Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

The macaroni penguin is mainly active during the day. Very little is known of the species outside of the breeding season; most studies have been carried out on breeding birds. They feed mainly on krill (shrimp-like crustaceans), although in some areas, fish become an increasingly important food source as the breeding season progresses (5). It has been estimated that macaroni penguins alone consume four million tonnes of krill each year (6). In some populations, dives typically take the form of a V-shape, reaching depths of 48 m (4), although in other populations, the dive profiles were more complex (5). Birds return to the breeding colonies each year in October and November, with males arriving before the females (4). Individuals often have to walk hundreds of meters over screes to reach their nest site (2). Macaroni penguins are monogamous and pair-bonds are long-lasting. Each year the pair reunites at the same nest location, recognising each other by means of their calls (4). Pairs often perform a display known as the 'ecstatic display' in which their heads are swung from side to side (4). The nest is a simple scrape in the ground, typically lined with small rocks. In some cases, it may be made on a patch of grass and lined with grass shoots (4). Two eggs are laid; the second egg is always larger than the first and is usually the only successful egg per nest. If both eggs are lost, the pair is unable to produce a replacement brood (3). Incubation takes up to 37 days and is shared by the parents in three main shifts. The first shift lasts for 8 - 12 days and is shared by the male and female. The second shift (12 - 14 days) is carried out by the female and the final shift (9 - 11 days) by the male. During each shift, the non-incubating bird goes to forage at sea during the day (4) (2). The newly hatched chicks are helpless, and for the first 23 - 25 days they are guarded and brooded by the male, while the female forages and feeds the chicks each day by regurgitating food (4). After this period, the chicks have developed their first plumage, which allows them to maintain their own temperature and so they can leave the nest. They cluster into small crèches for protection; at this stage, both parents are able to forage (3). Most chicks will have fledged at 60 - 70 days of age (4), at which point they have developed waterproof plumage (3). They do not start to breed until five years of age in females and six in males (4). After the chicks leave the breeding colonies, the adults feed at sea for around three weeks before their annual moult. During the moult they are unable to forage, as their plumage is not watertight. After the 25-day moult the adults leave the colonies to spend the winter at sea (3). In undisturbed colonies, predation is relatively low. Eggs (mainly deserted ones) are predated upon by skuas, sheathbills, and kelp gulls while weakened chicks, or those separated from the crèche are taken by skuas and giant petrels. Whilst at sea, adult macaroni penguins are predated upon by leopard seals and Antarctic fur seals (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This large, crested penguin is similar in appearance to other members of the genus Eudyptes; the macaroni penguin is, however, larger than all other species except the royal penguin (E. schlegeli) (4). Adult macaroni penguins have golden-yellow plume-like feathers that arise from a central patch on the forehead, extending back along the crown and drooping down behind the eye (4) (2). The head, chin, throat and upperparts are black; the underparts are white and the flippers are black on the uppersurface but mainly white below (4). The large bill is orange-brown; the eyes are red and there is a patch of bare pink skin from the base of the bill to the eye. The legs and feet are pink. Males and females are similar in appearance, but males tend to be slightly larger (4). Immature birds lack the head plumes or have a few sparse yellow feathers on the forehead; their bills are smaller than those of adults and are brownish-black in colour; the chin and throat are dark grey (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The macaroni penguin is found on the edge of Antarctica and Sub-Antarctic islands south of the Americas and Africa. Large populations of this penguin can also be found in Chile, the Falkland Islands, South Georgia and the South Sandwich Islands, South Shetland Islands, Crozet Islands, Kerguelen Islands, and McDonald Islands.

Biogeographic Regions: neotropical (Native ); antarctica (Native )

  • Stonehouse, B. 1975. The Biology of Penguins. London: The MacMillan Press LTD..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Eudyptes chrysolophus breeds in at least 258 colonies at c.55 breeding sites (Crossin et al. 2013), including southern Chile, the Falkland Islands (Malvinas), South Georgia (Georgia del Sur) and the South Sandwich Islands (Islas Sandwich del Sur), the South Orkney and South Shetland Islands, Bouvet Island (to Norway), Prince Edward and Marion Islands (South Africa), Crozet Islands, Kerguelen Islands (French Southern Territories), Heard and McDonald Islands (to Australia) and very locally on the Antarctic Peninsula. The global population is estimated at 6.3 million breeding pairs, with key populations on Isles Crozet (2,200,000 pairs, including 1 million on Ilots des Pingouins), Kerguelen (1.8 million pairs), Heard Island (1 million pairs), South Georgia (1 million pairs) and Marion Island (290,000 pairs).

Previously, the global population had been estimated at c.9 million pairs (Woehler 1993, Ellis et al. 1998). The South Georgia and Bouvet populations probably increased substantially in the 1960s and early 1970s, but have subsequently decreased. At South Georgia, c.5 million pairs were estimated in the 1980s, falling to c.2.7 million pairs in the mid 1990s and to <1 million pairs in 2002 (Crossin et al. 2013). Volcanic activity eliminated a colony of c.1 million pairs on McDonald Island, although satellite images show unidentified penguins that may be recolonising individuals of this species (Crossin et al. 2013). Surveys on Heard Island (c.1 million pairs) suggest a decrease owing to losses in some smaller colonies. The population at Marion has decreased by over 30% from 434,000 pairs in 1994-1995 to 290,000 pairs in 2008-2009 (Crawford et al. 2009), and 267,000 pairs in 2012-2013 (Dyer and Crawford in press). However, populations on Kerguelen increased by c.1% per annum between 1962 and 1985, and subsequent data from 1998 indicated that colonies were stable or increasing (H. Weimerskirch per T. Micol in litt. 1999). Populations in South America may be stable but data are few.

Satellite tracking of individuals during winter revealed that individuals from Kerguelen spent most of their time in a previously unrecognised foraging area, i.e. a narrow latitudinal band (47-49 degrees S) within the central Indian Ocean (70-110 degrees E), corresponding oceanographically to the Polar Frontal Zone (Bost et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Subantarctic islands in s Atlantic Ocean and s Indian Ocean.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The macaroni penguin has a circumpolar range (4). It breeds at 50 known sites on sub-Antarctic islands in the South Atlantic and southern Indian Oceans, with one breeding site on the Antarctic Peninsula (2) (4). Main breeding populations are located on the islands of Crozet, Heard, McDonald, Keruguelen and South Georgia (2). In 12 years, study populations on South Georgia have decreased by 65% and it is thought that the overall population on South Georgia has declined by 50% in the last 20 years (2). Most of the world population of this penguin has declined by at least 20% in the last 36 years (equivalent to three generations), but surveys are required to confirm the status of the species (2). The range of the macaroni penguin outside of the breeding season is unknown, although it is thought that it stays in Antarctic waters (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Macaroni penguin is a medium-sized bird that stands about 71 centimeters tall and weighs between 5 to 6 kg. Females are usually smaller than males. Males and females are monomorphic. They have orange, yellow, and black crests that join on the top of the head. This penguin has a red bill, and the chin, face and under the throat have solid black feathers.

Range mass: 5000 to 6000 g.

Average wingspan: 71 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Macaroni penguins live in Antarctica in rocky, water-bound areas, on rocks and cliffs above the ocean.

Habitat Regions: polar ; terrestrial

Terrestrial Biomes: icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It nests on level to steep ground, often walking hundreds of metres across steep screes to nest-sites. Breeding areas usually have little or no vegetation due to erosion by birds. It feeds mainly on small krill (Marchant and Higgins 1990), although individuals from the Kerguelen Islands foraging in the Indian Ocean during winter do not feed on krill, taking other crustaceans instead (Bost et al. 2009).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19027 specimens in 2 taxa.
Water temperature and chemistry ranges based on 18972 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.348 - 9.431
  Nitrate (umol/L): 9.487 - 27.676
  Salinity (PPS): 33.189 - 34.140
  Oxygen (ml/l): 6.384 - 8.152
  Phosphate (umol/l): 0.938 - 1.987
  Silicate (umol/l): 1.978 - 89.471

Graphical representation

Temperature range (°C): -1.348 - 9.431

Nitrate (umol/L): 9.487 - 27.676

Salinity (PPS): 33.189 - 34.140

Oxygen (ml/l): 6.384 - 8.152

Phosphate (umol/l): 0.938 - 1.987

Silicate (umol/l): 1.978 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding colonies are situated on rocky slopes or level ground, usually in areas lacking vegetation, although some nests are located amongst tussock grass (4). Little is known of this species outside of the breeding season, but it is believed that it is pelagic, spending all of its time at sea (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Macaroni penguins live almost entirely on krill (Euphasiidae) supplemented with up to five percent squid. They also eat some fish and amphipod crustaceans (Amphipoda). Recently it was discovered that some populations travel long distances to feed on populations of subantarctic krill and the crustacean, Parathemisto gauchidaudii, in the Indian ocean. Macaroni penguins fast for up to forty days during the breeding season.

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Primary predators of macaroni penguins in the water are killer whales (Orca orcinus) and leopard seals (Hydrurga leptonyx). In colonies, skuas (Stercorariidae) prey on macaroni penguin nestlings and other weak individuals. As are most penguins, macaroni penguins are counter-shaded in the water, making them difficult to see. They use their agile swimming abilities, vision, and association with other macaroni penguins to be vigilant to predators and avoid capture in the water.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Although very near-sighted on land, penguins have exceptional vision in the water. Their eyes, like the many sea animals, are attuned to the colors of the sea. This excellent vision is needed to avoid predation by leopard seals and killer whales, which are their primary predators in the ocean. On land their main predator is the skua (a large bird) which snatches penguin's chicks from nests. The penguin communicates by complex ritual behaviors such as head and flipper waving, calling, bowing, gesturing and preening. Courtship and mating rituals include so called "ecstatic displays" where a bird, typically an unattached male, pumps his chest several times with his head stretched upwards and with flippers stretched outwards, projects a harsh loud braying sound. This can result in a mass trumpeting by other males, which is believed to help synchronize the breeding cycle.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Category

Breeding
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Macaroni penguins usually breed in the sub-Atlantic. Adults arrive to breed late in October, laying their eggs in early November. Macaroni penguin nests are made from scrapes found in mud or gravel among rocks. Macaroni penguins may assemble by the millions in their massive rookeries and can be smelled as far as 5-6 miles offshore. Macaroni penguins are atypical in that the first egg of the breeding season is much smaller and less likely to develop than the second egg. Two eggs are laid with only one chick usually being reared. Incubation is shared by both parents in long shifts. Eggs hatch after 33 to 37 days. The male broods and guards the chicks for 23 to 25 days while the females bring food daily. Chicks then gather into small creches and are fed every 1 to 2 days until they are ready to leave and go to sea (60 to 70 days old). Macaroni penguins leave their breeding colony by April or May.

Breeding interval: Macaroni penguins breed once yearly.

Breeding season: Adults arrive to breed late in October, laying their eggs in early November.

Average eggs per season: 2.

Range time to hatching: 33 to 37 days.

Range time to independence: 60 to 70 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

  • Ainley, D., R. LeResche, W. Sladen. 1983. Breeding Biology of the Adélie Penguin. London, England: University of California Press,Ltd..
  • Stonehouse, B. 1975. The Biology of Penguins. London: The MacMillan Press LTD..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudyptes chrysolophus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATCGGCACCCTCTACCTAATCTTCGGTGCATGAGCAGGCATAGCCGGAACTGCCCTTAGCCTACTCATCCGTGCAGAGCTCGGCCAACCTGGAACTCTCCTAGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAATAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAGGCAGGAGCTGGCACAGGATGAACTGTATACCCACCACTAGCGGGCAACCTAGCCCATGCCGGGGCATCTGTAGACTTAGCCATTTTCTCACTCCACCTAGCAGGAGTCTCCTCCATTCTTGGAGCAATTAACTTCATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCTCTATTCGTATGGTCCGTTCTTATCACAGCCGTCCTCCTACTACTCTCACTCCCCGTACTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATCCTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCTCATGTAGTAACATATTACGCAGGCAAAAAGGAACCCTTCGGCTACATAGGAATAGTATGAGCCATATTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCATCACATATTCACAGTCGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudyptes chrysolophus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Macaroni penguin population status is stable and increasing. They are among the most numerous penguin species in the world with a population of approximately 9 million.  They are vulnerable to changes in the environment such as pollution, fishing, and global warming. Humans are the biggest threat to these penguins due to the overfishing of krill and other small invertebrates that they feed on.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bce+3bce+4bce

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Crawford, R., Croxall, J., Micol, T., Nisbet, I. & Weimerskirsch, H.

Justification
This species qualifies as Vulnerable because the global population appears to have declined rapidly over the last three generations (36 years). The primary drivers of declines are uncertain but could include climatic variation and competition for food from commercial fisheries.


History
  • 2012
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU A1b) on the IUCN Red List 2003 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated at 6.3 million breeding pairs in at least 258 colonies at c.55 breeding sites (Crossin et al. 2013), with key populations on Isles Crozet (2,200,000 pairs, including 1 million on Ilots des Pingouins), Kerguelen (1.8 million pairs), Heard Island (1 million pairs), South Georgia (1 million pairs) and Marion Island (290,000 pairs).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Known threats at its main breeding grounds are those common to all Southern Ocean species, such as the existing and potential impact of commercial fishing, and ocean warming (Ellis et al. 1998), although oil pollution is no longer considered a likely threat (I. C. T. Nisbet in litt. 2010). The numbers breeding in colonies on Marion Island have shown declines following disease outbreaks (Cooper et al. 2009). Invasive mammals including cats, mice and rabbits are present on a number of sub-Antarctic islands but their impact on the species is not known (Crossin et al. 2013).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Many penguin species of the Southern Oceans Ecosystem share a common set of factors that are causing population reductions (6) (2). Introduced predators such as cats and rats are a great problem for breeding birds on a number of islands, including South Georgia. Over-fishing is a very serious factor, in particular the harvesting of krill, the main food source of the macaroni penguin. Further pressures include oil spills and increasing tourism, as well as potential climate change, particularly as penguins are extremely sensitive to changes in sea temperature and ocean currents and the consequent decrease in prey availability (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Long-term monitoring programmes are in place at several breeding colonies (Ellis et al. 1998). Most breeding islands are protected as reserves of various kinds and Heard and McDonald Islands are a World Heritage Site.

Conservation Actions Proposed
Survey or resurvey all main breeding populations at major breeding sites, and research its distribution outside breeding season. Maintain monitoring programmes at selected sites. Conduct research into its demography, reproductive performance and foraging ecology (Ellis et al. 1998). Investigate the impacts of disease outbreaks on Marion Island and elsewhere (see Cooper et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Although numbers of macaroni penguins are high, the decline of the overall population in the last 30 years have resulted in the classification of the species as globally Vulnerable by the IUCN Red List of Threatened Species (1). Long-term monitoring programmes are underway at a number of breeding colonies and many of the islands that support breeding populations of this penguin are protected reserves (2). The islands of Heard and McDonald are World Heritage Sites (2). If the suite of threats facing the macaroni penguin continue unabated, it seems likely that the population declines will continue.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of macaroni penguins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Macaroni penguins live in large colonies and they represent a large potential food resource, but their economic importance is minor or insignificant to humans. Whalers and seal hunters of the nineteenth century visited some penguin colonies for meat and eggs, and there once was a penguin oil industry which took large numbers of birds but by the early 20th century, this was no longer profitable.

Positive Impacts: body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Vulnerable
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Macaroni penguin

The macaroni penguin (Eudyptes chrysolophus) is a species of penguin found from the Subantarctic to the Antarctic Peninsula. One of six species of crested penguin, it is very closely related to the royal penguin, and some authorities consider the two to be a single species. It bears a distinctive yellow crest, and the face and upperparts are black and sharply delineated from the white underparts. Adults weigh on average 5.5 kg (12 lb) and are 70 cm (28 in) in length. The male and female are similar in appearance, although the male is slightly larger and stronger with a relatively larger bill. Like all penguins, it is flightless, with a streamlined body and wings stiffened and flattened into flippers for a marine lifestyle. They also have red eyes.

Its diet consists of a variety of crustaceans, mainly krill, as well as small fish and cephalopods; the species consumes more marine life annually than any other species of seabird. These birds moult once a year, spending about three to four weeks ashore, before returning to the sea. Numbering up to 100,000 individuals, the breeding colonies of the macaroni penguin are among the largest and densest of all penguin species. After spending the summer breeding, penguins disperse into the oceans for six months; a 2009 study found that macaroni penguins from Kerguelen travelled over 10,000 km (6,200 mi) in the central Indian Ocean. With about 18 million individuals, the macaroni penguin is the most numerous penguin species. However, widespread declines in populations have been recorded since the mid-1970s. Their conservation status is being reclassified as vulnerable.

Taxonomy[edit]

The macaroni penguin was described from the Falkland Islands in 1837 by German naturalist Johann Friedrich von Brandt.[3] It is one of six or so species in the genus Eudyptes, collectively known as crested penguins. The genus name is derived from the Ancient Greek words eu "good", and dyptes "diver". The specific epithet chrysolophus is derived from the Greek words chryse "golden", and lophos "crest".[4]

The common name was recorded from the early 19th century in the Falkland Islands. English sailors apparently named the species for its conspicuous yellow crest;[5] Maccaronism was a term for a particular style in 18th-century England marked by flamboyant or excessive ornamentation. A person who adopted this fashion was labelled a "macaroni" or "macaroni", as in the song "Yankee Doodle".[6]

Molecular clock evidence using DNA suggests the macaroni penguin split from its closest relative, the royal penguin (Eudyptes schlegeli), around 1.5 million years ago.[7] Although the two have generally been considered separate species, the close similarities of their DNA sequences has led some, such as the Australian ornithologists Les Christidis and Walter Boles, to treat the royal as a subspecies of the macaroni.[8][9] The two species are very similar in appearance, although the royal penguin has a white face instead of the usually black face of the macaroni.[10] Interbreeding with the Indo-Pacific subspecies of the southern rockhopper penguin (E. chrysocome filholi) has been reported at Heard and Marion Islands, with three hybrids recorded there by a 1987–88 Australian National Antarctic Research Expedition.[11]

Description[edit]

Showing the conspicuous orange and yellow crests

The macaroni penguin is a large, crested penguin, similar in appearance to other members of the genus Eudyptes. An adult bird has an average length of around 70 cm (28 in);[3] the weight varies markedly depending on time of year and sex. Males average from 3.3 kg (7 lb) after incubating, or 3.7 kg (8 lb) after moult to 6.4 kg (14 lb) before moult, while females average 3.2 kg (7 lb) after to 5.7 kg (13 lb) before moult.[12] Among standard measurements, the thick bill (from the gape) measures 7 to 8 cm (2.8 to 3.1 in), the culmen being around a centimetre less. The wing, from the shoulder to the tip, is around 20.4 cm (8.0 in) and the tail is 9–10 cm (3.5–3.9 in) long.[13] The head, chin, throat, and upper parts are black and sharply demarcated against the white under parts. The black plumage has a bluish sheen when new and brownish when old. The most striking feature is the yellow crest that arises from a patch on the centre of the forehead, and extends horizontally backwards to the nape. The flippers are blue-black on the upper surface with a white trailing edge, and mainly white underneath with a black tip and leading edge. The large, bulbous bill is orange-brown. The iris is red and a patch of pinkish bare skin is found from the base of the bill to the eye. The legs and feet are pink. The male and female are similar in appearance, although males tend to be slightly larger.[3] Males also bear relatively larger bills, which average around 6.1 cm (2.4 in) compared to 5.4 cm (2.1 in) in females; this feature has been used to tell the sexes apart.[12]

Immature birds are distinguished by their smaller size, smaller, duller-brown bill, dark grey chin and throat, and absent or underdeveloped head plumes, often just a scattering of yellow feathers. The crest is fully developed in birds aged three to four years, a year or two before breeding age.[3]

Macaroni penguins moult once a year, a process in which they replace all of their old feathers. They spend around two weeks accumulating fat before moulting because they do not feed during the moult, as they cannot enter the water to forage for food without feathers. The process typically takes three to four weeks, which they spend sitting ashore. Once finished, they go back to sea and return to their colonies to mate in the spring.[14] Overall survival rates are poorly known; the successful return of breeding adults at South Georgia Island varied between 49% and 78% over three years, and around 10% of those that did return did not breed the following year.[15]

Vocalisation[edit]

Distribution and habitat[edit]

Macaroni penguin rangemap.svg

A 1993 review estimated that the macaroni was the most abundant species of penguin, with a minimum of 11,841,600 pairs worldwide.[16] Macaroni penguins range from the Subantarctic to the Antarctic Peninsula; at least 216 breeding colonies at 50 sites have been recorded.[17] In South America, macaroni penguins are found in southern Chile, the Falkland Islands, South Georgia and the South Sandwich Islands, and South Orkney Islands. They also occupy much of Antarctica and the Antarctic Peninsula, including the northern South Shetland Islands, Bouvet Island, the Prince Edward and Marion islands, the Crozet Islands, the Kerguelen Islands, and the Heard and McDonald Islands.[18] While foraging for food, groups will range north to the islands off Australia, New Zealand, southern Brazil, Tristan da Cunha, and South Africa.[19]

Conservation[edit]

Although the population of macaroni penguins is estimated at around 18 million mature individuals, a substantial decline has been recorded in several locations.[20] This includes a 50% reduction in the South Georgia population between the mid-1970s to mid-1990s,[21] and the disappearance of the species from Isla Recalada in Southern Chile.[22] This decline of the overall population in the last 30 years has resulted in the classification of the species as globally Vulnerable by the IUCN Red List of Threatened Species.[20] Long-term monitoring programs are underway at a number of breeding colonies, and many of the islands that support breeding populations of this penguin are protected reserves. The Heard Islands and McDonald Islands are World Heritage Sites for the macaroni penguin.[20] The macaroni penguin may be being impacted by commercial fishing and marine pollution.[23] A 2008 study suggests the abilities of female penguins to reproduce may be negatively affected by climate- and fishing-induced reductions in krill density.[24]

Life history[edit]

Swimming at Twycross Zoo

Like most other penguin species, the macaroni penguin is a social animal in its nesting and its foraging behaviour; its breeding colonies are among the largest and most densely populated. Scientist Charles Andre Bost found that macaroni penguins nesting at Kerguelen dispersed eastwards over an area exceeding 3×106 km2. Fitted with geolocation sensors, the 12 penguins studied travelled over 10,000 km (6,200 mi) in this period and spent their time largely within a zone 47–49°S and 70–110°E in the central Indian Ocean, not coming ashore once. This area, known as the Polar Frontal Zone, was notable for the absence of krill.[25]

Living in colonies results in a high level of social interaction between birds, which has led to a large repertoire of visual, as well as vocal, displays.[26] These behaviours peak early in the breeding period, and colonies particularly quieten when the male macaroni penguins are at sea.[27] Agonistic displays are those which are intended to confront or drive off or, alternatively, appease and avoid conflict with other individuals.[26] Macaroni penguins, particularly those on adjacent nests, may engage in 'bill-jousting'; birds lock bills and wrestle, each trying to unseat the other, as well as batter with flippers and peck or strike its opponent's nape.[28] Submissive displays include the 'slender walk', where birds move through the colony with feathers flattened, flippers moved to the front of the body, and head and neck hunched, and general hunching of head and neck when incubating or standing at the nest.[29]

Diet[edit]

The diet of the macaroni penguin consists of a variety of crustaceans, squid and fish, although the proportions that each makes up vary with locality and season. Krill, particularly Antarctic krill (Euphausia superba), account for over 90% of food during breeding season.[30] Cephalopods and small fish such as the marbled rockcod (Notothenia rossii), painted notie (Lepidonotothen larseni), Champsocephalus gunneri, the lanternfish species Krefftichthys anderssoni, Protomyctophum tenisoni and P. normani become more important during chick-rearing.[31] Like several other penguin species, the macaroni penguin sometimes deliberately swallows small (10– to 30-mm-diameter) stones; this behaviour has been speculated to aid in providing ballast for deep-sea diving,[32] or to help grind food, especially the exoskeletons of crustaceans which are a significant part of its diet.[33][34]

Foraging for food is generally conducted on a daily basis, from dawn to dusk when they have chicks to feed. Overnight trips are sometimes made, especially as the chicks grow older;[30] a 2008 study that used surgically implanted data loggers to track the movement of the birds showed the foraging trips become longer once the chick-rearing period is over.[35] Birds venture out for 10–20 days during incubation and before the moult.[30] Macaroni penguins are known to be the largest single consumer of marine resources among all of the seabirds, with an estimated take of 9.2 million tonnes of krill a year.[36] Outside the breeding season, macaroni penguins tend to dive deeper, longer, and more efficiently during their winter migration than during the summer breeding season. Year round, foraging dives usually occur during daylight hours, but winter dives are more constrained by daylight due to the shorter days.[37]

Foraging distance from colonies has been measured at around 50 km (31 mi) at South Georgia,[38] offshore over the continental shelf, and anywhere from 59 to 303 kilometres (37 to 188 mi) at Marion Island.[39] Macaroni penguins normally forage at depths of 15 to 70 m (49 to 230 ft), but have been recorded diving down to 100 m (330 ft) on occasions. Some night foraging does occur, but these dives are much shallower, ranging from only 3 to 6 m (9.8 to 19.7 ft) in depth. Dives rarely exceed two minutes in duration.[40] All dives are V-shaped, and no time is spent at the sea bottom; about half the time on a foraging trip is spent diving. Birds have been calculated as catching from 4 to 16 krill or 40 to 50 amphipods per dive.[30]

Predators[edit]

The macaroni penguin's predators consist of birds and aquatic mammals. The leopard seal (Hydrurga leptonyx), Antarctic fur seal (Arctocephalus gazella), Subantarctic fur seal (A. tropicalis) and killer whale (Orcinus orca) sometimes hunt adult macaroni penguins in the water. Colonies suffer low rates of predation if undisturbed; predators generally only take eggs and young that have been left unattended or deserted. Skua species, the snowy sheathbill (Chionis alba), and kelp gull (Larus dominicanus) prey on eggs, and skuas and giant petrels also sometimes take chicks.[15]

Courtship and breeding[edit]

Female macaroni penguins can begin breeding at around five years of age, while the males do not normally breed until at least six years old. Females breed at a younger age because the male population is larger. The surplus of male penguins allows the female penguins to select more experienced male partners as soon as the females are physically able to breed.[41] Commencing a few days after females arrive at the colony, sexual displays are used by males to attract partners and advertise their territory, and by pairs once together at the nest site and at changeover of incubation shifts.[28] In the 'ecstatic display', a penguin bows forward, making loud throbbing sounds, and then extends its head and neck up until its neck and beak are vertical. The bird then waves its head from side to side, braying loudly.[42] Birds also engage in mutual bowing, trumpeting, and preening.[28] Monitoring of pair fidelity at South Georgia has shown around three-quarters of pairs will breed together again the following year.[15]

Adult macaroni penguins typically begin to breed late in October, and lay their eggs in early November.[19] The nest itself is a shallow scrape in the ground which may be lined with some pebbles, stones, or grass, or nestled in a clump of tussock grass (on South Georgia Island).[43] Nests are densely packed, ranging from around 66 cm apart in the middle of a colony to 86 cm at the edges.[43] A fertile macaroni penguin will lay two eggs each breeding season. The first egg to be laid weighs 90–94 g (3.2–3.3 oz), 61–64% the size of the 145–155 g (5.1–5.5 oz) second, and is extremely unlikely to survive.[43] The two eggs together weigh 4.8% of the mother's body weight; the composition of an egg is 20% yolk, 66% albumen, and 14% shell.[44] Like those of other penguin species, the shell is relatively thick to minimise risk of breakage, and the yolk is large, which is associated with chicks born in an advanced stage of development.[45] Some of the yolk remains at hatching and is consumed by the chick in its first few days.[45]

The fate of the first egg is mostly unknown, but studies on the related royal penguin and erect-crested penguin show the female tips the egg out when the larger second egg is laid. The task of incubating the egg is divided into three roughly equal sessions of around 12 days each over a five-week period.[43] The first session is shared by both parents, followed by the male returning to sea, leaving the female alone to tend the egg. Upon the male's return, the female goes off to sea and does not return until the chick has hatched.[41] Both sexes fast for a considerable period during breeding; the male fasts for 37 days after arrival until he returns to sea for around 10 days before fasting while incubating eggs and young for another 36 days, and the female fasts for 42 days from her arrival after the male until late in the incubation period.[46] Both adults lose 36–40% of their body weight during this period.[47] The second egg hatches around 34 days after it is laid. Macaroni penguins typically leave their breeding colony by April or May to disperse into the ocean.[19][48]

From the moment the egg is hatched, the male macaroni penguin cares for the newly hatched chick. For about 23 to 25 days, the male protects its offspring and helps to keep it warm, since only a few of its feathers have grown in by this time. The female brings food to the chick every one to two days. When they are not being protected by the adult male penguins, the chicks form crèches to keep warm and stay protected. Once their adult feathers have grown in at about 60 to 70 days, they are ready to go out to sea on their own.[49]

Media appearances[edit]

References[edit]

  1. ^ BirdLife International (2013). "Eudyptes chrysolophus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Species Eudyptes chrysolophus (Brandt, 1837)". Australian Biological Resources Study: Australian Faunal Directory. Canberra, ACT: Department of the Environment, Water, Heritage and the Arts, Commonwealth of Australia. 9 October 2008. Retrieved 25 March 2010. 
  3. ^ a b c d Williams (1995) p. 211
  4. ^ Liddell, Henry George and Scott, Robert (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. 
  5. ^ J. Simpson, E. Weiner (eds), ed. (1989). "Macaroni". Oxford English Dictionary (2nd ed.). Oxford: Clarendon Press. ISBN 0-19-861186-2. 
  6. ^ Steele, Valerie (1998). Paris Fashion: A Cultural History. Berg Publishers. pp. 21–32. ISBN 978-1-85973-973-0. 
  7. ^ Baker AJ, Pereira SL, Haddrath OP, Edge KA; Pereira; Haddrath; Edge (2006). "Multiple gene evidence for expansion of extant penguins out of Antarctica due to global cooling". Proc Biol Sci. 273 (1582): 11–7. doi:10.1098/rspb.2005.3260. PMC 1560011. PMID 16519228. 
  8. ^ Christidis L, Boles WE (2008). Systematics and Taxonomy of Australian Birds. Canberra: CSIRO Publishing. p. 98. ISBN 978-0-643-06511-6. 
  9. ^ Juliff, Peter (December 2008). "From the Pole to the Equator: A panoply of Penguins". The Bird Observer (Bird Observation & Conservation Australia) (857). Retrieved 2009-01-27. 
  10. ^ Williams (1995) p. 214
  11. ^ Woehler EJ, Gilbert CA, EJ; Gilbert, CA (1990). "Hybrid Rockhopper-Macaroni Penguins, interbreeding and mixed-species pairs at Heard and Marion Islands". Emu 90 (3): 198–210. doi:10.1071/MU9900198. 
  12. ^ a b Williams (1995) p. 213
  13. ^ Records
  14. ^ Riffenburgh, Beau (2007). Encyclopedia of the Antarctic. CRC Press. p. 605. ISBN 0-415-97024-5. 
  15. ^ a b c Williams (1995) p. 219
  16. ^ Woehler, EJ (1993). The distribution and abundance of Antarctic and subantarctic penguins. Cambridge, United Kingdom: SCAR/ Scientific Committee on Antarctic Research. ISBN 0-948277-14-9. 
  17. ^ Oehler DA, Pelikan S, Fry WR, Weakley Jr L, Kusch A, Marin M, David A.; Pelikan, Steve; Fry, W. Roger; Weakley, Leonard; Kusch, Alejandro; Marin, Manuel (2008). "Status of Crested Penguin (Eudyptes) populations on three islands in Southern Chile". The Wilson Journal of Ornithology 120 (3): 575–81. doi:10.1676/07-108.1. 
  18. ^ Bernstein, Neil; Tirrell, Paul. "Short Communications: New Southerly Record for the Macaroni Penguin (Eudyptes chrysolophus) on the Antarctic Peninsula". Auk. Retrieved 2008-12-07. 
  19. ^ a b c Curry, Tiera. "Macaroni Penguin". Center for Biological Diversity website. Center for Biological Diversity. Retrieved 2008-11-17. 
  20. ^ a b c Benstead, Phil; David Capper; Jonathan Ekstrom; Rachel McClellan; Alison Stattersfield; Andy Symes (2008). "Species Factsheet". BirdLife International (BirdLife International). Retrieved 2009-01-16. 
  21. ^ Trathan PN, Croxall JP, Murphy EJ, Everson I, PN; Murphy, EJ; Croxall, JP; Everson, I (1998). "Use of at-sea distribution data to derive potential foraging ranges of Macaroni Penguins during the breeding season". Marine Ecology Progress Series 169: 263–75. doi:10.3354/meps169263. 
  22. ^ Oehler DA, Fry WR, Weakley LA Jr, Marin M, David A.; Fry, W. Roger; Weakley, Leonard A.; Marin, Manuel (2007). "Rockhopper and Macaroni Penguin Colonies Absent from Isla Recalada, Chile". The Wilson Journal of Ornithology 119 (3): 502–506. doi:10.1676/06-096.1. 
  23. ^ Ellis S, Croxall JP, Cooper J (1998). Penguin Conservation Assessment and Management Plan. Apple Valley, Minnesota: IUCN/SSC Conservation Breeding Specialist Group. 
  24. ^ Cresswell KA, Wiedenmann J, Mangel M, K. A.; Wiedenmann, J.; Mangel, M. (2008). "Can macaroni penguins keep up with climate and fishing induced changes in krill?". Polar Biology 31 (5): 641–49. doi:10.1007/s00300-007-0401-0. 
  25. ^ Bost CA, Thiebot JB, Pinaud D, Cherel Y, Trathan PN; Thiebot; Pinaud; Cherel; Trathan (May 15, 2009). "Where do penguins go during the inter-breeding period? Using geolocation to track the winter dispersion of the macaroni penguin". Biology Letters 5 (4): 473–6. doi:10.1098/rsbl.2009.0265. PMC 2781933. PMID 19447814. 
  26. ^ a b Williams (1995) p. 57
  27. ^ Williams (1995) p. 61
  28. ^ a b c Williams (1995) p. 216
  29. ^ Williams (1995) p. 190
  30. ^ a b c d Williams (1995) p. 215
  31. ^ Williams (1995) pp. 215–16
  32. ^ Splettstoesser J, Todd FS (1999). "Stomach stones from Emperor Penguin Aptenodytes forsteri colonies in the Weddell Sea". Marine Ornithology 27: 97–100. 
  33. ^ Brown CR, Klages NT, C. R.; Klages, N. T. (1987). "Seasonal and annual variation in diets of Macaroni (Eudyptes chrysolophus chrysolophus) and Southern Rockhopper (E. chrysocome chrysocome) penguins at sub-Antarctic Marion Island". Journal of Zoology 212: 7–28. doi:10.1111/j.1469-7998.1987.tb05111.x. 
  34. ^ De Villiers MS, Bruyn PJN (2004). "Stone-swallowing by three species of penguins at sub-antarctic Marion Island" (PDF). Marine Ornithology 32 (2): 185–86. Retrieved 2012-08-20. 
  35. ^ Green JA, Wilson RP, Boyd IL, Woakes AJ, Green CJ, Butler PJ, Jonathan A.; Wilson, Rory P.; Boyd, Ian L.; Woakes, Anthony J.; Green, Chris J.; Butler, Patrick J. (2008). "Tracking macaroni penguins during long foraging trips using 'behavioural geolocation'". Polar Biology 32 (4): 645–53. doi:10.1007/s00300-008-0568-z. 
  36. ^ Brooke MDL (2004). "The food consumption of the world's seabirds". Proceedings. Biological Sciences / the Royal Society. 271 Suppl 4 (Suppl 4): S246–48. doi:10.1098/rsbl.2003.0153. PMC 1810044. PMID 15252997. 
  37. ^ Green JA, Boyd IL, Woakes AJ, Warren NL, Butler PJ, JA; Boyd, IL; Woakes, AJ; Warren, NL; Butler, PJ (2005). "Behavioural flexibility during year-round foraging in macaroni penguins". Marine Ecology–Progress Series 296: 183–96. doi:10.3354/meps296183. 
  38. ^ Croxall JP, Prince PA, J. P.; Prince, P. A. (1980). "Food, feeding and ecological segregation of seabirds at South Georgia". Biological Journal of the Linnaean Society 14: 103–31. doi:10.1111/j.1095-8312.1980.tb00101.x. 
  39. ^ Brown CR (1987). "Travelling speed and foraging range of macaroni and rockhopper penguins at Marion Island" (PDF). Journal of Field Ornithology 58: 118–25. Retrieved 2012-08-20. 
  40. ^ Green K, Williams R, Green MG (1998). "Foraging ecology and diving behavior of Macaroni Penguins Eudyptes chrysolophus at Heard Island". Marine Ornithology 26: 27–34. Retrieved 2008-10-06. 
  41. ^ a b Bingham, Mike (2006). "Macaroni Penguin". International Penguin Conservation Work Group. Retrieved 2009-02-13. 
  42. ^ Williams (1995) p. 191
  43. ^ a b c d Williams (1995) p. 217
  44. ^ Williams (1995) p. 218
  45. ^ a b Williams (1995) p. 24
  46. ^ Williams (1995) p. 112
  47. ^ Williams (1995) p. 113
  48. ^ "Macaroni Penguins". Heard Island and McDonald Islands (Australian Government Department of the Environment, Water, Heritage, and the Arts). 2005. Retrieved 2008-11-04.  |first1= missing |last1= in Authors list (help)
  49. ^ Reynolds, Katie (2001). "Eudypteschrysolophus". Animal Diversity Web. Retrieved 2008-11-11. 

Cited text[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!