Overview

Brief Summary

Brief Summary

The Little Penguin (Eudyptula minor) breeds in colonies on the mainland and offshore islands of southern Australia and New Zealand. The distribution of colonies is irregular throughout this area and colony size varies from a few breeding pairs to tens of thousands. Little Penguins forage at sea during the day and return to their nesting colonies at dusk. They are philopatric, returning to their natal (birth) colony to molt every year and to breed (typically producing 2 eggs) at 2 or 3 years of age. However, banding and genetic studies show that dispersal does occur, although infrequently, at least in southeastern Australia. During their first year, juveniles may travel distances of several hundred kilometers and fledglings have been observed migrating to breed at non-natal colonies. Although some pair bonds are maintained across seasons, competition for mates and nest burrows is intense and extra-pair copulations and mate switching occur. Breeding birds live to an average age of 7 years, but several individuals have been known to exceed 20 years in the wild. (Billing et al. 2007 and references therein; Peucker et. al. 2009 and references therein)

Giling et al. (2008) reported on a population of Little Penguins that has nested for many years between boulders on the St, Kilda breakwater in Melbourne, Australia, a city with a population of around 3.5 million humans. Penguins at this site are presumably well protected from predators and have good access to prey, factors that apparently outweigh the detrimental effects of close proximity to humans (although the birds do tend to avoid portions of the site subject to greater human disturbance).

Like most penguins, Little Penguins are small enough that their expected heat loss in cold water would be too rapid for survival without some method of actively reducing this loss. In fact, anatomical studies of the wings and feet of penguins provide evidence of one such adaptation in the form of a countercurrent heat exchange system in which heat from arterial blood is transferred to colder venous blood (similar systems have evolved in other animals, e.g., to regulate heat or gas exchange, and are used by human engineers as well). By having warmer blood running adjacent to cooler blood but in an opposite direction, as the warmer blood cools along its path, it continues to encounter even cooler blood flowing past it in the opposite direction, to which it transfers heat. Thus, warmth is returned to the body instead of being lost to the environment. Thomas and Fordyce (2007) studied the vascular anatomy of the Little Penguin and its inferred (although not directly measured) impact on heat retention.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Little Penguin has a narrow distribution from the Chatham Islands (New Zealand) in the east to the south-western tip of Australia1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Eudyptula minor is found throughout the southern coast of Australia and as far north as the South Solitary Island off the coast of New South Wales. They are also native to the coasts of New Zealand.

Eudyptula minor has six recognized subspecies. E. m. novaehollandia is geographically located in Australia. The other five subspecies, E. m. iredaei, E. m. variabilis, E. m. albosignata, E. m. minor, E. m. chathamensis, are distributed around the country of New Zealand.

Biogeographic Regions: australian (Native ); pacific ocean (Native )

  • Davis, L., M. Renner. 2003. Penguins. New Haven and London: Yale University Press.
  • Hoskins, A., P. Dann, Y. Ropert-Coudert, A. Kato, A. Chiaradia, D. Costa, J. Arnould. 2008. Foraging behaviour and habitat selection of the little penguin Eudyptula minor during early chick rearing in Bass Strait, Australia. Marine Ecology-Progress Series, 366: 293-303.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As the smallest penguin in the world, this flightless bird stands at an average height of 30 cm and has a weight of 1.1 to 1.2 kg. It has a black bill with an average length of 35 mm and eyes ranging from silver to blue, grey, and hazel. Its chin and throat are white along with the underside of its flippers and torso. The top of the head, neck and dorsal side of its flippers and torso are an indigo-blue. The color of the penguin’s feathers can become duller with age, and the color of their undersides can range from white to gray to brown. Sexual dimorphism is not pronounced in this species. Males are larger and have longer and deeper bills than females. Males have an average bill length of 35.7 mm and an average bill depth of 15.4 mm. Females have an average bill length of 34.5 mm and an average depth of 14.1 mm. Flipper length is similar in both genders with an average of 117.5 mm.

Juveniles have a dorsal plumage that is a brighter light blue than the indigo-blue of the adults. The juveniles also have thinner and shorter beaks.

Range mass: 1.1 to 1.2 kg.

Average length: 30 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

  • Overeem, R., A. Peucker, C. Austin, P. Dann, C. Burridge. 2008. Contrasting genetic structuring between colonies of the World's smallest penguin, Eudyptula minor. Conservation Genetics, 9/4: 893-905.
  • Williams, T. 1995. The Penguins: Spheniscidae. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in temperate marine waters, mainly feeding on pelagic shoaling fish, cephalopods and occasionally crustaceans. It captures prey by pursuit diving, frequently swimming round a shoal of fishg in concentric circles before plunging into its midst. It is known to dive up to 69 m and usually feeds along. Breeding has been recorded in all month with the exact timing depending on locality and year. It forms colonies, nesting in burrows on sandy or rocky islands, often at the base of cliffs or in sand dunes1

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

When on land, Eudyptula minor inhabits coastal habitats with good nesting conditions. Little penguins nest in burrows dug in bare sand or under vegetation. If the ground is too soft to hold a burrow, these penguins also nest in caves and rock crevices. Habitats include rocky coastline, savanna, scrub forest or forests. Little penguins are marine seabirds and spend the majority of their lives swimming underwater.

Habitat Regions: temperate ; saltwater or marine

Terrestrial Biomes: chaparral ; scrub forest

Aquatic Biomes: coastal

Other Habitat Features: caves

  • Ropert-Coudert, Y., A. Kato, A. Chiaradia. 2009. Impact of small-scale environmental perturbations on local marine food resources: a case study of a predator, the little penguin. Proceedings of The Royal Society, 276: 4105-4109.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1513 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 19.682 - 20.446
  Nitrate (umol/L): 0.079 - 0.092
  Salinity (PPS): 35.704 - 35.782
  Oxygen (ml/l): 5.140 - 5.145
  Phosphate (umol/l): 0.103 - 0.111
  Silicate (umol/l): 2.588 - 2.660

Graphical representation

Temperature range (°C): 19.682 - 20.446

Nitrate (umol/L): 0.079 - 0.092

Salinity (PPS): 35.704 - 35.782

Oxygen (ml/l): 5.140 - 5.145

Phosphate (umol/l): 0.103 - 0.111

Silicate (umol/l): 2.588 - 2.660
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Eudyptula minor is mainly piscivorous and employs a pursuit-diving technique to catch prey in shallow depths. The majority of its diet is composed of Clupeiformes fish, such as anchovies and sardines. The variety of fish consumed depends on the locality of the penguin. This species also preys on small squid, octopi and crustaceans. It has been observed that in recent years the number of prey available is decreasing. This results in longer foraging trips for the penguin, greater energy expenditures, and can ultimately decrease population sizes.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Eudyptula minor plays multiple roles in its ecosystem as a predator and a host to parasites. It preys on small fish, squids, octopi, or occasionally crustaceans and likely impacts these populations. Little penguin eggs and chicks are food sources to local populations of dogs, rats, cats, and other introduced predators. Adult little penguins fall prey to sharks, seals, and orca whales and are a valuable food source to these predators.

In recent years, a new species of feather mite, Ingrassia eudyptula, has been discovered which is believed to parasitize Eudyptula minor. These mites eat preening oil on the feathers of the penguin.

Commensal/Parasitic Species:

  • Mironov, S., H. Proctor. 2008. The Probable Association of Feather Mites of the Genus Ingrassia (Analgoidea: Xolalgidae) with the Blue Penguin Eudyptula minor (Aves: Sphenisciformes) in Australia. The Journal of Parasitology, 94/6: 1243-1248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Key predators of little penguins are introduced species. These include dogs, weasels, rats, foxes and cats. Pacific gulls and King's skinks are natural predators that eat the eggs and young of little penguins. In an effort to decrease predation, little penguins move in groups to and from the ocean. This anti-predator technique occurs a few hours before dawn and a few hours after dusk when it is dark. As penguins are less mobile on land, making mass land movements under the cover of darkness is likely another method used to avoid predation. Despite these techniques, adult little penguins often fall prey to sharks, seals, and orca whales.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eudyptula minor is a nocturnal species and is highly vocal during the night while roosting. The sound of their calls can range from a low rumble to a trumpet-like noise. Their song can be used for several functions, including attracting mates. Each little penguin has a distinctive individual song that is used by parents and siblings to distinguish one another from strangers. Calls can also be used with an aggressive intent against an intruder around a penguin's nest.

Little penguins perform unique courtship displays. Males take a particular stance, with heads facing up and wings back, while braying to females. If the female accepts, she will join the male in a courtship "dance" where they march in circles together and make braying calls.

Like all birds, little penguins perceive their environments through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

  • Jouventin, P., T. Aubin. 2000. Acoustic convergence between two nocturnal burrowing seabirds: experiments with a penguin Eudyptula minor and a shearwater Puffinus tenuirostris. Ibis, 142: 645-656.
  • Miyazaki, M., J. Waas. 2002. 'Last Word' Effects of Male Advertising Calls on Female Preference in Little Blue Penguins. Behaviour, 139/11-12: 1413-1423.
  • Nakagawa, S., J. Waas, M. Miyazaki. 2001. Heart rate changes reveal that little blue penguin chicks (Eudyptula minor) can use vocal signatures to discriminate familiar from unfamiliar chicks. Behavioral Ecology and Sociobiology, 50: 180-188.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little penguins live an average of 6 years. However a banded little penguin has been recaptured the age of 25 years and 8 months old. Data on the lifespan of the bird in captivity could not be found.

Range lifespan

Status: wild:
25.6 (high) years.

Average lifespan

Status: wild:
6 years.

  • 2009. "Little Penguin, Eudyptula minor" (On-line). Parks & Wildlife Service, Tasmania. Accessed March 19, 2010 at http://www.parks.tas.gov.au/index.aspx?base=5091.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Courtship begins with male little penguins performing courtship displays and giving mating calls. A male will hold his body in an upright position with flippers above his back, neck stretched, and head upright facing the sky. The male then emits a braying sound. These displays may be performed alone or in a group of unmated males. Occasionally the male will perform in front of a nest he constructed. After a female chooses a male, they perform a display together. One individual stands upright and spreads its flippers with head bowed, which signals the other bird to follow and they walk in small circles around the nest, braying as they go. After this display by male and female, copulation takes place.

Little penguins form monogamous pairs and retention of mated pairs from year to year is high in this species. Pairs are likely to split up only after an unsuccessful nesting attempt or death.

Mating System: monogamous

Little penguins breed from June to October in loose colonies. They may nest in ground burrows, rocky cliffs or caves, where they lay a clutch of 1 to 2 eggs. The eggs are smooth and white in appearance. They have an average weight of 53 g and an average diameter of 42.0 mm. Incubation occurs for 31 to 40 days and the newly hatched chicks are an average weight of 36 to 47 g. The chicks are semi-altricial thus are born with downy feathers, require brooding, are unable to leave the nest, and are unable to feed themselves. After the young hatch, the next 18 to 38 days are termed the "guard period" for penguins during which time both parents brood the young, trading off every 3 to 4 days. After the initial guard period, the parents relax their duties and guard chicks only at night. Fledging occurs when the chick is 50 to 65 days old and at this time it has grown to between 800 g to 1150 g. Juveniles reach full independence at 57 to 78 days old. Most juvenile penguins reach reproductive maturity at 3 years old.

The breeding cycle of Eudyptula minor is variable depending on nesting location and many other environmental factors. Nutrition, age, breeding date can influence the timing of the breeding cycle and nesting success. A lack of nutrition has been shown to delay the breeding process. The probability of breeding success also increases with age. This trend is attributed to the fact that older penguins have more experience, which increases the chance of fledgling survival. Little penguins can lay multiple clutches if the first clutch was a failure or if the adults raised their first fledglings early in the breeding season.

Breeding interval: Little penguins breed once a year, however, they do have the ability to lay an additional clutch.

Breeding season: The breeding season usually occurs from June until December, but may vary geographically.

Range eggs per season: 1 to 2.

Average eggs per season: 2.

Range time to hatching: 31 to 40 days.

Range birth mass: 36 to 47 g.

Range fledging age: 50 to 65 days.

Range time to independence: 57 to 78 days.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both sexes take responsibilities in the breeding process. Both male and female penguins may build their nest together, but the male may have a greater role in physically building the burrow. The female often takes on a larger role in the incubation stage, but the male still helps by exchanging duties with the female every 3 to 4 days. After chicks are born, both parents continue to brood the young during the "guard period." Again, parents swap guarding duties every 3 to 4 days so that one broods the chicks while the other forages. After several weeks, parents decrease guarding time to only at night. Chicks fledge after 50 to 65 days at which time they leave the nest and do not return for several days. Juveniles reach independence from their parents at 57 to 78 days old.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Davis, L., M. Renner. 2003. Penguins. New Haven and London: Yale University Press.
  • Heber, S., K. Wilson, L. Molles. 2008. Breeding biology and breeding success of blue penguin (Eudyptula minor) on the West Coat of New Zealand's South Island. New Zealand Journal of Zoology, 35: 63-71.
  • Knight, C., T. Rogers. 2004. Factors influencing fledgling production in little penguins. Wildlife Research, 31: 339-344.
  • Nisbet, I., I. Dann. 2009. Reproductive performance of little penguins Eudyptula minor in relation to year, age, pair-bond duration, breeding date and individual quality. Journal of Avian Biology, 40/3: 296-308. Accessed February 22, 2010 at http://dx.doi.org/10.1111/j.1600-048X.2008.04563.x.
  • Williams, T. 1995. The Penguins: Spheniscidae. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptula minor

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 55 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROMB021-06|S2-P-21881|Eudyptula minor| AACCGATGACTATTCTCAACCAACCACAAAGATATCGGCACCCTTTACCTAATTTTTGGCGCATGAGCAGGTATAGCCGGAACTGCCCTC---AGCTTACTCATCCGCGCAGAACTTGGCCAACCTGGAACTCTCCTCGGAGAT---GACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATA---ATTGGCGCCCCTGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTACCCCCCTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGGATGAACAGTATATCCCCCTCTAGCAGGCAACCTAGCCCATGCTGGTGCATCAGTAGACTTA---GCCATCTTCTCACTCCACCTAGCAGGAATCTCCTCGATCCTAGGAGCAATCAATTTCATCACCACCGCCATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTTATCACAGCAGTCCTCCTATTACTCTCACTTCCCGTACTTGCCGCC---GGCATCACCATACTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCAATCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTATATCCTAATTCTACCGGGCTTCGGAATCATCTCCCACGTAGTAACATACTACGCAGGTAAGAAA---GAACCCTTCGGTTACATAGGAATGGTATGAGCAATACTATCTATCGGATTCCTCGGCTTTATCGTATGAGCACATCACATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptula minor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 55
Species: 59
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Currently Eudyptula minor is not considered to be threatened by extinction. It is believed that the global population of these birds averages around 1,000,000 individuals. Their population is declining, however, due to introduced predators, decreasing populations of prey and oil spills. The intensity of industrial fisheries results in low prey densities for penguins and other piscivores. Factors such as human settlement, coastal erosion, and pollution have also affected the breeding habitats of these birds.

The subspecies E. m. albosignata is now considered endangered. It is only found on the Banks Peninsula on South Island, New Zealand.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the population in Australia is estimated as under 1,000,000 individuals (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known effects of little penguins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The penguin parade of the Eudyptula minor is a popular tourist attraction. It has been recorded that 500,000 tourists annually come to watch the colony of penguins parade to and from the water at Phillip Island.

This specific species is also of great interest to scientists because of their small sizes and the increased amounts of energy needed to survive, especially in cold temperatures. This subject is important in the study of thermoregulation in endotherms, and the penguin's physical characteristics allow scientists to use this penguin in comparisons with other endotherms.

Positive Impacts: ecotourism ; research and education

  • Fallow, P., A. Chiaradia, Y. Ropert-Coudert, A. Kato, R. Reina. 2009. Flipper Bands Modify the Short-Term Diving Behavior of Little Penguins. Journal of Wildlife Management, 73/8: 1348-1354.
  • Thomas, ., R. Fordyce. 2007. The Heterothermic Loophole Exploited by Penguins. Australian Journal of Zoology, 55/5: 317-321.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Penguin

The Little Penguin (Eudyptula minor) is the smallest species of penguin. The penguin, which usually grows to an average of 33 cm (13 in) in height and 43 cm (17 in) in length (though specific measurements vary by subspecies),[2][3] is found on the coastlines of southern Australia and New Zealand, with possible records from Chile.

Apart from Little Penguins, they have several common names. In Australia, they are also referred to as Fairy Penguins because of their tiny size. In New Zealand, they are also called Little Blue Penguins, or just Blue Penguins, owing to their slate-blue plumage, and they are called Kororā in Māori.

Contents

Taxonomy

The Little Penguin was first described by German naturalist, Johann Reinhold Forster in 1781. There are several subspecies but a precise classification of these is still a matter of dispute. The holotypes of the subspecies Eudyptula minor variabilis[4] and Eudyptula minor chathamensis[5] are in the collection of the Museum of New Zealand Te Papa Tongarewa. The White-flippered Penguin is sometimes considered a subspecies, sometimes a distinct species, and sometimes a morph. As the Australian and Otago (eastern South Island) Little Penguins seem to be a distinct species[6] to which the specific name minor would apply, the White-flippered birds indeed belong to a distinct species, although not exactly as originally assumed.

Mitochondrial and nuclear DNA evidence suggests the split between Eudyptula and Spheniscus occurred around 25 million years ago, with the ancestors of the White-flippered and Little Penguins diverging about 2.7 million years ago.[7]

Description

Little penguin at the Melbourne Zoo

Like all penguins, the little penguin's wings have developed into flippers used for swimming. The Little Penguin typically grows to between 30 and 33 cm (12 to 13 inches) tall and usually weighs about 1.5 kilogram on average (3.3 pounds). The head and upperparts are blue in colour, with slate-grey ear coverts fading to white underneath, from the chin to the belly. The flippers are blue. The dark grey-black beak is 3–4 cm long, the irises pale silvery- or bluish-grey or hazel, and the feet pink above with black soles and webbing. An immature individual will have a shorter bill and lighter upperparts.[8]

Like most seabirds, they have a long lifespan. The average for the species is 6.5 years, but flipper ringing experiments show in very exceptional cases up to 25 years in captivity.[9]

Distribution and habitat

The Little Penguin breeds along the entire coastline of New Zealand, the Chatham Islands, and southern Australia (including roughly 20,000 pairs[10] on Babel Island).

Little penguins have also been reported from Chile (where they are known as Pingüino pequeño or Pingüino azul) (Isla Chañaral 1996, Playa de Santo Domingo, San Antonio, 16 March 1997) and South Africa, but it is unclear whether these birds were vagrants.

Rough estimates (as new colonies continue to be discovered) of the world population are around 350,000-600,000 animals.[3] The species is not considered endangered, except for the White-Flippered subspecies found only on Banks Peninsula and nearby Motunau Island in New Zealand. Since the 1960s, the mainland population has declined by 60-70%; though there has been a small increase on Motunau Island. But overall Little Penguin populations have been decreasing as well, with some colonies having been wiped out and other populations continuing to be at risk.[3] However, new colonies have been established in urban areas.[2]

The greatest threat to Little Penguin populations has been predation (including nest predation) from cats, dogs, mustelids, foxes, large reptiles, and possibly ferrets and stoats.[3][2][11] Due to their diminutive size and the introduction of new predators, some colonies have been reduced in size by as much as 98% in just a few years, such as the small Fairy colony on Middle Island, near Warrnambool, Victoria , which was reduced from 5000 penguins to 100. Because of this threat of colony collapse, conservationists pioneered an experimental technique using Maremma Sheepdogs to protect the colony and fend off would-be predators.[12]

Behaviour

Like Galápagos penguins, Little Penguins spend the whole day swimming in the sea. They are out at sunrise and hunt into the evening. Little Penguins preen their feathers to keep them waterproof. They do this by rubbing a tiny drop of oil onto each and every feather from a special gland above the tail.

Diet

These birds feed by hunting fish, squid and other small sea animals, for which they travel and dive quite extensively. They are generally inshore feeders.[13] The use of data loggers has provided information of the diving behavior of Little Penguins. 50% of their dives go no deeper than 2 m and the mean diving time is 21 seconds.[14] Yet, they are able to dive as deep as 20m and remained submerged as long as 60 sec.[15]

Reproduction

Chick in nest burrow
Little Penguin (Eudyptula minor) family exiting burrow at night, Bruny Island

Little Penguins mature at different ages. The female matures at 2 years old. The male, however, matures at 3 years old. Little Penguins only remain faithful to their partner in breeding seasons and whilst hatching eggs. At other times of the year they do tend to swap burrows. They exhibit site fidelity to their nesting colonies and nesting sites over successive years.

Little Penguins live year-round in large colonies, with each individual breeding pair forming a burrow in which to raise their chicks (of which two are born at a time, usually about 2 days apart). Little Penguins typically return to their colonies to feed their chicks at dusk. The birds will tend to come ashore in small groups to provide some defense against predators which might pick off individuals one by one. In Australia, the strongest colonies are usually on cat-free and fox-free islands. However, the population on Granite Island (which is a fox, cat and dog-free island) has been severely depleted, from around 2000 penguins in the year of 2001 down to 146 in 2009.

Relationship with humans

Feeding time at Melbourne Zoo

South of Perth, Western Australia, visitors to Penguin Island are able to view penguins in a totally natural state. Less than one hour from the centre of the city, it is possible to see Little Penguins in all months, including visiting sensitive areas where they remain on land for extended periods for the purposes of moulting.

At Phillip Island, a viewing area has been set up at the Phillip Island Nature Park to allow visitors to view the nightly "penguin parade". Lights and concrete stands have been erected to allow visitors to see but not photograph the birds interacting in their colony. [16]

In Otago, New Zealand town of Oamaru, where visitors may view the birds returning to their colony at dusk.[17] In Oamaru it is not uncommon for penguins to nest within the cellars and foundations of local shorefront properties, especially in the old historic precinct of the town. More recently, Little penguin viewing facilities have been put in place at Pilots Beach, Otago Peninsula and Dunedin in New Zealand. Here visitors are guided by volunteer wardens to watch penguins returning to their burrows at dusk.[18]

Visitors to Kangaroo Island, South Australia, have the nightly opportunity to commune with penguins at the Kangaroo Island Marine Centre in Kingscote and at the Penneshaw Penguin Centre.[19] Several human-made enclosures have been made to support breeding and shelter, with several people clearing an area for the penguins and burying the huts, most notably The Knox School, when their efforts were filmed and broadcast in 2008 by Totally Wild. There are also nightly tours of

Granite Island South of Adelaide, South Australia is home to a colony of 2000 fairy penguins. You are able to see the penguins every day in their natural habitat with guided tours every day at dusk. [20] There is also a penguin centre where you can feed and interact with penguins. [21]

Mascots and logos

Linus Torvalds, the original creator of Linux (a popular operating system kernel), was once pecked by a Little Penguin while on holiday in Australia. Reportedly, this encounter encouraged Torvalds to select Tux as the official Linux mascot.[22]

Penny the Little Penguin was the mascot for the 2007 FINA World Swimming Championships held in Melbourne, Victoria.[23][24]

Sea World

Little Penguins at Sea World, Gold Coast, Queensland, Australia (photo 2005)

There is a colony of Little Penguins at Sea World, on the Gold Coast, Queensland, Australia. In early March, 2007, 25 of the 37 penguins died from an unknown toxin following a change of gravel in their enclosure.[25][26][27] It is still not known what caused the deaths of the Little Penguins, and it was decided not to return the 12 surviving penguins to the same enclosure in which the penguins became ill.[28]

A new enclosure for the Little Penguin colony was opened at Sea World in 2008.

Predators

Little Penguin at night at the
St Kilda breakwater

Little Penguins in the wild are sometimes preyed upon by New Zealand fur seals. A study done by researchers from the South Australian Research and Development Institute (based at the Waite campus of the University of Adelaide) found that roughly 40 percent of seal droppings in South Australia's Granite Island area contained Little Penguin remains.[29][30]

Little Penguins on Middle Island in Warrnambool, Victoria were subject to heavy predation by foxes, which could reach the island at low tide by a tidal sand bridge. The deployment of Maremma sheepdogs to protect the penguin colony has deterred the foxes and enabled the penguin population to rebound.[31] This is in addition to the support from groups of volunteers who work to protect the penguins from attack at night.

In Sydney, snipers have been deployed to protect a colony of Little Penguins.[32] This effort is in addition to support from local volunteers who work to protect the penguins from attack at night.

References

  1. ^ BirdLife International (2004). Eudyptula minor. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 9 May 2006.
  2. ^ a b c Grabski, Valerie (2009). "Little Penguin - Penguin Project". Penguin Sentinels/University of Washington. http://mesh.biology.washington.edu/penguinProject/Little. Retrieved 2011-11-25. 
  3. ^ a b c d Dann, Peter. "Penguins: Little (Blue) Penguins - Eudyptula minor". International Penguin Conservation Work Group. http://www.penguins.cl/little-penguins.htm. Retrieved 2011-11-25. 
  4. ^ "Eudyptula minor variabilis; holotype". Collections Online. Museum of New Zealand Te Papa Tongarewa. http://collections.tepapa.govt.nz/objectdetails.aspx?oid=416404. Retrieved 17 July 2010. 
  5. ^ "Eudyptula minor chathamensis; holotype". Collections Online. Museum of New Zealand Te Papa Tongarewa. http://collections.tepapa.govt.nz/objectdetails.aspx?oid=421788. Retrieved 17 July 2010. 
  6. ^ Banks, Jonathan C.; Mitchell, Anthony D.; Waas, Joseph R. & Paterson, Adrian M. (2002): An unexpected pattern of molecular divergence within the blue penguin (Eudyptula minor) complex. Notornis 49(1): 29–38. PDF fulltext
  7. ^ Baker AJ, Pereira SL, Haddrath OP, Edge KA (2006). "Multiple gene evidence for expansion of extant penguins out of Antarctica due to global cooling". Proc Biol Sci. 273 (1582): 11–17. doi:10.1098/rspb.2005.3260. PMC 1560011. PMID 16519228. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1560011. 
  8. ^ Williams (The Penguins) p. 230
  9. ^ Dann, P. et al. (2005): Longevity in Little Penguins. Marine Ornithology 33: 71–72. PDf fulltext
  10. ^ "Birds of world significance: Babel Island Group, Tasmania". Atlas of Australian Birds. Birds Australia. http://www.birdata.com.au/printibaWBDBBirdList.do?sitRecID=23907. Retrieved 29 November 2011. 
  11. ^ "BBC - Science & Nature -Sea Life - Fact Files: Little/Fairy penguin". bbc. 2005-07. http://www.bbc.co.uk/nature/blueplanet/factfiles/birds/fairy_penguin_bg.shtml. Retrieved 2011-11-25. 
  12. ^ Vieru, Tudor (2009-01-07). "Sheepdogs Guard Endangered Fairy Penguin Colony". Softpedia. http://news.softpedia.com/newsPDF/Sheepdogs-to-Guard-Endangered-Fairy-Penguin-Colony-101357.pdf. Retrieved 2011-11-25. 
  13. ^ Numata, M; Davis, L & Renner, M (2000) "[Prolonged foraging trips and egg desertion in little penguins (Eudyptula minor)]". New Zealand Journal of Zoology 27: 291-298
  14. ^ Bethge, P; Nicol, S; Culik, BM & RP Wilson (1997) "Diving behaviour and energetics in breeding little penguins (Eudyptula minor)". Journal of Zoology 242: 483-502
  15. ^ Ropert-Coudert Y, Chiaradia A, Kato A (2006) "An exceptionally deep dive by a Little Penguin Eudyptula minor". Marine Ornithology 34: 71-74
  16. ^ Tourism Victoria. "Phillip Island Penguin Parade". Visit Victoria. http://www.visitvictoria.com/Regions/Phillip-Island/Activities-and-attractions/Nature-and-wildlife/Wildlife-viewing/Penguins.aspx. Retrieved 21 July 2011. 
  17. ^ Oamaru Blue Penguin Colony
  18. ^ Blue Penguins Pukekura
  19. ^ Penneshaw Penguin Centre
  20. ^ [1]
  21. ^ [2]
  22. ^ ""Tux" the Aussie Penguin". Linux Australia. Archived from the original on 2006-05-07. http://web.archive.org/web/20060507115127/http://www.linux.org.au/linux/tux. Retrieved 2006-06-25. 
  23. ^ FINA - Melbourne, 2007
  24. ^ Protecting our Little Penguins (Victorian Government website)
  25. ^ Mystery illness kills at least 24 penguins at Sea World
  26. ^ Authorities find unknown toxin in Sea World Penguins
  27. ^ Sea World probes mysterious deaths
  28. ^ Penguin deaths remain a mystery
  29. ^ Penguins —Environment, South Australian Government
  30. ^ Littlely, Bryan (2007-10-10). "Fur seals threat to Granite Island penguins". The Advertiser: pp. 23 
  31. ^ "Dogs come to fairy penguins' rescue". Special Broadcasting Service. 5 January 2009. http://www.sbs.com.au/news/article/1004160/Dogs-come-to-fairy-penguins%27-rescue. Retrieved 2009-01-07. 
  32. ^ "Penguin murders prompt sniper aid". BBC. 16 July 2009. http://news.bbc.co.uk/2/hi/asia-pacific/8153168.stm. Retrieved 2009-07-16. 

Cited text

  • Williams, Tony D. (1995). The Penguins. Oxford, England: Oxford University Press. ISBN 0-19-854667-X. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!