079c2f41ac&searchtype=a.
  • Martin, G. 1985. Through a penguin's eye. New Scientist, 105/1447: 29-31.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Magellanic penguins live for an average of 25 to 30 years in the wild. Juvenile penguins suffer the highest mortality rate during their first pelagic migration, but annual survival slowly increases as they age. Causes of mortality for both juveniles and adults include predation, climatic variation, discarded human garbage, oil spills, and commercial fishing.

Typical lifespan

Status: wild:
25 to 30 years.

  • Wildlife Conservation Society. 2011. "Magellanic Penguin" (On-line). Wildlife Conservation Society: Bronx Zoo. Accessed February 24, 2011 at http://www.bronxzoo.com/animals-and-exhibits/animals/birds/magellanic-penguin.aspx.
  • Boersma, P., D. Stokes. 1995. The penguins (Bird families of the world): Conservation: threats to penguin populations. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild) Observations: It is estimated that these animals live up to 30 years in the wild (Scolaro 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Magellanic penguins are a monogamous species that upholds their pair-bonds for many seasons. An unmated male attracts a mate first by calling, which is more accurately described as "braying" like a donkey. Once an interested female comes forward, the male will walk in a circle around her and eventually will rapidly pat her with his flippers. A breeding pair often performs mutual preening to uphold their pair-bond.

Male Magellanic penguins also fight each other for both nests and females. When males fight before females have laid eggs, the larger male typically wins. These winners are more likely to breed and thus have more chicks. The winners' nest sites tend to be more covered and protected from the elements as well. When fighting occurs after egg laying, the winner, regardless of size, is typically the owner of the nest that he is trying to protect.

Mating System: monogamous

Magellanic penguins nest close to shore. They prefer to build their nests under a bush, but will also dig burrows into substrate if necessary. They choose areas where the substrate is composed of small particles such as silt and clay and low amounts of sand. Magellanic penguins breed in dense colonies where nests may be only 123 to 253 cm apart. Adults will arrive at their breeding grounds in early September and lay two eggs in late October. The average annual reproductive success is 0.52 chicks per nest. The clutch hatches asymmetrically, and the first hatched generally is bigger and better able to obtain food from the parents. Thus, one chick typically dies from starvation unless there is an overabundance of food or the colony size is small. Eggs weigh 124.8 grams and are 7.5 cm long. The incubation period lasts for 40 to 42 days and the chick brooding period lasts from 24 to 29 days. The young fledge at 40 to 70 days old, typically during January to the beginning of March. Fledglings group together in creches and immediately take to the water, while adults remain on shore for several weeks to molt. Juvenile Magellanic penguins do not reproduce until 4 years of age.

Breeding interval: Magellanic penguins breed once every year after reaching maturity

Breeding season: The breeding season for Magellanic penguins occurs from September to February

Average eggs per season: 2.

Range time to hatching: 40 to 42 days.

Range fledging age: 40 to 70 days.

Range time to independence: 40 to 70 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1040 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1040 days.

Both male and female penguins defend their nest, eggs, and young. Once the clutch is laid, incubation duties are shared and initially each parent will perform a two-week long shift. Parents switch more frequently as the incubation period progresses. When the young hatch after 40 to 42 days, they are semi-altricial meaning they are downy, immobile, and completely dependent on their parents for food and temperature regulation. Parents continue to alternate incubating and foraging duties, and the young are fed through regurgitation. The young are constantly cared for and brooded for 24 to 29 days, after which the parents spend extended periods of time foraging and will return to the nest every 1 to 3 days. At 40 to 70 days old, the young fledge and immediately take to the water in large groups, or creches. Fledgling penguins do not receive further parental care, as the parents remain on shore to molt. Once the adults have fledged, mixed groups of juvenile and adult penguins migrate north to the wintering grounds.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Williams, T. 1995. The Penguins: Spheniscidae. New York: Oxford University Press.
  • 2011. "Magellanic Penguin" (On-line). Wildlife Conservation Society. Accessed February 24, 2011 at http://www.wcs.org/saving-wildlife/birds/magellanic-penguin.aspx.
  • Boersma, D. 2009. "Magellanic Penguin" (On-line). Penguin Sentinenels. Accessed February 24, 2011 at http://mesh.biology.washington.edu/penguinProject/Magellanic.
  • Borboroglu, P., P. Yorio, P. Boresma, H. Del Valle, M. Bertellotti. 2002. Habitat use and breeding distribution of magellanic penguins in Northern San Jorge Gulf, Pantagonia, Argentina. The Auk, 119/1: 233-239. Accessed April 10, 2011 at http://www.jstor.org/pss/4090029.
  • Martella, M. 2001. "Winning and losing: causes for variability in outcome of fights in male Magellanic penguins (Spheniscus magellanicus)" (On-line). Oxford Journals: Behavioral Ecology. Accessed March 19, 2011 at http://beheco.oxfordjournals.org/content/13/4/462.full.
  • Reid, W., P. Boersma. 1990. Parental quality and selection on egg size in the Magellanic penguin. Evolution, 44: 1780-1786. Accessed February 23, 2011 at http://www.jstor.org/stable/2409506.
  • Stokes, D., P. Boersma. 1998. Nest-site characteristics and reproductive success in Magellanic penguins (Spheniscus magellanicus). The Auk, 115: 34-49. Accessed February 23, 2011 at http://www.jstor.org/pss/4089109.
  • Yorio, P., P. Boersma. 1994. Consequences of nest desertion and inattendance for Magellanic Penguin hatching success. The Auk, 111: 215-218. Accessed March 23, 2011 at http://www.jstor.org/pss/4088528.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spheniscus magellanicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 40 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROMB036-06|MM 5|Spheniscus magellanicus| AACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTTTACCTAATCTTCGGCGCATGAGCAGGCATAGCCGGAACCGCCCTC---AGCCTGCTCATCCGCGCAGAACTCGGTCAACCCGGAACCCTCCTAGGAGAC---GACCAGATCTACAATGTAATTGTTACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCACTTATA---ATCGGCGCCCCCGACATAGCATTTCCCCGCATAAATAACATAAGCTTTTGACTACTACCTCCCTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGGATGAACCGTATACCCACCATTAGCAGGCAACCTAGCCCATGCCGGCGCATCAGTAGACCTA---GCCATTTTTTCACTCCACCTAGCAGGAATCTCCTCCATCCTAGGAGCAATCAACTTCATCACCACCGCCACTAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTGTTCGTATGATCCGTCCTTATCACAGCTGTCCTCCTACTACTCTCACTTCCCGTACTTGCTGCC---GGCATCACCATGCTACTAACAGACCGAAACCTAAACACCACCTTCTTCGATCCAGCTGGAGGGGGAGACCCAATCCTATACCAGCACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATTCTACCAGGCTTCGGAATCATCTCTCACGTAGTAGCATACTATGCAGGCAAAAAG---GAACCCTTTGGCTACATAGGCATAGTATGAGCAATACTGTCCATCGGATTCCTCGGCTTTATCGTATGAGCTCACCACATATTCACAGTCGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Spheniscus magellanicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Species: 43
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s
Woods, R., Nisbet, I., Frere, E., Boersma, P., Komar, O.

Justification
This species has fluctuated in numbers in different parts of its range, but overall moderately rapid declines are thought to have been sustained and as a result it is listed as Near Threatened.

History
  • 2008
    Near Threatened
  • 2004
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

When last assessed in 2010, the IUCN Red List categorized Magellanic penguins as near threatened. While an overall moderately rapid decrease is apparent, some smaller colonies of penguins have grown. During their annual migrations, penguins would often drift into shipping lanes and get oiled. However, changes to the Chubut provisional law moved the designated lanes to reduce oiling incidents. Magellanic penguins are also unintentionally caught in fishing nets and die as a result. Through commercial fishing humans are depleting populations of small fish which are a main component of Magellanic penguins' diets. The IUCN has proposed reducing by-catch of an anchovy fishery in Argentina and monitoring the effects on a penguin population in Punta Tombo as a possible solution.

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The world population is estimated at 1,300,000 pairs: 950,000 along the Argentinian coast, 100,000+ in the Falklands (Malvinas) and 200,000+ in Chile (Ellis et al. 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threat appears to be oil pollution, which was thought to kill more than 20,000 adults and 22,000 juveniles every year on the Argentinian coast5 (also the wintering ground for the Falklands population3), although this threat is now much reduced15. Mortality may increase in the future if petroleum extraction is developed offshore of the Falkland Islands (Malvinas). The expanding Argentinian anchovy fishery may threaten the largest known colony at Punta Tumbo, and there is no mechanism to quantify the impact of the fishery11.. Penguins are hunted for bait in Punta Arenas, Chile, and are often caught in fishing nets, particularly in Patagonia6,8. Fisheries may be having an additional effect, as bycatch includes juvenile hake and anchovy, which are an important part of the species's diet4,6. Predation from foxes, rats and cats occurs on some islands. Egg-collection occurs at localised sites. El Niño Southern Oscillation events can cause range-wide disruption of breeding1. If precipitation regimes at nesting colonies change resulting in more than 2.5 inches of rain falling during a year, a possible consequence of climate change, most chicks will not survive due to burrow collapses and hypothermia14. Tourism may also disturb individuals at breeding colonies14.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although the Magellanic penguin is not classified as globally threatened, it has, nevertheless, been severely impacted upon by several threats. These include oil pollution resulting from the deliberate release of oily ballast water from tankers (4). This is believed to kill more than 20,000 adults and 22,000 juveniles every year on the Argentine coast (5). The threat of oil pollution could be further increased by the development of offshore petroleum extraction around the Falklands (5), as during a five-month period of oil exploration around the islands in 1998, three oil spills occurred killing hundreds of Magellanic penguins (2). Expanding commercial fisheries are also having a detrimental effect on the Magellanic penguin, as they cause shortages of prey species, resulting in high levels of chick mortality due to starvation. The growing fisheries have also resulted in an increasing number of penguins caught as bycatch (5). At a more local level, threats to this species include egg collection, predation by foxes rats and cats and disturbance by tourists (2) (5). While currently, the global population of the Magellanic penguin remains relatively high (an estimated 1,300,000 pairs) rapid declines are evident at many locations, with some authorities estimating that 50 percent of the Falkland Islands population has been lost since the 1980s (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Radio-tracking has shown that breeding birds regularly travel long distances, and were found to be frequenting shipping lanes, where many birds were getting oiled. Changes in Chubut provincial law moved the shipping lane after the findings were given significant publicity, and thus the oiling threat has been somewhat reduced12.

Conservation Actions Proposed
Conduct a population census in Chile. Monitor effect of the Argentinian anchovy fishery on the Punta Tumbo population. Reduce byctach and oiling incidents.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

After successfully radio-tracking breeding Magellanic penguins on their long distance foraging expeditions, it became apparent that they were often frequenting shipping lanes and becoming oiled. Heavy publicity of this fact resulted in changes in laws within the Argentinean province of Chubut, so that a shipping lane was moved, thereby reducing, to some degree, the threat to this species. Nevertheless, further work must be undertaken to mitigate the threats of commercial fishing and oil pollution, otherwise the Magellanic penguin's decline is likely to continue (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Spheniscus magellanicus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

During their breeding season, magellanic penguins are popular tourist attractions. Over 100,000 people visit their nesting grounds at Punta Tombo each year. For a few years after 1982, this species became the target of human exploitation for their meat and skins, which were used to make gloves.

Positive Impacts: ecotourism

  • Boresma, P. 2008. Penguins as marine sentinels. BioScience, 58/7: 597-607. Accessed April 10, 2011 at http://www.jstor.org/stable/10.1641/B580707.
  • Müller-Schwarze, D. 1984. The behavior of penguins: adapted to ice and tropics. Albany, NY: SUNY Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Magellanic Penguin

The Penguins derive from a young South African girl called The Baker. The Baker, who is world known for her stardom success in the childhood program 'Pingu' has made these creatures incredibly popular which has enabled people to understand the term… 'Waddling' to a degree of mutual awareness. She is renowned for her frequent occurrences of waddling.

Contents

Description

Magellanic penguin on Argentina's coast
Swimming underwater at Berlin Zoo, Germany

Magellanic Penguins are medium-sized penguins which grow to be 61–76 cm (24–30 in) tall and weigh between 2.7 kg and 6.5 kg (5.9-14.3 lbs).[1][2] The males are larger than the females, and the weight of both drops while the parents nurture their young.

Adults have black backs and white abdomens. There are two black bands between the head and the breast, with the lower band shaped in an inverted horseshoe. The head is black with a broad white border that runs from behind the eye, around the black ear-coverts and chin, and joins at the throat. Chicks and younger penguins have grey-blue backs, with a more faded grey-blue colour on their chest. Magellanic Penguins can live up to 25 years in the wild, but as much as 30 years in captivity.

Young birds usually have a blotched pattern on their feet, which fades as they age. By the time these birds reach about ten years of age, their feet usually become all black.

Like other species of penguins, the Magellanic Penguin has very rigid wings used to "fly" or cruise under water.

Diet

Magellanic Penguins feed in the water, preying on cuttlefish, sardines, squid, krill, and other crustaceans, and ingest sea water with their prey. Their salt-excreting gland rids the salt from their bodies.

Breeding

Adults and chicks by their burrow in Cape Virgenes, Patagonia, Argentina

Magellanic Penguins travel in large flocks when hunting for food. In the breeding season, these birds gather in large nesting colonies at the coasts of Argentina, southern Chile, and the Falkland Islands, which have a density of 20 nests per 100 square meters. One of the largest of these colonies is located at Punta Tombo.[3] Nests are built under bushes or in burrows. Two eggs are laid. Incubation lasts 39–42 days, a task which the parents share in 10-15 day shifts. The chicks are cared for by both parents for 29 days and are fed every two to three days. Normally, both are raised through adulthood, though occasionally only one chick is raised.

Magellanic Penguins mate with the same partner year after year. The male reclaims his burrow from the previous year and waits to reconnect with his female partner. The females are able to recognize their mates through their call alone....

Status in the wild

Magellanic penguins at the Patagonian coast

Millions of these penguins still live on the coasts of Argentina and Chile, but the species is classified as a "threatened species", primarily due to the vulnerability of large breeding colonies to oil spills, which kill 20,000 adults and 22,000 juveniles every year off the coast of Argentina. To help the fight against the oil spills, zoo representatives from all over the world come and adopt the hatchlings, and breed them there. The decline of fish populations is also responsible, as well as predators such as sea lions and giant petrels, which prey on the chicks

Climate change has displaced fish populations, so Magellanic penguins must swim an extra 25 miles (40 km) further from the nest for fish. While the penguins are swimming an extra 50 miles (80.4 km), their mates are sitting on a nest and starving. A colony being tracked by University of Washington professor P. Dee Boersma, about 1,000 miles (1,609 km) south of Buenos Aires, has fallen by more than 20 percent in the past 22 years, leaving 200,000 breeding pairs. Some younger penguins are now moving their breeding colonies north to be closer to fish, but, in some cases, this is putting them on private, unprotected lands.

At present, 12 of 17 penguin species are experiencing rapid population declines.

References

  1. ^ BBC.co.uk
  2. ^ Answers-.penguin
  3. ^ C. Michael Hogan (2008) Globaltwitcher.auderis.se, Magellanic Penguin, ed. N. Stromberg]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!