Overview

Brief Summary

Biology

The Royal penguins' breeding season extends from September to March and starts with the male birds coming ashore on Macquarie Island to build their nests, which are lined with grass and stones (5). The females arrive a couple of weeks later and courtship takes place. Males swing their heads up and down and call to encourage the females to become receptive to mating (5). Eventually, two eggs are laid at the end of October, the second egg being the only one that is usually incubated (5). Royal penguins are monogamous and often form large colonies of up to 500,000 birds (5), together with the closely related rockhopper penguins. The nests are usually placed a few hundred metres from the sea and the birds make access routes through the tussock grass (4). Incubation lasts from 30-40 days (5), after which the male guards the chick for up to three weeks while the female provides food (4) (5). After this period, the demands of the chick make it necessary for both parents to collect food, and the chicks usually gather together in small crèches (4). Royal penguins feed largely on krill, small shrimp-like crustaceans, the rest of their diet comprising fish and squid. The parent birds regurgitate partially-digested food from their stomachs to feed their growing youngster (2). When it reaches some 70 days old, the chick will have fledged and can begin to fend for itself. It becomes sexually mature at one year (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Royal penguins differ from the other crested penguins by having white or pale grey faces and chins (3). They have black crowns, backs and flippers flecked with white; short, stubby orange bills and sulphur-yellow crests above the eyes that join at the top of the head (4). Female birds are slightly smaller than the males, but otherwise, the sexes are similar (5). Royal penguins are sometimes confused with the Macaroni penguin (black chin and face), and some authorities consider the Royal a subspecies of the Macaroni (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Eudyptes schlegeli is confined to Macquarie Island and nearby Bishop and Clerk Islands, Australia. However, small numbers of similar-looking birds appear at other sub-Antarctic islands, indicating that it may breed elsewhere. It was heavily exploited in the 19th century, but has recovered and, in 1984-1985, an estimated 850,000 pairs were breeding on Macquarie, with an earlier count of over 1,000 pairs on Bishop and Clerk. The population is believed to be stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Royal Penguins are a migratory species. All Eudyptes schlegeli make residence on Macquarie Island during the breeding season. The island is located off the South of Australia in the Pacific. It is uncertain where they go during the non-breeding season. Sightings have ranged from Tasmania all the way to the Antarctic sector of the Southern Ocean (Kerry and Clippindale 1997).

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Royal penguins are migratory birds and outside of the breeding season are believed to spend their time in the southern seas between Australia and Antarctica. Their main breeding site is on Macquarie Island, situated roughly half-way between Tasmania and Antarctica, and managed by the Australian state of Tasmania (6). However, they were also recorded in the past as breeding in smaller numbers on New Zealand's South Island and Campbell Island (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Royal Penguins are often confused with Macaroni Penguins (Eudyptes chrysolophus) (Barham & Barham date unknown). In fact, both of these species were at one time considered to be the same species (Kerry and Clippindale 1997). They are the largest of the crested penguins standing about 70 cm in height. Females are usually slightly smaller than males. Both have yellow/orange and black crests that run from their sides all the way to the tops of their heads. The one distinguishing difference between Royal Penguins and Macaroni Penguins is that Royals have white chins and the Macaroni Penguins have black chins (Kerry and Clippindale 1997).

Range mass: 4000 to 5000 g.

Average length: 70 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests in huge colonies on bare, level, pebbly, rocky or sandy ground. When breeding, it feeds on euphausiids, fish and squid. Its ecology and movements during the winter when away from the island are unknown1.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The only certain habitat of Eudyptes schlegeli is on Macquarie Island. The surface of the island is covered with rock and small shrubs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 212 specimens in 1 taxon.
Water temperature and chemistry ranges based on 212 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.950 - 5.950
  Nitrate (umol/L): 19.829 - 19.829
  Salinity (PPS): 34.005 - 34.005
  Oxygen (ml/l): 6.975 - 6.975
  Phosphate (umol/l): 1.408 - 1.408
  Silicate (umol/l): 6.646 - 6.646
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The most important land habitat for the Royal penguin is Macquarie Island, which is dotted with rocks, tussock grass and small shrubs. The birds spend about seven months of the year in the coastal waters around this island (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Eudyptes schlegeli consists primarily of euphausiid (26%) and myctophid (52%). Other forms of nourishment come from small fish, squid, and various crustaceans. One interesting observation is that different colonies of the penguins on Macquarie Island (notably the east and west coasts) show significant variations in diet (Kerry 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Royal Penguins are monogamous (Waas et al. 2000). Reproduction only occurs on Macquarie Island from September to March. The season is marked when males arrive and begin building nests made out of grass and lined with small stones. The nests are easily distinguished from other crested penguin nests (Royal 1998). Females arrive in early October and lay eggs near the end of the month. Eudyptes schlegeli are known to breed in both large and small colonies. The largest colony is estimated to have around 500,000 pairs, while smaller colonies can contain a mere 70 to 200 pairs.

Two eggs are laid in the nest but only the second egg is incubated (Waas et al. 2000). Incubation takes approximately 30 to 40 days. When the chick hatches the male protects and raises it for 10 to 20 days. During this time the female penguin gathers and brings food to the nest daily. At an age of about 70 days, the chick is capable of leaving the nest and subsisting on its own. Royal Penguins reach sexual maturity in approximately one year (Royal 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes schlegeli

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROMB019-06|R27F|Eudyptes schlegeli| AACCGATGACTATTCTCCACCAACCACAAAGATATCGGCACCCTCTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTT---AGCCTACTCATCCGTGCAGAGCTCGGCCAACCTGGAACTCTCCTAGGAGAC---GACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTCCCCCTTATA---ATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCTGGCACAGGATGAACTGTATACCCACCACTAGCGGGCAACCTAGCCCATGCCGGGGCATCTGTAGACTTA---GCCATTTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTTGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCA---GGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATATTACGCAGACAAAAAG---GAACCCTTCGGCTACATAGGAATAGTATGAGCCATATTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCATCACATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes schlegeli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s
Copson, G.

Justification
Although this species has a large population which is currently thought to be stable, it is confined to a single location when breeding and as such it is prone to the effects of human activities or stochastic events within a very short time period in an uncertain future, and is thus capable of becoming Critically Endangered or even Extinct in a very short time period. It is consequently classified as Vulnerable.

History
  • 2008
    Vulnerable
  • 2007
    Vulnerable
  • 2005
    Vulnerable
  • 2004
    Vulnerable
  • 2000
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There remain roughly 850,000 living pairs of Royal Penguins today. The survival of the species has never been severly threatened. The recent government restrictions and control of Macquarie Island should only benefit Eudyptes schlegeli.

The only fear that scientists have noted is the very limited distribution of the Royal Penguin. A natural disaster could jeopardize the species since breeding only occurs on Macquarie Island.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU A1be+2be, C1) on the IUCN Red List 2003 (1)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In 1984-1985, the breeding population on Macquarie Island was estimated at 850,000 pairs, with an earlier count of over 1,000 pairs on Bishop and Clerk Islands (Garnett and Crowley 2000).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
On land, rats take some eggs and young. Breeding success can be reduced as a result of disturbance by researchers and tourists. Marine pollution, particularly ingested plastics, kills some birds. Fishing around sub-Antarctic islands may also adversely affect the species. The most likely long-term threat is the effect of climate change on sea-surface temperature and food supply.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Once the subject of a lucrative oil industry in the latter part of the 19th century, Royal penguins are now protected at their breeding sites (5). The main threats come from south polar skuas, Stercorarius maccormicki, which take both eggs and unprotected young (4). There is an additional risk from the fact that as the birds' breeding range is so restricted, a natural or man-made disaster could easily wipe out this species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Studies of foraging ecology and breeding biology have been completed. Monitoring of breeding population size and success is ongoing. Feral cats have now been eliminated from Macquarie Island. Tourists on breeding islands are managed to prevent disturbance.

Conservation Actions Proposed
Carry out surveys to obtain an up-to-date population estimate. Determine trends in numbers. Monitor rates and effects of marine debris ingestion. Monitor the effects of fishing. Establish demographic parameters, particularly survival of different age classes. Study the potential impacts of climate change. Control rat populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The current world population of the Royal penguin is believed to be stable at around 850,000 pairs (2) (5). There are a number of studies taking place to discover more about the migratory habits of the bird, and their main breeding site, Macquarie Island, enjoys protected status from the Tasmanian government.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Today the Royal Penguin provides no real economic gain to humans. Perhaps one could count Eudyptes schlegeli's aesthetic beauty that is observed by tourists on the government protected Macquarie Island. In years past, the species were killed and boiled down for their oil (Royal 1998). Fortunately, today there are more effective ways of getting similar oils and Royal Penguins are no longer hunted.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Royal Penguin

The Royal Penguin (Eudyptes schlegeli) is a penguin-type, which can be found on the sub-Antarctic islands in the Australian region (Macquarie Island and adjacent islands). It is one of the species of crested penguins. There is no distinction among the subspecies on the Penguin canopy, but they should not be confused with the similarly named King Penguin or Emperor Penguin. The IUCN classifies the Royal penguin as threatened. The scientific name commemorates the German zoologist Hermann Schlegel.

There is some controversy over whether Royal Penguins are a sub-species of Macaroni Penguins. Individuals of the two groups have been known to interbreed, though this is a relatively rare occurrence. Indeed, other penguins have been known to form mixed-species pairs in the wild.

Contents

Taxonomy

Breeding

Royal Penguin rookery on Macquarie Island.

They inhabit the waters surrounding Antarctica. Royals look very much like Macaroni Penguins, but have a white face and chin instead of the Macaronis' black visage. They are 65–76 cm (26–30 in) long and weigh 3–8 kg (6.6–18 lb).[2][3] Males are larger than females. Royal Penguins breed only on Macquarie Island and, like other penguins, spend much of their time at sea, where they are assumed to be pelagic.

Royal Penguins nest on beaches or on bare areas on slopes covered with vegetation. Like most seabirds they are colonial, nesting in scrapes on the ground up to a mile inland. The breeding season begins in September with laying starting in October. Two eggs are incubated for 35 days, with each incubation stint lasting up to two weeks. After brooding the chick for three weeks, both parents forage at sea while the chicks form large creches. The chicks fledge after two months. Young adults usually return to the colony to breed after six years.

Diet

Royal Penguins fighting on Macquarie Island

Royal Penguins feed on krill, fish, and small amounts of squid. They build their nest by making a shallow hole in the sand or in a weeded area. They put plants and stones inside the nest. Most of the time, two eggs are often laid, however, only one survives. The egg is kept warm by both parents for 35 days. This is done by rotating 12 day shifts. After hatching, the male watches out for the chick for 10 to 20 days and the female brings food for both of them. Around 20 days, the chicks will form a home for warmth and safety. The parents continue to feed it 2 to 3 times a day. When the chick is about 65 days old it will have its adult feathers and goes on its own.

Threats

Royal Penguins are not considered threatened. Historically they were "harvested" (exploited) for their oil; between 1870 and 1919 the government of Tasmania issuing licences for hunting them, with an average of 150,000 penguins (both Royal and King) being taken each year. At the peak of the industry in 1905, the plant established on Macquarie Island was processing 2000 penguins at a time, with each penguin yielding about half a litre of oil.[4]

Since the end of penguin hunting on Macquarie the numbers have climbed to 850,000 pairs. Before hunting started, there were 3 million penguins on the island (both Royal and King).[4]

AudioRoyalPenguins.oga
Sound of Rookery at Hurd Point

References

  • del Hoyo,J., Elliot, A., Sargatal, J., eds (1992) Handbook of the Birds of the World, Volume One Ostritch to Ducks, ISBN 84-87334-10-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!