Overview

Brief Summary

Biology

Breeding begins around the age of six (4) (5), with males returning to the breeding colony in August, and females following shortly after (4). Single males attract females by standing upright with their wings extended and repeatedly pumping their chest. Nests are shallow dug holes in the ground, lined with twigs and small branches, usually built under trees and shrubs to shield it from the sun (5). Two eggs are typically laid in late September to early October, the first, smaller egg being laid four to five days before the second, larger egg (4) (5). Both parents take turns incubating the eggs for the first 10 days, after which the male goes to the ocean to feed while the female incubates the eggs for 12 days straight and then vice versa. A mutual display of bowing and trumpeting (extending the beak vertically in the air and calling out) is performed when the male returns to the nest, helping to cement the bond (5). For the first three weeks after hatching, the male stands guard, protecting the chicks from predators, while the female forages and returns daily to feed the young (4) (5) (6). As with most penguins, both chicks rarely survive, with many pairs losing an egg during incubation, or one chick usually dying before the end of the guard stage. After the guard stage, the chick begins to explore its surroundings, creching with other nearby chicks, but returning to the nest to be fed. At 11 weeks the young fledge (4). Little has been recorded on the diet of the Snares crested penguin, but krill, squid and fish are known to be included (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This medium-sized species has the immediately recogniseable pattern of most penguins of snowy-white underparts and dark blue-black upperparts, head and throat. The Snares crested penguin's most noticeable feature is a bright yellow, thin, bushy crest running above and behind each eye (3). The red-brown bill is very robust, particularly in the male, and the conspicuous bare pink skin at its base helps distinguish the Snares from the similar Fiordland penguin (E. pachyrhynchus) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eudyptes robustus breeds on the Snares Islands (3 km2), 200 km south of New Zealand. The population was estimated at 23,250 breeding pairs in 1985-1986; 19,000 on North-East Island, 3,500 on Broughton and 750 on the Western Chain islets. In 2000, 25,861 pairs were counted on North-East Island and 4,000 on Broughton (Amey et al. 2001). The 2008 survey produced counts of 21,819 nests on North-East Island and 4,234 nests on Broughton, suggesting that the species had experienced a poor breeding year in line with that observed in the other seabird species present; a repeat survey in 2010 found 25,905 nests on North-East Island and 5,161 nests on Broughton (J. Hiscock in litt. 2012). The population is considered stable (J. Hiscock in litt. 2012). The wintering range is largely unknown, although occasional records from the waters off Tasmania and South Australia suggest a movement towards Australia (D. Houston in litt. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Snares I. and adjacent waters off New Zealand.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eudyptes robustus is restricted to Snares Island, south of New Zealand, and the adjacent ocean. Snares Island is a marine sanctuary that restricts access to humans (Muller-Schwarze 1984).

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Other Geographic Terms: island endemic

  • Muller-Schwarze, D. 1984. Behavior of Penguins. Albany, New York: University of New York Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeding is confined to the Snares Islands off southern New Zealand, but the wintering range is largely unknown, although occasional records exist from the waters off Tasmania and South Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As with the other five species of Eudyptes, E. robustus has characteristic yellow plumes or crests on the head (Muller-Schwarze 1984). Eudyptes robustus stands between 50 and 60 cm tall. They are physically similar to the Fjordland penguin (Eudyptes pachyrhynchus). They have a thick heavy bill, with white or pink skin around the base of the beak. They have all black feathers on their cheeks as opposed the white feather tufts on the cheek of the Fjordland penguin. Eudyptes robustus has broad crests that grow from the beak to the back of the head (Penguins Around the World 2000). Males and females are physically very similar, however the male is usually a little taller and weighs a little more.

Range mass: 3000 to 4000 g.

Range length: 50 to 60 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests in dense colonies, of usually between 50 and 500 pairs (mean 200, range 1-1,305 [Department of Conservation unpubl. data]), mostly under the forest on North-East Island, but otherwise in the open (P. J. McClelland in litt. 1999, J. Hiscock in litt. 2012). Chicks are fed on krill (60%), fish (30%) and squid (10%), and that there are indications that fish and squid play a more important role in the diet of adults (Mattern et al. 2009). In the breeding season, the species forages predominantly in the Subtropical Convergence Zone during the incubation period and within a 50-km radius to the north of the Snares Islands after hatching (Mattern 2012). It may first breed at four years of age and the oldest known bird lived to 20 years (Heather and Robertson 1997). The yellow crest of the species may serve as a condition-dependent indicator to conspecifics, thus potentially a signal of social status or attractiveness (McGraw et al. 2009).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudyptes robustus lives in the temperate subantarctic subzone. This habitat provides enough vegetation for nest building and roosting. Snares Island is heavily forested, but the shores are rocky with mosses filling in the gaps. The main rock type is muscovite granite. The ground is cover to a depth of two meters with peat. This is the area where E. robustus builds its nests (Russ 2000).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nests are typically constructed in dense colonies in muddy, forested areas and on rocky slopes, with these colonies often shifting to new sites as the vegetation is killed off by breeding and nesting activities (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of the Snares Island Penguin is not well known, however, researchers believe that it is made up of krill, squid, and fish (Barham and Barham 1996). Fish makes up approximately 18% of its diet.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

There are around 135 breeding colonies for E. robustus on Snares Island, with approximately two nests per square meter. These colonies produce an average of 44 fledglings per year. Breeding begins around age six. The reproductive cycle begins in the first three weeks of September.

The nests are created by digging shallow holes in the ground. These holes are lined with twigs and small branches. Eudyptes robustus builds the nest under trees and shrubs to shield themselves from the sun. If the vegetation is destroyed by storms the breeding grounds are moved (Penguins Around the World 2000).

The first egg is laid is usually small, then 4-5 days later a larger egg is laid. Both parents take turns incubating the eggs for the first 10 days. At this point the male goes to the ocean to feed the female who incubates the eggs for twelve days straight. When the male returns, the female goes to the ocean to feed and the male incubates the eggs for the next eleven days. The first three weeks after the chicks hatch, the male acts as a guard, protecting them from predators. Usually only one of every two chicks survive the guard stage. This high mortality rate is due to weather, primarily rainstorms. Predation and parasites are not significant sources of mortality. Approximately 75 days after hatching the chick goes to sea with the parents and then continues on its own (Muller-Schwarze 1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes robustus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGACTATTCTCCACCAACCACAAAGATATCGGCACCCTTTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTCAGCCTACTCATCCGCGCAGAGCTCGGTCAACCCGGAACTCTTCTAGGTGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAATTGATTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCTGGCACAGGATGGACTGTATATCCACCACTAGCAGGCAACCTAGCCCATGCCGGGGCATCCGTAGACTTAGCCATCTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTAGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTATCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGATCCCGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTTTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATACTACACAGGCAAAAAAGAACCCTTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGAATAGACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes robustus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Bell, B., Hiscock, J., Houston, D., Mattern, T., McClelland, P. & Weeber, B.

Justification
This species is classified as Vulnerable because it is restricted to one extremely small island group and hence is susceptible to stochastic events and human activities. Population trends are not clear, but if it is shown to be undergoing any decline, as is happening in some congeners, the species should be uplisted to Critically Endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

At present, there are no conservation issues facing E. robustus. All 17 species of penguins are legally protected from hunting and egg collecting. There are no introduced land predators on Snares Island, however, researchers believe that the introduction of the Norwegian rat (Rattus norvegicus) could pose a serious problem. At present the only predators of adult E. robustus is the Hooker's sea lion. Eggs and chicks are subject to predation by brown skuas and giant petrels. Because the population is restricted to Snares Island, there is no danger from human contact (Sea World 2001).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A survey in 2010 found 25,905 nests on North-East Island and 5,161 nests on Broughton (J. Hiscock in litt. 2012), suggesting that there are c.31,000 pairs, or c.62,000 mature individuals. This is assumed to equate to a total population of c.93,000 individuals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threats are commercial fisheries, oceanographic changes, and oil spills (Mattern 2012). There are no introduced predators on the Snares Islands and consequently the possibility of the accidental introduction of mammals is a continual concern (B. D. Bell verbally 1993). The Snares Islands are the site of a large squid fishery, which may be in competition with the species (Ellis et al. 1998). Other Eudyptes species in the region are presently undergoing major declines (E. sclateri, E. chrysocome), perhaps due to oceanic warming and the associated change in distribution of prey species (Ellis et al. 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although no major threats currently face the Snares crested penguin, the species is considered vulnerable due to its breeding population being confined to one small island group (3). The Snares Islands are completely free of introduced predators and any accidental introduction could be disastrous (3) (4). Additionally, waters surrounding these islands are the target of a large squid fishery, which may be reducing the penguin's available prey. Other related species within the region, notably the erect-crested penguin (E. sclateri) and rockhopper penguin (E. chrysocome), are known to be undergoing major declines, possibly due to oceanic warming and the resultant redistribution of prey species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The islands are nature reserves and part of a World Heritage Site declared in 1998. Landing is by permit only (D. Houston in litt. 2008).

Conservation Actions Proposed
Census all breeding colonies during incubation period. Complete regular counts every 10 years to monitor trends in the population (Taylor 2000). Turn World Heritage Site territorial seas (out to 12 nautical miles) into a marine reserve and restrict all fishing (B. Weeber in litt. 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Due to concern about the accidental introduction of predators, the Snares Islands have been designated as nature reserves and part of a World Heritage Site, with landing by permit only (3) (4) (7). This species is also protected by the New Zealand government (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Because E. robustus has almost no contact with humans, it has no positive or negative impact on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Snares Penguin

The Snares penguin (Eudyptes robustus), also known as the Snares crested penguin and the Snares Islands penguin, is a penguin from New Zealand. The species breeds on The Snares, a group of islands off the southern coast of the South Island. This is a medium-small, yellow-crested penguin, at a size of 50–70 cm (20–28 in) and a weight of 2.5–4 kg (5.5-8.8 lbs). It has dark blue-black upperparts and white underparts. It has a bright yellow eyebrow-stripe which extends over the eye to form a drooping, bushy crest. It has bare pink skin at the base of its large red-brown bill.

This penguin nests in small (10 nests) to large (1200 nests) colonies under forest cover or the open. The main colonies are located on North East Island, other colonies are established on Broughton Island as well as the rocky Western Chain. The Snares penguin's main prey is krill, supplemented by squid and small fish. The species is currently rated as vulnerable by the IUCN as its breeding range is restricted to one small island group. The current population is estimated at around 25,000 breeding pairs.

Nomenclature[edit]

Snares penguins were originally collected in 1874 and named atrata by Frederick Wollaston Hutton. However, Hutton lost his sample at sea, whilst drawing the bird with the assistance of penguin enthusiast Emile Campbell-Browne, before a full speciation could be identified. A description written by Hutton and an illustration done by Keulemans in Buller’s A History of the Birds of New Zealand are evidence that this is the same penguin previously identified by Hutton. However, there is some debate over the classification of this penguin, and Oliver was able to successfully propose that a few slight anatomical differences did exist between the Snares penguins and the early description and illustration, leading the Snares penguin to be called robustus instead of atratus.[2]

Description[edit]

The Snares penguin is often compared to the Fiordland penguin (Eudyptes pachyrhynchus), which is related by the genus of crested penguins (Eudyptes). Snares penguins can be distinguished from Fiordland penguins by a patch of skin at the base of their beaks.[3] The Snares penguin is similarly colored to other species of penguins, having a black head, back and flippers with a white belly. A bright-yellow crest, beginning at the base of the bill, runs along the upper part of the head on both sides and ends at the back of the head. It has a thick reddish-brown beak, traced with light pink skin at the base.[4] The eyes are generally described as a bright red-brown color, but this coloration can vary somewhat between individuals and in different lighting.[2] The color patterns under the wings differ from individual to individual, so it is not a good characteristic for species identification.[5]

The penguin can make a large variety of vocal noises. It is difficult to verbally describe these noises, but they range from hisses and explosive cries when threatened to rhythmical braying and trumpeting sounds that can be heard from long distances at sea.[2]

Distribution and habitat[edit]

The Snares penguin is named after the place in which it breeds—the Snares Islands. The Snares Islands are a small group of islands off the coast of southern New Zealand. Although little is known of their range and migration outside of the breeding season, it is not thought that they migrate far in the winters. Occasional sitings have occurred on the coasts of Tasmania, southern Australia, the Chatham Islands, Stewart Island, and the southern New Zealand mainland.[6][7] There are approximately 25,000 living pairs of Snares penguins.[4]

Diving Snares penguins

Snares penguins nest in dense colonies under the tree cover of the Olearia forests or on coastal rocks.[5] To build a nest, the penguins dig up shallow holes in the ground and layer the bottom with grass, leaves, twigs, peat, or pebbles.[4] A small rim of mud is added to the rim of the nest to raise it above ground level.[2] Vegetation at nesting sites dies dues to the dense nesting activities, and the colony moves to a new nesting site.[6] Colonies nesting near streams may have some advantage, as the stream provides water for drinking and bathing. However, it is not essential that nesting colonies are located near a stream and many are far from any stream.[2]

Conservation[edit]

Although Snares penguins are not currently threatened, they are considered a vulnerable species. If a threat arose, it could quickly wipe out their population because their breeding grounds are confined to a small island group. Possible threats include the introduction of a new predator, overfishing around the islands that would deplete their food source, increasing water temperatures from global warming driving prey away, and pollution.[6][7] The New Zealand government has taken action to protect the Snares Islands habitats and marine feeding grounds.[4]

Behavior[edit]

Diet[edit]

The diet of Snares penguins usually consists of krill of the species Nyctiphanes australis, small fish, and cephalopods. One study found that about 60 percent of the mass of stomach contents from Snares penguins consisted of krill, 30 percent was fish, and about 10 percent was cephalopods. The researchers concluded that the number of fish otoliths and cephalopod beaks indicated the importance of these types of prey to adult penguins while at sea.[8] Another study reports the diet consisting of about 55 percent krill, 24 percent fish, and 21 percent cephalopods, also suggesting that fish and cephalopods are more important prey types than the percentages of stomach composition indicate.[9]

Foraging ecology[edit]

The foraging patterns of breeding Snares penguins are well defined. After shared incubation of eggs, males leave on two-week-long foraging trips, which has been found to be synchronized with spring plankton blooms, as they are reliable predictors of food sources.[9] Upon the return of the males, the females go on somewhat shorter foraging trips (less than a week), returning in time for the chicks to hatch. Throughout the chick guard stage, the female is the lone provider of food performing short foraging trips (one to three days). While male penguins performing long foraging trips reach depths of up to 120 m, chick rearing birds usually exhibit shallow pursuit diving strategies (average dive depths 20-40 m) to catch prey.[9]

Predators[edit]

Predators of adult Snares penguins are sea lions and leopard seals. Their eggs and chicks are hunted by skuas and petrels.[3]

Courtship and breeding[edit]

The breeding season of Snares penguins occurs in the summer of New Zealand, beginning in early September and ending in late January.[10] Snares penguins begin reproducing in the age range of five to nine years old.[2] To court females, single males stand erect with their wings spread out and pumping their chest.[6] It is likely that the pairs remain faithful to each other for more than one season. The pairs then build a nest, most of the work being done by the male.[2] The female lays two eggs, typically about three to five days apart, which hatch 31–37 days later. The second laid egg is up to 85 percent larger than the first and also hatches first. The smaller, last-hatched chick is outcompeted by its siblings and usually does not survive, also called "siblicide". Egg-size dimorphism is particularly large in Snares penguins, and the larger egg hatching first only accentuates the sibling size difference.[10] Hatching pattern and size-dimorphic eggs are two of the mechanisms by which birds can change their breeding pattern in response to environmental and breeding conditions. In altricial birds, such as Snares penguins, egg-size variation and asynchronous hatching are adaptive mechanisms that may lead to brood reduction. However, Snares penguins and other members of their genus, Eudyptes, differ from most other birds in that their last laid egg is larger and hatches first rather than being the smallest and last to hatch.[11]

Egg incubation does not occur until both eggs have been laid, and they are usually incubated one in front of the other. The smaller, first-laid egg is often placed in the anterior position for incubation, which is thought to be the less favorable location since they have lower and more variable temperatures during incubation. Although the smaller, first egg receives less favorable incubation, it was found that egg-size dimorphism affects the hatching pattern in Snares penguins instead of egg incubation position.[12] Both parents incubate the eggs. For the first ten days, they alternate. Then the male leaves for an extended period (about 12 days) to forage for food, while the mother stays with the eggs. When he returns, the roles are reversed. Also, upon his return, the pair engages in a display of bowing and trumpeting, which further strengthens their bond. For the first three weeks after hatching, the male guards the chicks from predators while the female searches for food, returning each day to feed her offspring.[6] It was observed that parents can recognize their chicks and chicks can recognize their parents. The study found that calls between chick and parent were more important for recognition than visual cues.[13] The parents provide food for their young each day until it has molted and can forage for its own food.[4] The chicks fledge at approximately 11 weeks.[3]

References[edit]

  1. ^ BirdLife International (2012). "Eudyptes robustus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g Warham, John. "The Breeding Biology and Behavior of the Snares Crested Penguin." Journal of the Royal Society of New Zealand 4.1 (1974): 63-108. Google Books. Web. 16 Apr. 2011.
  3. ^ a b c "Snares Penguins, Eudyptes robustus". MarineBio.org. Retrieved 2011-12-01. 
  4. ^ a b c d e "Snares Island Penguin". Antarctic Connection. Retrieved 2011-12-01. 
  5. ^ a b "Snares Penguin: Eudyptes Robustus". PenguinWorld.com. Lloyd Spencer Davis & Adelie Productions. Retrieved 2011-12-01. 
  6. ^ a b c d e "Snares Crested Penguin - Eudyptes Robustus". ARKive.org. Retrieved 2011-12-01. 
  7. ^ a b "Snares Crested Penguin". Center for Biological Diversity. Retrieved 2011-12-01. 
  8. ^ Mattern T, Houston D, Lalas C, Setiawan A, and Davis LS (2009) "Diet Composition, Continuity in Prey Availability and Marine Habitat - Keystones to Population Stability in the Snares Penguin (Eudyptes Robustus)". Emu 109(3): 204-13.
  9. ^ a b c Mattern, Thomas. "Marine Ecology of Offshore and Inshore Foraging Penguins: the Snares Penguin Eudyptes Robustus and Yellow-eyed Penguin Megadyptes Antipodes." Australasian Digital Theses Program (2007). University of Otago. Web. 16 Apr. 2011.
  10. ^ a b Massaro, Melanie, and Lloyd S. Davis. "Differences in Egg Size, Shell Thickness, Pore Density, Pore Diameter and Water Vapour Conductance between First and Second Eggs of Snares Penguins Eudyptes Robustus and Their Influence on Hatching Asynchrony." Ibis 147.2 (2005): 251-58. Wiley Online Library. Web. 16 Apr. 2011.
  11. ^ Slagsvold, Tore, Jostein Sandvik, Gunnar Rofstad, Oystein Lorensten, and Magne Husby. "On the Adaptive Value of Intraclutch Egg-Size Variation in Birds." The Auk 101.4 (1984): 685-97. JSTOR. Web. 16 Apr. 2011.
  12. ^ Massaro, Melanie, and LloydS. Davis. "Preferential Incubation Positions for Different Sized Eggs and Their Influence on Incubation Period and Hatching Asynchrony in Snares Crested (Eudyptes Robustus) and Yellow-eyed Penguins (Megadyptes Antipodes)." Behavioral Ecology and Sociobiology 56.5 (2004): 426-34. JSTOR. Web. 16 Apr. 2011.
  13. ^ Proffitt, Fiona, and Ian McLean. "Recognition of Parents' Calls by Chicks of the Snares Crested Penguin." Bird Behavior 9 (1990): 103-13. Ingentaconnect. Web. 16 Apr. 2011.
  • Wilson, David. "Causes and Benefits of Chick Aggregations in Penguins." The Auk 126.3 (2009): 688-93. JSTOR. Web. 16 Apr. 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!