Overview

Brief Summary

The Little Penguin (Eudyptula minor) breeds in colonies on the mainland and offshore islands of southern Australia and New Zealand. The distribution of colonies is irregular throughout this area and colony size varies from a few breeding pairs to tens of thousands. Little Penguins forage at sea during the day and return to their nesting colonies at dusk. They are philopatric, returning to their natal (birth) colony to molt every year and to breed (typically producing 2 eggs) at 2 or 3 years of age. However, banding and genetic studies show that dispersal does occur, although infrequently, at least in southeastern Australia. During their first year, juveniles may travel distances of several hundred kilometers and fledglings have been observed migrating to breed at non-natal colonies. Although some pair bonds are maintained across seasons, competition for mates and nest burrows is intense and extra-pair copulations and mate switching occur. Breeding birds live to an average age of 7 years, but several individuals have been known to exceed 20 years in the wild. (Billing et al. 2007 and references therein; Peucker et. al. 2009 and references therein)

Giling et al. (2008) reported on a population of Little Penguins that has nested for many years between boulders on the St, Kilda breakwater in Melbourne, Australia, a city with a population of around 3.5 million humans. Penguins at this site are presumably well protected from predators and have good access to prey, factors that apparently outweigh the detrimental effects of close proximity to humans (although the birds do tend to avoid portions of the site subject to greater human disturbance).

Like most penguins, Little Penguins are small enough that their expected heat loss in cold water would be too rapid for survival without some method of actively reducing this loss. In fact, anatomical studies of the wings and feet of penguins provide evidence of one such adaptation in the form of a countercurrent heat exchange system in which heat from arterial blood is transferred to colder venous blood (similar systems have evolved in other animals, e.g., to regulate heat or gas exchange, and are used by human engineers as well). By having warmer blood running adjacent to cooler blood but in an opposite direction, as the warmer blood cools along its path, it continues to encounter even cooler blood flowing past it in the opposite direction, to which it transfers heat. Thus, warmth is returned to the body instead of being lost to the environment. Thomas and Fordyce (2007) studied the vascular anatomy of the Little Penguin and its inferred (although not directly measured) impact on heat retention.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Little Penguin has a narrow distribution from the Chatham Islands (New Zealand) in the east to the south-western tip of Australia1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudyptula minor is found throughout the southern coast of Australia and as far north as the South Solitary Island off the coast of New South Wales. They are also native to the coasts of New Zealand.

Eudyptula minor has six recognized subspecies. E. m. novaehollandia is geographically located in Australia. The other five subspecies, E. m. iredaei, E. m. variabilis, E. m. albosignata, E. m. minor, E. m. chathamensis, are distributed around the country of New Zealand.

Biogeographic Regions: australian (Native ); pacific ocean (Native )

  • Davis, L., M. Renner. 2003. Penguins. New Haven and London: Yale University Press.
  • Hoskins, A., P. Dann, Y. Ropert-Coudert, A. Kato, A. Chiaradia, D. Costa, J. Arnould. 2008. Foraging behaviour and habitat selection of the little penguin Eudyptula minor during early chick rearing in Bass Strait, Australia. Marine Ecology-Progress Series, 366: 293-303.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

As the smallest penguin in the world, this flightless bird stands at an average height of 30 cm and has a weight of 1.1 to 1.2 kg. It has a black bill with an average length of 35 mm and eyes ranging from silver to blue, grey, and hazel. Its chin and throat are white along with the underside of its flippers and torso. The top of the head, neck and dorsal side of its flippers and torso are an indigo-blue. The color of the penguin’s feathers can become duller with age, and the color of their undersides can range from white to gray to brown. Sexual dimorphism is not pronounced in this species. Males are larger and have longer and deeper bills than females. Males have an average bill length of 35.7 mm and an average bill depth of 15.4 mm. Females have an average bill length of 34.5 mm and an average depth of 14.1 mm. Flipper length is similar in both genders with an average of 117.5 mm.

Juveniles have a dorsal plumage that is a brighter light blue than the indigo-blue of the adults. The juveniles also have thinner and shorter beaks.

Range mass: 1.1 to 1.2 kg.

Average length: 30 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

  • Overeem, R., A. Peucker, C. Austin, P. Dann, C. Burridge. 2008. Contrasting genetic structuring between colonies of the World's smallest penguin, Eudyptula minor. Conservation Genetics, 9/4: 893-905.
  • Williams, T. 1995. The Penguins: Spheniscidae. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in temperate marine waters, mainly feeding on pelagic shoaling fish, cephalopods and occasionally crustaceans. It captures prey by pursuit diving, frequently swimming round a shoal of fishg in concentric circles before plunging into its midst. It is known to dive up to 69 m and usually feeds along. Breeding has been recorded in all month with the exact timing depending on locality and year. It forms colonies, nesting in burrows on sandy or rocky islands, often at the base of cliffs or in sand dunes (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1513 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 19.682 - 20.446
  Nitrate (umol/L): 0.079 - 0.092
  Salinity (PPS): 35.704 - 35.782
  Oxygen (ml/l): 5.140 - 5.145
  Phosphate (umol/l): 0.103 - 0.111
  Silicate (umol/l): 2.588 - 2.660

Graphical representation

Temperature range (°C): 19.682 - 20.446

Nitrate (umol/L): 0.079 - 0.092

Salinity (PPS): 35.704 - 35.782

Oxygen (ml/l): 5.140 - 5.145

Phosphate (umol/l): 0.103 - 0.111

Silicate (umol/l): 2.588 - 2.660
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

When on land, Eudyptula minor inhabits coastal habitats with good nesting conditions. Little penguins nest in burrows dug in bare sand or under vegetation. If the ground is too soft to hold a burrow, these penguins also nest in caves and rock crevices. Habitats include rocky coastline, savanna, scrub forest or forests. Little penguins are marine seabirds and spend the majority of their lives swimming underwater.

Habitat Regions: temperate ; saltwater or marine

Terrestrial Biomes: chaparral ; scrub forest

Aquatic Biomes: coastal

Other Habitat Features: caves

  • Ropert-Coudert, Y., A. Kato, A. Chiaradia. 2009. Impact of small-scale environmental perturbations on local marine food resources: a case study of a predator, the little penguin. Proceedings of The Royal Society, 276: 4105-4109.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1513 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 19.682 - 20.446
  Nitrate (umol/L): 0.079 - 0.092
  Salinity (PPS): 35.704 - 35.782
  Oxygen (ml/l): 5.140 - 5.145
  Phosphate (umol/l): 0.103 - 0.111
  Silicate (umol/l): 2.588 - 2.660

Graphical representation

Temperature range (°C): 19.682 - 20.446

Nitrate (umol/L): 0.079 - 0.092

Salinity (PPS): 35.704 - 35.782

Oxygen (ml/l): 5.140 - 5.145

Phosphate (umol/l): 0.103 - 0.111

Silicate (umol/l): 2.588 - 2.660
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eudyptula minor is mainly piscivorous and employs a pursuit-diving technique to catch prey in shallow depths. The majority of its diet is composed of Clupeiformes fish, such as anchovies and sardines. The variety of fish consumed depends on the locality of the penguin. This species also preys on small squid, octopi and crustaceans. It has been observed that in recent years the number of prey available is decreasing. This results in longer foraging trips for the penguin, greater energy expenditures, and can ultimately decrease population sizes.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eudyptula minor plays multiple roles in its ecosystem as a predator and a host to parasites. It preys on small fish, squids, octopi, or occasionally crustaceans and likely impacts these populations. Little penguin eggs and chicks are food sources to local populations of dogs, rats, cats, and other introduced predators. Adult little penguins fall prey to sharks, seals, and orca whales and are a valuable food source to these predators.

In recent years, a new species of feather mite, Ingrassia eudyptula, has been discovered which is believed to parasitize Eudyptula minor. These mites eat preening oil on the feathers of the penguin.

Commensal/Parasitic Species:

  • Feather mites (Ingrassia eudyptula)

  • Mironov, S., H. Proctor. 2008. The Probable Association of Feather Mites of the Genus Ingrassia (Analgoidea: Xolalgidae) with the Blue Penguin Eudyptula minor (Aves: Sphenisciformes) in Australia. The Journal of Parasitology, 94/6: 1243-1248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Key predators of little penguins are introduced species. These include dogs, weasels, rats, foxes and cats. Pacific gulls and King's skinks are natural predators that eat the eggs and young of little penguins. In an effort to decrease predation, little penguins move in groups to and from the ocean. This anti-predator technique occurs a few hours before dawn and a few hours after dusk when it is dark. As penguins are less mobile on land, making mass land movements under the cover of darkness is likely another method used to avoid predation. Despite these techniques, adult little penguins often fall prey to sharks, seals, and orca whales.

Known Predators:

  • Dogs (Canis lupus)
  • Red foxes (Vulpes vulpes)
  • Weasels (Mustela)
  • Cats (Felius catus)
  • Rats (Rattus)
  • Pacific gulls (Larus pacificus)
  • King's skinks (Egernia kingii)
  • Orca whales (Orcinus orca)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eudyptula minor is a nocturnal species and is highly vocal during the night while roosting. The sound of their calls can range from a low rumble to a trumpet-like noise. Their song can be used for several functions, including attracting mates. Each little penguin has a distinctive individual song that is used by parents and siblings to distinguish one another from strangers. Calls can also be used with an aggressive intent against an intruder around a penguin's nest.

Little penguins perform unique courtship displays. Males take a particular stance, with heads facing up and wings back, while braying to females. If the female accepts, she will join the male in a courtship "dance" where they march in circles together and make braying calls.

Like all birds, little penguins perceive their environments through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Jouventin, P., T. Aubin. 2000. Acoustic convergence between two nocturnal burrowing seabirds: experiments with a penguin Eudyptula minor and a shearwater Puffinus tenuirostris. Ibis, 142: 645-656.
  • Miyazaki, M., J. Waas. 2002. 'Last Word' Effects of Male Advertising Calls on Female Preference in Little Blue Penguins. Behaviour, 139/11-12: 1413-1423.
  • Nakagawa, S., J. Waas, M. Miyazaki. 2001. Heart rate changes reveal that little blue penguin chicks (Eudyptula minor) can use vocal signatures to discriminate familiar from unfamiliar chicks. Behavioral Ecology and Sociobiology, 50: 180-188.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little penguins live an average of 6 years. However a banded little penguin has been recaptured the age of 25 years and 8 months old. Data on the lifespan of the bird in captivity could not be found.

Range lifespan

Status: wild:
25.6 (high) years.

Average lifespan

Status: wild:
6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Courtship begins with male little penguins performing courtship displays and giving mating calls. A male will hold his body in an upright position with flippers above his back, neck stretched, and head upright facing the sky. The male then emits a braying sound. These displays may be performed alone or in a group of unmated males. Occasionally the male will perform in front of a nest he constructed. After a female chooses a male, they perform a display together. One individual stands upright and spreads its flippers with head bowed, which signals the other bird to follow and they walk in small circles around the nest, braying as they go. After this display by male and female, copulation takes place.

Little penguins form monogamous pairs and retention of mated pairs from year to year is high in this species. Pairs are likely to split up only after an unsuccessful nesting attempt or death.

Mating System: monogamous

Little penguins breed from June to October in loose colonies. They may nest in ground burrows, rocky cliffs or caves, where they lay a clutch of 1 to 2 eggs. The eggs are smooth and white in appearance. They have an average weight of 53 g and an average diameter of 42.0 mm. Incubation occurs for 31 to 40 days and the newly hatched chicks are an average weight of 36 to 47 g. The chicks are semi-altricial thus are born with downy feathers, require brooding, are unable to leave the nest, and are unable to feed themselves. After the young hatch, the next 18 to 38 days are termed the "guard period" for penguins during which time both parents brood the young, trading off every 3 to 4 days. After the initial guard period, the parents relax their duties and guard chicks only at night. Fledging occurs when the chick is 50 to 65 days old and at this time it has grown to between 800 g to 1150 g. Juveniles reach full independence at 57 to 78 days old. Most juvenile penguins reach reproductive maturity at 3 years old.

The breeding cycle of Eudyptula minor is variable depending on nesting location and many other environmental factors. Nutrition, age, breeding date can influence the timing of the breeding cycle and nesting success. A lack of nutrition has been shown to delay the breeding process. The probability of breeding success also increases with age. This trend is attributed to the fact that older penguins have more experience, which increases the chance of fledgling survival. Little penguins can lay multiple clutches if the first clutch was a failure or if the adults raised their first fledglings early in the breeding season.

Breeding interval: Little penguins breed once a year, however, they do have the ability to lay an additional clutch.

Breeding season: The breeding season usually occurs from June until December, but may vary geographically.

Range eggs per season: 1 to 2.

Average eggs per season: 2.

Range time to hatching: 31 to 40 days.

Range fledging age: 50 to 65 days.

Range time to independence: 57 to 78 days.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both sexes take responsibilities in the breeding process. Both male and female penguins may build their nest together, but the male may have a greater role in physically building the burrow. The female often takes on a larger role in the incubation stage, but the male still helps by exchanging duties with the female every 3 to 4 days. After chicks are born, both parents continue to brood the young during the "guard period." Again, parents swap guarding duties every 3 to 4 days so that one broods the chicks while the other forages. After several weeks, parents decrease guarding time to only at night. Chicks fledge after 50 to 65 days at which time they leave the nest and do not return for several days. Juveniles reach independence from their parents at 57 to 78 days old.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Davis, L., M. Renner. 2003. Penguins. New Haven and London: Yale University Press.
  • Heber, S., K. Wilson, L. Molles. 2008. Breeding biology and breeding success of blue penguin (Eudyptula minor) on the West Coat of New Zealand's South Island. New Zealand Journal of Zoology, 35: 63-71.
  • Knight, C., T. Rogers. 2004. Factors influencing fledgling production in little penguins. Wildlife Research, 31: 339-344.
  • Nisbet, I., I. Dann. 2009. Reproductive performance of little penguins Eudyptula minor in relation to year, age, pair-bond duration, breeding date and individual quality. Journal of Avian Biology, 40/3: 296-308. Accessed February 22, 2010 at http://dx.doi.org/10.1111/j.1600-048X.2008.04563.x.
  • Williams, T. 1995. The Penguins: Spheniscidae. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptula minor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 57 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCACCAACCGATGACTATTCTCAACCAACCACAAAGATATCGGCACCCTTTACCTAATTTTTGGCGCATGAGCAGGTATAGCCGGAACTGCCCTCAGCTTACTCATCCGCGCAGAACTTGGCCAACCTGGAACTCTCCTCGGAGATGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCTGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTACCCCCCTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGGATGAACAGTATATCCCCCTCTAGCAGGCAACCTAGCCCATGCTGGTGCATCAGTAGACTTAGCCATCTTCTCACTCCACCTAGCAGGAATCTCCTCGATCCTAGGAGCAATCAATTTCATCACCACCGCCATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTTATCACAGCAGTCCTCCTATTACTCTCACTTCCCGTACTTGCCGCCGGCATCACCATACTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCAATCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTATATCCTAATTCTACCGGGCTTCGGAATCATCTCCCACGTAGTAACATACTACGCAGGTAAGAAAGAACCCTTCGGTTACATAGGAATGGTATGAGCAATACTATCTATCGGATTCCTCGGCTTTATCGTATGAGCACATCACATATTCACAGTCGGAATAGACGTAGATACCCGAGCATACTTTACATCCGCCACCATGATCATCGCCATCCCAACTGGCATCAAAGTCTTCAGCTGACTGGCGACCCTGCATGGAGGGACTATCAAATGAGATCCTCCAATACTATGAGCCCTGGGCTTCATCTTCCTCTTTACTATTGGAGGATTAACAGGCATCGTCCTAGCAAACTCCTCACTGGACATTGCCCTACACGATACATACTATGTAGTCGCCCACTTCCACTATGTCCTCTCAATAGGAGCTGTCTTTGCCATTCTAGCAGGATTCACTCACTGATTCCCTTTATTCACAGGATACACCTTGCACCCCACATGAGCCAAAGCCCACTTCGGGGTCATATTTACAGGTGTTAACCTAACCTTCTTCCCACAACACTTTCTAGGCTTAGCTGGCATGCCCCGACGATACTCCGACTACCCGGATGCCTACACCATATGAAACACCATATCATCTATCGGTTCACTAATCTCAATAACTGCAGTAATCATACTAATATTTATCATCTGAGAAGCCTTCACATCAAAACGAAAAATCCTACAACCTGAACTAATTACCACCAACATTGAATGAATCCACGGCTGCCCTCCCCCCTACCACACCTTCGAAGAACCAGCATTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptula minor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 57
Specimens with Barcodes: 60
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5