Overview

Brief Summary

Biology

After spending much of the year alone in the open ocean, males arrive at the chosen breeding site ahead of the females during late June or July. Two weeks later the females arrive and mating takes place. The birds are monogamous and prefer their nest sites to be hidden from one another. Two pale-green eggs are laid in a cavity between tree roots, stones or small burrows in the coastal forest, and incubation takes from four to six weeks. The birds do not attempt to collect nest materials. Although it is usual for just one egg to hatch successfully, occasionally both chicks emerge. However, the parents rarely catch enough food for two offspring and the smaller chick usually dies (3). While the chick is still defenceless, one parent (usually the male), will guard it whilst the other finds food. Fiordland crested penguins feed inshore and catch crustaceans, squid and small fish which they regurgitate for the chick. Once the young is large enough to be safe from most native predators, both parents take on the role of fishing to provide their offspring with food. Chicks often wander about the nest site or gather in loose-knit crèches. After about 10 or 11 weeks, the chick moults and leaves the nest site, finally adopting the solitary pelagic lifestyle of the adult birds. It will return to breed at the age of five years (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

One of the smaller members of the penguin family, the Fiordland crested penguin has a black head, throat and back, a white front and underside, a thick stubby orange bill and pink feet. The most distinguishing features are the yellow sulphur-coloured crests above the eyes that extend from the bill to just behind the head. Both sexes are similar, whereas young birds have paler cheeks and shorter crests (2) (4). Like other members of the genus Eudyptes the Fiordland crested penguin has a black throat but can be distinguished from the similar Rockhopper, Macaroni and Royal penguins by the shape, extent and colour of the eye crests (4). The two species that can be confused with the Fiordland crested are the erect-crested penguin and the Snares Island penguin. The former has eye crests that stand proud of the top of the head and no part which extends to below the eye itself. The latter is a slightly larger bird with a thicker bill (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

South I. (New Zealand) and adjacent subantarctic islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australia, New Zealand, New Zealand Exclusive Economic Zone, Southern Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Eudyptes pachyrhynchus nests on Stewart Island and several of its offshore islands, Solander Island and on the west to south-west coast of the South Island, New Zealand. The population is estimated at 2,500-3,000 breeding pairs, mostly nesting on predator-free islands, and divided into 12 major, fragmented breeding sites with c.100 nests or more4. Numbers appear to be declining in some populations, principally those on the mainland where predators have the greatest impact. At Open Bay Island, there was a decline of 33% between 1988 and 19951, and at Dusky Sound there were "thousands" of birds in 1900 but only a few hundred in the 1990s5. Non-breeding dispersal patterns at sea are largely unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Fiordland Penguins Eudyptes pachyrhynchus are found from the southwestern coast of the South Island of New Zealand, to the nearby islands of Stewart and Solander.

(Stonehouse 1975; Simpson 1976)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:


Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

A migratory species, found in Antarctic waters and around the southern circumpolar islands, the Fiordland penguin breeds on the coast of southwest New Zealand, Stewart Island and Solander Island (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Fiordland Penguin, also known as the thick-billed penguin, has an average length of 55cm (21 in). The head and body of this penguin are black, with the exception of its white front and the white markings on its cheeks. Fiordland Penguins have a crest of brilliant yellow feathers which are visible at the base of the bill and extend over the eye. Fiordland Penguins are monomorphic, that is the male and female look alike. Fiordland Penguin chicks have gray-brown backs with white fronts.

(Barham 2000; Stonehouse 1975; Lynch 1997)

Range mass: 2000 to 5000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in colonies, situated in dense, temperate rainforest along shores and rocky coastlines, sometimes in sandy bays. It feeds on fish, squid, octopus and krill2. It first breeds at 5-6 years old2 and birds may live for 10-20 years1.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fiordland penguins have a pelagic aquatic habitat (open ocean). They will spend up to 75% of their lives in the ocean during the winter, as a result barnacles often attach themselves to the penguins tail. The other 25% of the Fiordlands life is spent on secluded land areas during the breeding season.

(Lynch 1997; Sparks and Soper 1987)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Outside the breeding season, Fiordland crested penguins are birds of the open ocean. When ashore to breed they prefer secluded coastlines and chose nesting sites that are amongst rocks or have tree cover (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fiordland Penguins feed in coastal waters, particularly during the breeding season. Fiordlands have a diet consisting of crustaceans, small fish, and squid. (Barham 2000; Sparks and Soper 1987)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

The Fiordland Penguin typically locates its breeding site inland from the coast (distances vary), with some nest sites at areas up to 100m above sea level. Nesting in loose colonies, Fiordlands locate their nests seperate and out of sight from one another. Unlike most crested penguins, the Fiordland Penguin does not nest in the open. Fiordland nests can be located in caves, under logs, at the base of trees, and under bushes (particularly away from sand flies).

Fiordland males return to the nesting sites in July, two weeks before the females. Shortly after the females arrive they mate. Soon after, the female Fiordland will lay two pale-green eggs, which incubate for 4-6 weeks. It is unusual for both of the eggs to hatch, but when they do, the parents are unable to gather enough food for both chicks. The result is the death of the smaller sibling. For the first 2-3 weeks of the chicks life, the male will stay and guard the nest while the female retrieves and regurgitates food for her young. In a couple of weeks both parents will search for food while leaving the chicks either alone or in loose creches (breeding groups). At about 75 days old, the Fiordland chicks will moult, and go to sea.

(Simpson 1976; Barham 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes pachyrhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGACTATTCTCCACCAACCACAAAGATATCGGCACCCTTTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTCAGCCTACTCATCCGCGCAGAGCTCGGTCAACCCGGAACTCTTCTAGGTGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAATTGATTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCTGGCACAGGATGGACTGTATATCCACCACTAGCGGGCAACCTAGCCCATGCCGGAGCATCCGTAGACTTAGCCATCTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTGGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGATCCCGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATACTATACAGGCAAAAAAGAACCCTTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes pachyrhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2be+3bce+4bce;C1+2a(i)

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s
Taylor, G.

Justification
This species qualifies as Vulnerable because it has a small population which is assumed to have undergone a continuing rapid reduction over the last three generations (29 years), based on trend data from a few sites and a variety of threats, especially introduced predators.

History
  • 2008
    Vulnerable
  • 2005
    Vulnerable
  • 2004
    Vulnerable
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
  • 1988
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the mid 1980's, it was estimated that there were 5,000 to 10,000 breeding pairs of Fiordland Penguins. Currently, there are an estimated 1,000 to 2,500 breeding pairs. The populations are upset by introduced predators such as ferrets, skuas, and wekas. Natural predators include fur seals, stoats, and larger predatory fish. (Barham 2000; Stonehouse 1975)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 09/02/2010
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Eudyptes pachyrhynchus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
McLean et al. (1997).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The endemic Weka Gallirallus australis has been introduced to several islands where it preys on eggs and chicks - causing up to 38% of egg mortality and 20% of chick mortality on Open Bay Island1. Other predators include dogs (particularly during moulting when adults are confined to the shore for 20-30 days), cats, stoat Mustela erminea and rats1,2,3. Birds are disturbed by humans at nest-sites, killed on roads, and may be accidentally captured in set-nets. Marine perturbations can cause substantial changes in prey abundance, and a future rise in sea temperatures could have a similar effect. Squid fisheries potentially compete for food1. A marine farm is planned for the Jackson's Bay area where 10% of the population of this species is found7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Fiordland crested penguin has declined in numbers drastically during the last twenty years. In the 1980s, the global population was estimated to number 10,000 breeding pairs. Today, the number is thought to be 2,500 to 3,000 pairs. The principal cause is believed to be from introduced animals such as cats and stoats (5), although where the birds' breeding sites are close to public beaches, pet dogs are thought to be largely responsible for disturbing adult birds and catching chicks. With the increase in human leisure activities, this pressure is bound to intensify (2). There is also a problem with the endemic weka, Gallirallus australis, which preys on eggs and chicks and is thought to contribute to over a third of egg loses in some breeding areas, especially Solander Island (5). At sea, penguins are in constant competition for food with fishing vessels and sometimes find themselves caught in fishing nets. Perhaps the biggest threat, however, is through marine pollution, particularly oil spillage and the illegal but common practice of discharging oil tanker ballast water off-shore (5). As yet, little is known about the possible effects of global warming on penguin populations (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The Open Bay Island population has been the focus of several recent studies. The Department of Conservation had planned to monitor all colonies for five years followed by five years rest, but, owing to difficulties censusing the species because pairs within colonies are well dispersed under tree-cover, and because disturbance by surveyors was thought to be increasing predation rate, only a selection of colonies are partially monitored every two years.

Conservation Actions Proposed
Survey areas of coastline not included in the 1990s survey. Quantify the effect of predators on island and mainland sites1. Eradicate G. australis from Big Solander Island6. Complete a detailed study on foraging ecology to identify potential competition with commercial fisheries and the effects of climatic variation1. Establish guidelines to control visitor access to colonies. Obtain legal protection for accessible colony sites6.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Recent surveys of a number of the Fiordland crested penguin's breeding areas have suggested that more research into predator-related threats need to be examined. One idea is to eradicate the weka – the principal local predator – from Solander Island to reduce the losses of eggs and chicks (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fiordland Penguin

The Fiordland Crested Penguin (Eudyptes pachyrhynchus), also known as Tawaki (Maori), is a species of crested penguin from New Zealand. It breeds along the Fiordland coast and its outlying islands as well as on Stewart Island/Rakiura.

Contents

Taxonomy

Also known as the Fiordland Crested Penguin, the Fiordland Penguin was described in 1845 by English zoologist George Robert Gray, its specific epithet derived from the Ancient Greek pachy-/παχυ- 'thick' and rhynchos/ρυνχος 'beak'.[2] It is one of six species in the genus Eudyptes, the generic name derived from the Ancient Greek eu/ευ 'good' and dyptes/δυπτης 'diver'.[2]

Description

They are medium-sized, yellow-crested, black-and-white penguins, growing to approximately 60 cm (24 in) long and weighing on average 3.7 kg (8.2 lbs), with a weight range of 2 to 5.95 kg (4.4 to 13.1 lb).[3] It has dark, bluish-grey upperparts with a darker head, and white underparts. It has a broad, yellow eyebrow-stripe which extends over the eye and drops down the neck. Most birds have 3-6 whitish stripes on the face.

Distribution and habitat

This penguin nests in colonies in dense temperate forest. It breeds along the Fiordland coast and its outlying islands as well as on Stewart Island/Rakiura.

Diet

The main prey species reported for Fiordland penguins are cephalopods (85%, mainly Arrow squid, Nototodarus sloanii), followed by crustaceans (13%, primarily Krill, Nyctiphanes australis) and fish (2%, mainly Red Cod and Hoki). However, the importance of cephalopods might be exaggerated.[4]

Conservation

The current status of this penguin is threatened due to its small population. Current population estimates range between 2,500-3,000 pairs and is thought to have declined since the late 1980s by around 33%. It is under threat from introduced predators including dogs, cats, stoats and rats.

References

  1. ^ BirdLife International (2012). "Eudyptes pachyrhynchus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106003854. Retrieved 16 July 2012.
  2. ^ a b Liddell, Henry George and Robert Scott (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4.
  3. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  4. ^ van Heezik, Y: Diet of the Fiordland Crested penguin during the post-guard phase of chick growth, Notornis 36: 151-156 (1989)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!