Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The King Penguin can be found on the Falkland Islands (Islas Malvinas) and South Georgia (Georgias del Sur) off the coast of South America, including the coast of southern Argentina during winter. Colonies are also present on Marion Island and Price Edward Island (South Africa), the Kerguelen Islands and Crozet Island (French Southern Territories), and Macquarie Island (Australia) in the Southern Ocean (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aptenodytes patagonicus (king penguins) colonies are mainly located on islands surrounding Antarctica. Islands include Crozet, Falkland, Heard, Kerguelen, Macquarie, Prince Edward, South Georgia and South Sandwich. Although no colonies have been found south of latitude 60 degrees S, some non-breeding members have taken residence in southern Chile and southern Argentina. Some lone wanderers have been found as far north as Brazil and South Africa and as far south as the Antarctic Coast.

On South Georgia Island over 30 colonies of A. patagonicus patagonicus reside. Colony sizes range from approximately 39,000 breeding pairs at both Salisbury Plains and St. Andrews Bay to 9,000 pairs located at Royal Bay. This subspecies is only found on South Georgia and the Falkland Islands. Another genetically unique subspecies, A. patagonicus halli, is only found on Crozet, Heard, Kerguelen, Macquarie and Prince Edwards islands.

Biogeographic Regions: antarctica (Native ); oceanic islands (Native )

  • McGonigal, D., L. Woodworth. 2001. Antarctica and the Arctic: The Complete Encyclopedia. Ontario: Firefly Books.
  • Shirihai, H. 2008. The Complete Guide to Antarctic Wildlife: Birds and Marine Mammals of the Antarctic Continent and the Southern Ocean. Princeton, NJ: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

King penguins are the second largest of all penguin species. Females are noted to be slightly smaller than males. However, no specific female measurements have been recorded. Their documented height ranges from 85 to 95 cm and weight is between 9.3 and 17.3 kg. Average adult weight has been found to be 11.8 kg.

Although they are easily confused with emperor penguins (Aptenodytes forsteri), king penguins are more colorful and have a longer, more slender bill. This bill has a stripe on the lower mandible that ranges in color from pinkish-red to orange-yellow and exhibits ultraviolet (UV) reflectance. The function of this beak spot is unclear, but it is thought to signal sexual maturity, health and/or social standing. The spot, without UV reflectance, is found in juveniles. Neither the beak spot nor UV reflectance are seen in chicks. This UV reflective beak spot does not differ between sexes.

Adult king penguins have a dark, nearly black head with orange to orange-yellow, spoon-shaped spots on either side of the head and an orange area that is most intense at the throat and fades down the upper breast into pale yellow then finally a white ventral side. The dorsal side of the body and flippers consist of gray and black feathers with a silvery sheen. The sides are separated from the ventral side by a narrow, black line. The front edge of the flipper also has a black line that extends to a black tip. King penguins are sexually monomorphic in plumage, but males are slightly larger.

Juvenile king penguins are similar to adults, but their coloration isn't as vivid. They do not reach full adult coloration until three years of age. Prior to the first molt, the chicks are simply dark brown.

There is no evidence of physical differences between the two subspecies.

Range mass: 9.3 to 17.3 kg.

Average mass: 11.8 kg.

Range length: 85 to 95 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Average basal metabolic rate: 25.889 W.

  • Jouventin, P., P. Nolan, J. Ornborg, F. Dobson. 2005. Ultraviolet beak spots in king and emperor penguins. The Condor, 107: 144-150.
  • Nolan, P., F. Dobson, M. Nicolaus, T. Karels, K. McGraw, P. Jouventin. 2010. Mutual mate choice for colorful traits in king penguins. Ethology, 116: 635-644.
  • Putz, K., C. Bost. 1994. Feeding behavior of free-ranging king penguins (Aptenodytes patagonicus). Ecology, 75: 489-497.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 94 cm. Plumage: Head, wings and tail black; belly white; back blue-grey; black line from back of head extending down sides separates grey back from white belly; bright orange patch behind ear extends into yellow-orange upper breast. Immature paler. Bare parts: iris dark brown; upper mandible black lower mandible black with red line at base; legs and feet black.
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Length: 94 cm. Plumage: Head, wings and tail black; belly white; back blue-grey; black line from back of head extending down sides separates grey back from white belly; bright orange patch behind ear extends into yellow-orange upper breast. Immature paler. Bare parts: iris dark brown; upper mandible black lower mandible black with red line at base; legs and feet black.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This marine species spends much of its time near breeding areas. It feeds mostly upon fish but will also take cephalopods. It captures prey by means of pursuit-diving, swimming at up to 12 km/h normally no deeper than 50 m. It arrives at colonies to breed between September and November, forming colonies on flattish beaches with no snow or ice which normally have easy access to the sea (del Hoyo et al. 1992)

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22500 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22487 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.161 - 9.020
  Nitrate (umol/L): 2.005 - 27.249
  Salinity (PPS): 33.682 - 34.198
  Oxygen (ml/l): 6.384 - 8.062
  Phosphate (umol/l): 0.324 - 1.848
  Silicate (umol/l): 2.879 - 47.448

Graphical representation

Temperature range (°C): -0.161 - 9.020

Nitrate (umol/L): 2.005 - 27.249

Salinity (PPS): 33.682 - 34.198

Oxygen (ml/l): 6.384 - 8.062

Phosphate (umol/l): 0.324 - 1.848

Silicate (umol/l): 2.879 - 47.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

King penguins spend a lot of time in the ocean feeding, but their primary habitats are sparsely vegetated areas of islands in the southern oceans and sub-Antarctic. The islands south of the Polar Front are typically more glaciated and at higher altitudes. For example, Heard Island is 2745 meters above sea level. These islands are still out of reach of the Antarctic pack ice, but icy conditions are still prevalent. As in the case of South Georgia, the bays freeze over and the island is over half covered in ice during the winter months. In the locations not covered in ice, bryophytes are the primary vegetation. Islands like Macquarie (433 meters above sea level) have some flowering plants and ferns and the air temperature only varies a few degrees between the summer and winter seasons.

While king penguins prefer to live on islands south of the Polar Front, they prefer to fish in waters just north of it where surface air temperatures are around 4.5 degrees C. They have been known to dive to a maximum of 322 meters.

Range elevation: 433 to 2745 m.

Range depth: 0 to 322 m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Terrestrial Biomes: tundra

Aquatic Biomes: pelagic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22500 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22487 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.161 - 9.020
  Nitrate (umol/L): 2.005 - 27.249
  Salinity (PPS): 33.682 - 34.198
  Oxygen (ml/l): 6.384 - 8.062
  Phosphate (umol/l): 0.324 - 1.848
  Silicate (umol/l): 2.879 - 47.448

Graphical representation

Temperature range (°C): -0.161 - 9.020

Nitrate (umol/L): 2.005 - 27.249

Salinity (PPS): 33.682 - 34.198

Oxygen (ml/l): 6.384 - 8.062

Phosphate (umol/l): 0.324 - 1.848

Silicate (umol/l): 2.879 - 47.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Aptenodytes patagonicus travels up to 500 km from its colony to the ocean to feed on cephalopods, small fish, and squid. They can remain underwater approximately 10 minutes and reach speeds of 12 km per hour while diving 25 to 322 m. Adults take turns returning at irregular intervals to supplement the young that stay in the breeding grounds. During their first winter the chicks predominantly survive from their stored fat.

Animal Foods: fish; mollusks; other marine invertebrates

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

King penguins occasionally serve as prey for Antarctic fur seals (Arctocephalus gazelle), subantarctic fur seals (Arctocephalus tropicalis), brown skuas (Catharacta lonnbergi) and giant petrels (Macronectes giganteus). None of these predators appear to control the king penguin population because they are not a primary food source, and the king penguin population is steadily growing. King penguins act as predators for cephalopods, small fish and squid found in their geographic range, but there is no documentation stating if the populations are controlled by this predation.

The hard tick, Ixodes uriae, is a parasite that infests king penguins. The mortality rate of adult king penguins due to hard ticks is unknown; however, there is documentation of death due to hyperinfestation of hard ticks. A bird louse, Austrogoniodes pauliani, is also a common parasite found on these penguins.

Commensal/Parasitic Species:

  • Hard ticks (Ixodes uriae)
  • Bird louse (Austrogoniodes pauliani)

  • Gauthier-Clerc, M., Y. Clerquin, Y. Handrich. 1998. Hyperinfestation by ticks Ixodes uriae: a possible cause of death in adult king penguins, a long-lived seabird. Colonial Waterbirds, 21: 229-233.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Antarctic fur seals, sub-Antarctic fur seals, leopard seals, and killer whales regularly prey on adult king penguins. Also, brown skuas and giant petrels prey on king penguin chicks.

Known Predators:

  • Brown skuas (Catharacta lonnbergi)
  • Giant petrels (Macronectes giganteus)
  • Antarctic fur seals (Arctocephalus gazelle)
  • Sub-Antarctic fur seals (Arctocephalus tropicalis)
  • Leopard seals (Hydrurga leptonyx)
  • Killer whales (Orcinus orca)

  • Charbonnier, Y., K. Delord, J. Thiebot. 2009. King-size fast food for Antartic fur seals. Polar Biology, 33: 721-724.
  • Emslie, S., N. Karnovsky, W. Trivelpiece. 1995. Avian predation at penguin colonies on King George Island, Antarctica. The Wilson Bulletin, 107: 317-327.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Visitor
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Category

Visitor
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The primary form of communication in king penguins is a two-voice system that is produced by the syrinx, a two-part organ located where the bronchi join. Each part produces sound independently. In penguins, the syrinx is only found in the genus Aptenodytes. The UV reflective beak spots may be used for signaling, but the true use is unknown.

Due to the noisy environment of king penguin colonies, adults repeatedly call out 3 to 7 syllables of varying volumes with two frequencies to locate chicks. The chicks are thought to identify the calls by the lower of the two frequencies because they transmit farther in the seeming chaos of many adults calling at once. The higher frequency has no documented use. This ability has been termed "cocktail-party effect." The parental call is thought to be learned during the first five weeks of life and is important because of the lack of nests and landmarks in the king penguins' habitats.

At this time communication research is mainly focused on the parent/offspring connection, but it is believed that the two-voice systems are also used to locate mates.

King penguins also incorporate movements and behaviors into courtship rituals. Males will produce trumpeting calls and stretch to their maximum height to attract mates. Once a female accepts, the two will stand facing each other and will engage in a series of stretching, bobbing, shaking, bowing, and calling. Like all birds, king penguins perceive their environments through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Aubin, T., P. Jouventin, C. Hildebrand. 2000. Penguins use the two-voice system to recognize each other. Proceedings of the Royal Society B: Biological Sciences, 267: 1081-1087.
  • Jouventin, P., T. Aubin, T. Lengagne. 1999. Finding a parent in a king penguin colony: the acoustic system of individual recognition. Animal Behavior, 57: 1175-1183.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Aptenodytes patagonicus has been generically documented as a long-lived bird. However, no numerical lifespan data has been published. Captive king penguins can live up to 26 years.

Range lifespan

Status: captivity:
26 (high) years.

Average lifespan

Status: captivity:
26 years.

  • Flower, 1938. Furter notes on the duration of life in animals. IV. Birds. Proceedings of the Zoological Society of London, Ser. A: 195-235.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

King penguins have a lower rate of monogamy than smaller penguin species. Currently, there is no definitive answer as to why this occurs; however, two explanations have merit: 1) mates not arriving to the colony at the same time, and 2) the amount of fat the penguin has stored. Fat storage plays a role in the low monogamy rate because if the penguins begin storing fat too early they become more vulnerable to predators. If they begin storing fat too late, they may not return to the colony at the same time as their mate. If both mates do not arrive at the colony at the same time, breeding can be delayed or a new mate may be chosen.

Females appear to be more selective than males when choosing a mate, but both sexes seem to choose a mate based on their plumage. Early breeding pairs have higher ultraviolet reflectance of beak spots than those breeding later in the season. The plumage color on the breasts and auricular areas are thought to directly reflect the health of a king penguin’s immune system. The healthier it is, the brighter the plumage.

Males advertise for mates with a combination of vocalizations and visual displays. Male king penguins produce a trumpeting call and then stretch to full height with bills raised. Once a female accepts, the two face each other and continue to engage in physical displays including strutting, bowing, shaking, calling, and stretching to maximum height with bills in the air.

Mating System: monogamous

King penguins breed yearly on the flat shorelines of the sub-Antarctic islands. Their cycle beings with a 1-month molting stage for both parents, which is complete by the end of October. Once the molt is complete, the courtship stage can last for just over a month. The female lays a single, greenish-white egg in November or December. This is transferred to the male penguin's feet and is incubated for approximately 54 days under a pouch of belly skin that keeps it at the penguin’s internal body temperature. After laying the egg, the female leaves to feed and replenish the weight that was lost. When the female returns, the partners take turns in incubating the egg, with shifts ranging from 5 to 22 days. The average birth mass for king penguin chicks is 430 g. Post-hatching, the parents continue taking turns to incubate and feed the chick until May, when it is big enough to survive on its own.

By May, the chicks are fairly independent. They stay with the colony and survive off their stored fat until the following October. In these months, both parents leave to forage and return periodically to feed their chick. During that time the chicks live in crèches (groups of juveniles) until they have gained enough weight to become completely independent. Birth to independence takes 14 to 16 months. Juvenile king penguins do not reach reproductive maturity until 3 to 5 years of age.

Successful parents do not begin their next breeding cycle until their chick has successfully fledged. This causes a successful breeding pair to begin the next season late. The outcome is usually a failed cycle because an egg laid after December typically is not successful. However, this failure allows them to breed earlier the following season. The earlier that the breeding cycle begins the more likely it is to be successful. This biennial pattern to their breeding cycle makes king penguin reproduction unique.

Not all breeding pairs in a colony are on the same biennial cycle, and not all are guaranteed to follow the success-fail-success-fail pattern. It is most likely for them to follow this pattern or a success-fail-fail-success pattern. Some are on alternating cycles so that there are chicks born during every breeding season.

It is believed that food availability plays a role in the timing and success rate of the breeding cycle because it directly affects the health of the parent.

Breeding interval: King penguins breed once yearly, but normally are successful twice over 3 calendar years.

Breeding season: King penguins breed between October and December.

Average eggs per season: 1.

Average time to hatching: 54 days.

Range fledging age: 14 to 16 months.

Range time to independence: 14 to 16 months.

Range age at sexual or reproductive maturity (female): 3 (low) years.

Average age at sexual or reproductive maturity (female): 5 years.

Range age at sexual or reproductive maturity (male): 3 (low) years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

King penguin parents highly invest in their reproductive cycles. The males must begin the cycle with enough fat stored to sustain them through courtship, egg-laying and the first part of incubation. By the end of their first incubation shift the males have typically lost 30 percent of their body weight. A minimum body mass of 10 kg is considered to be a critical mass for male king penguins. When they are approaching 10 kg, the males must choose whether to abandon the egg or to continue waiting for the female to return and relieve them. Hatchlings are semi-altricial, and therefore have considerable development to achieve post-hatching. This requires a large parental investment to brood and nourish the young.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Aubin, T., P. Jouventin. 1998. Cocktail-party effect in king penguin colonies. Proceedings of the Royal Society B: Biological Sciences, 265: 1665-1673.
  • Bried, J., F. Jiguet, P. Jouventin. 1999. Why do Aptenodytes penguins have high divorce rates?. The Auk, 116: 504-512.
  • Cote, S. 2000. Aggressiveness in king penguins in relation to reproductive status and territory location. Animal Behaviour, 59: 813-821.
  • Dobson, F., P. Jouventin. 2003. Use of the nest site as a rendezvous in penguins. Waterbirds: The International Journal of Waterbird Biology, 26: 409-415.
  • Lockley, R. 1984. Seabirds of the World. New York, NY: Facts on File.
  • Nicolaus, M., C. Le Bohec, P. Nolan, M. Gauthier-Clerc, Y. Le Maho, J. Komdeur, P. Jouventin. 2007. Ornamental colors reveal age in the king penguin. Polar Biology, 31: 53-61.
  • Nolan, P., F. Dobson, M. Nicolaus, T. Karels, K. McGraw, P. Jouventin. 2010. Mutual mate choice for colorful traits in king penguins. Ethology, 116: 635-644.
  • Olsson, O. 1996. Seasonal effects of timing and reproduction in the king penguin: a unique breeding cycle. Journal of Avian Biology, 27: 7-14.
  • Olsson, O. 1997. Clutch abandonment: a state-dependent decision in king penguins. Journal of Avian Biology, 28: 264-267.
  • Shirihai, H. 2008. The Complete Guide to Antarctic Wildlife: Birds and Marine Mammals of the Antarctic Continent and the Southern Ocean. Princeton, NJ: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aptenodytes patagonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGACTATTTTCAACAAACCACAAAGATATCGGCACCCTCTACCTAATTTTCGGTGCATGAGCAGGCATGGCCGGAACCGCCCTCAGCCTACTTATTCGTGCAGAACTCGGCCAACCGGGGACCCTCCTGGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGAGGGTTCGGAAACTGACTAGTCCCACTTATAATCGGCGCTCCAGACATAGCATTCCCCCGCATGAACAATATAAGCTTCTGACTACTGCCCCCTTCTTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGGATGAACCGTATACCCGCCACTAGCAGGCAACCTAGCCCACGCCGGCCCATCAGTAGACCTTGCCATCTTCTCCCTTCACCTAGCAGGAGTCTCCTCCATCCTAGGGGCAATTAACTTCATCACCACCGCTATCAACATAAAACCCCCAGCCCTTTCACAATACCAAACCCCCCTATTCGTATGATCCGTTCTCATCACAGCTGTTCTCCTCCTACTCTCACTCCCCGTACTCGCTGCCGGCATCACCATACTACTAACAGACCGAAACTTAAACACCACTTTCTTCGACCCAGCCGGAGGAGGAGACCCAGTCCTATACCAACATCTTTTCTGATTCTTCGGCCATCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCCCACGTAGTAACGTACTATGCAGGCAAAAAAGAACCCTTCGGCTATATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGAATAGACGTAGATACCCGAGCAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aptenodytes patagonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5