Overview

Brief Summary

Biology

Breeding begins around the age of six (4) (5), with males returning to the breeding colony in August, and females following shortly after (4). Single males attract females by standing upright with their wings extended and repeatedly pumping their chest. Nests are shallow dug holes in the ground, lined with twigs and small branches, usually built under trees and shrubs to shield it from the sun (5). Two eggs are typically laid in late September to early October, the first, smaller egg being laid four to five days before the second, larger egg (4) (5). Both parents take turns incubating the eggs for the first 10 days, after which the male goes to the ocean to feed while the female incubates the eggs for 12 days straight and then vice versa. A mutual display of bowing and trumpeting (extending the beak vertically in the air and calling out) is performed when the male returns to the nest, helping to cement the bond (5). For the first three weeks after hatching, the male stands guard, protecting the chicks from predators, while the female forages and returns daily to feed the young (4) (5) (6). As with most penguins, both chicks rarely survive, with many pairs losing an egg during incubation, or one chick usually dying before the end of the guard stage. After the guard stage, the chick begins to explore its surroundings, creching with other nearby chicks, but returning to the nest to be fed. At 11 weeks the young fledge (4). Little has been recorded on the diet of the Snares crested penguin, but krill, squid and fish are known to be included (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This medium-sized species has the immediately recogniseable pattern of most penguins of snowy-white underparts and dark blue-black upperparts, head and throat. The Snares crested penguin's most noticeable feature is a bright yellow, thin, bushy crest running above and behind each eye (3). The red-brown bill is very robust, particularly in the male, and the conspicuous bare pink skin at its base helps distinguish the Snares from the similar Fiordland penguin (E. pachyrhynchus) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eudyptes robustus breeds on the Snares Islands (3 km2), 200 km south of New Zealand. The population was estimated at 23,250 breeding pairs in 1985-1986; 19,000 on North-East Island, 3,500 on Broughton and 750 on the Western Chain islets. In 2000, 25,861 pairs were counted on North-East Island and 4,000 on Broughton (Amey et al. 2001). The 2008 survey produced counts of 21,819 nests on North-East Island and 4,234 nests on Broughton, suggesting that the species had experienced a poor breeding year in line with that observed in the other seabird species present; a repeat survey in 2010 found 25,905 nests on North-East Island and 5,161 nests on Broughton (J. Hiscock in litt. 2012). The population is considered stable (J. Hiscock in litt. 2012). The wintering range is largely unknown, although occasional records from the waters off Tasmania and South Australia suggest a movement towards Australia (D. Houston in litt. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudyptes robustus is restricted to Snares Island, south of New Zealand, and the adjacent ocean. Snares Island is a marine sanctuary that restricts access to humans (Muller-Schwarze 1984).

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Other Geographic Terms: island endemic

  • Muller-Schwarze, D. 1984. Behavior of Penguins. Albany, New York: University of New York Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Snares I. and adjacent waters off New Zealand.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeding is confined to the Snares Islands off southern New Zealand, but the wintering range is largely unknown, although occasional records exist from the waters off Tasmania and South Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

As with the other five species of Eudyptes, E. robustus has characteristic yellow plumes or crests on the head (Muller-Schwarze 1984). Eudyptes robustus stands between 50 and 60 cm tall. They are physically similar to the Fjordland penguin (Eudyptes pachyrhynchus). They have a thick heavy bill, with white or pink skin around the base of the beak. They have all black feathers on their cheeks as opposed the white feather tufts on the cheek of the Fjordland penguin. Eudyptes robustus has broad crests that grow from the beak to the back of the head (Penguins Around the World 2000). Males and females are physically very similar, however the male is usually a little taller and weighs a little more.

Range mass: 3000 to 4000 g.

Range length: 50 to 60 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests in dense colonies, of usually between 50 and 500 pairs (mean 200, range 1-1,305 [Department of Conservation unpubl. data]), mostly under the forest on North-East Island, but otherwise in the open (P. J. McClelland in litt. 1999, J. Hiscock in litt. 2012). Chicks are fed on krill (60%), fish (30%) and squid (10%), and that there are indications that fish and squid play a more important role in the diet of adults (Mattern et al. 2009). In the breeding season, the species forages predominantly in the Subtropical Convergence Zone during the incubation period and within a 50-km radius to the north of the Snares Islands after hatching (Mattern 2012). It may first breed at four years of age and the oldest known bird lived to 20 years (Heather and Robertson 1997). The yellow crest of the species may serve as a condition-dependent indicator to conspecifics, thus potentially a signal of social status or attractiveness (McGraw et al. 2009).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudyptes robustus lives in the temperate subantarctic subzone. This habitat provides enough vegetation for nest building and roosting. Snares Island is heavily forested, but the shores are rocky with mosses filling in the gaps. The main rock type is muscovite granite. The ground is cover to a depth of two meters with peat. This is the area where E. robustus builds its nests (Russ 2000).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nests are typically constructed in dense colonies in muddy, forested areas and on rocky slopes, with these colonies often shifting to new sites as the vegetation is killed off by breeding and nesting activities (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of the Snares Island Penguin is not well known, however, researchers believe that it is made up of krill, squid, and fish (Barham and Barham 1996). Fish makes up approximately 18% of its diet.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There are around 135 breeding colonies for E. robustus on Snares Island, with approximately two nests per square meter. These colonies produce an average of 44 fledglings per year. Breeding begins around age six. The reproductive cycle begins in the first three weeks of September.

The nests are created by digging shallow holes in the ground. These holes are lined with twigs and small branches. Eudyptes robustus builds the nest under trees and shrubs to shield themselves from the sun. If the vegetation is destroyed by storms the breeding grounds are moved (Penguins Around the World 2000).

The first egg is laid is usually small, then 4-5 days later a larger egg is laid. Both parents take turns incubating the eggs for the first 10 days. At this point the male goes to the ocean to feed the female who incubates the eggs for twelve days straight. When the male returns, the female goes to the ocean to feed and the male incubates the eggs for the next eleven days. The first three weeks after the chicks hatch, the male acts as a guard, protecting them from predators. Usually only one of every two chicks survive the guard stage. This high mortality rate is due to weather, primarily rainstorms. Predation and parasites are not significant sources of mortality. Approximately 75 days after hatching the chick goes to sea with the parents and then continues on its own (Muller-Schwarze 1984).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes robustus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGACTATTCTCCACCAACCACAAAGATATCGGCACCCTTTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTCAGCCTACTCATCCGCGCAGAGCTCGGTCAACCCGGAACTCTTCTAGGTGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAATTGATTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCTGGCACAGGATGGACTGTATATCCACCACTAGCAGGCAACCTAGCCCATGCCGGGGCATCCGTAGACTTAGCCATCTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTAGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTATCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGATCCCGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTTTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATACTACACAGGCAAAAAAGAACCCTTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGAATAGACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes robustus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Bell, B., Hiscock, J., Houston, D., Mattern, T., McClelland, P. & Weeber, B.

Justification
This species is classified as Vulnerable because it is restricted to one extremely small island group and hence is susceptible to stochastic events and human activities. Population trends are not clear, but if it is shown to be undergoing any decline, as is happening in some congeners, the species should be uplisted to Critically Endangered.


History
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Lower Risk/least concern (LR/lc)