Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The King Penguin can be found on the Falkland Islands (Islas Malvinas) and South Georgia (Georgias del Sur) off the coast of South America, including the coast of southern Argentina during winter. Colonies are also present on Marion Island and Price Edward Island (South Africa), the Kerguelen Islands and Crozet Island (French Southern Territories), and Macquarie Island (Australia) in the Southern Ocean1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Aptenodytes patagonicus (king penguins) colonies are mainly located on islands surrounding Antarctica. Islands include Crozet, Falkland, Heard, Kerguelen, Macquarie, Prince Edward, South Georgia and South Sandwich. Although no colonies have been found south of latitude 60 degrees S, some non-breeding members have taken residence in southern Chile and southern Argentina. Some lone wanderers have been found as far north as Brazil and South Africa and as far south as the Antarctic Coast.

On South Georgia Island over 30 colonies of A. patagonicus patagonicus reside. Colony sizes range from approximately 39,000 breeding pairs at both Salisbury Plains and St. Andrews Bay to 9,000 pairs located at Royal Bay. This subspecies is only found on South Georgia and the Falkland Islands. Another genetically unique subspecies, A. patagonicus halli, is only found on Crozet, Heard, Kerguelen, Macquarie and Prince Edwards islands.

Biogeographic Regions: antarctica (Native ); oceanic islands (Native )

  • McGonigal, D., L. Woodworth. 2001. Antarctica and the Arctic: The Complete Encyclopedia. Ontario: Firefly Books.
  • Shirihai, H. 2008. The Complete Guide to Antarctic Wildlife: Birds and Marine Mammals of the Antarctic Continent and the Southern Ocean. Princeton, NJ: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

King penguins are the second largest of all penguin species. Females are noted to be slightly smaller than males. However, no specific female measurements have been recorded. Their documented height ranges from 85 to 95 cm and weight is between 9.3 and 17.3 kg. Average adult weight has been found to be 11.8 kg.

Although they are easily confused with emperor penguins (Aptenodytes forsteri), king penguins are more colorful and have a longer, more slender bill. This bill has a stripe on the lower mandible that ranges in color from pinkish-red to orange-yellow and exhibits ultraviolet (UV) reflectance. The function of this beak spot is unclear, but it is thought to signal sexual maturity, health and/or social standing. The spot, without UV reflectance, is found in juveniles. Neither the beak spot nor UV reflectance are seen in chicks. This UV reflective beak spot does not differ between sexes.

Adult king penguins have a dark, nearly black head with orange to orange-yellow, spoon-shaped spots on either side of the head and an orange area that is most intense at the throat and fades down the upper breast into pale yellow then finally a white ventral side. The dorsal side of the body and flippers consist of gray and black feathers with a silvery sheen. The sides are separated from the ventral side by a narrow, black line. The front edge of the flipper also has a black line that extends to a black tip. King penguins are sexually monomorphic in plumage, but males are slightly larger.

Juvenile king penguins are similar to adults, but their coloration isn't as vivid. They do not reach full adult coloration until three years of age. Prior to the first molt, the chicks are simply dark brown.

There is no evidence of physical differences between the two subspecies.

Range mass: 9.3 to 17.3 kg.

Average mass: 11.8 kg.

Range length: 85 to 95 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Average basal metabolic rate: 25.889 W.

  • Jouventin, P., P. Nolan, J. Ornborg, F. Dobson. 2005. Ultraviolet beak spots in king and emperor penguins. The Condor, 107: 144-150.
  • Nolan, P., F. Dobson, M. Nicolaus, T. Karels, K. McGraw, P. Jouventin. 2010. Mutual mate choice for colorful traits in king penguins. Ethology, 116: 635-644.
  • Putz, K., C. Bost. 1994. Feeding behavior of free-ranging king penguins (Aptenodytes patagonicus). Ecology, 75: 489-497.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This marine species spends much of its time near breeding areas. It feeds mostly upon fish but will also take cephalopods. It captures prey by means of pursuit-diving, swimming at up to 12 km/h normally no deeper than 50 m. It arrives at colonies to breed between September and November, forming colonies on flattish beaches with no snow or ice which normally have easy access to the sea1

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

King penguins spend a lot of time in the ocean feeding, but their primary habitats are sparsely vegetated areas of islands in the southern oceans and sub-Antarctic. The islands south of the Polar Front are typically more glaciated and at higher altitudes. For example, Heard Island is 2745 meters above sea level. These islands are still out of reach of the Antarctic pack ice, but icy conditions are still prevalent. As in the case of South Georgia, the bays freeze over and the island is over half covered in ice during the winter months. In the locations not covered in ice, bryophytes are the primary vegetation. Islands like Macquarie (433 meters above sea level) have some flowering plants and ferns and the air temperature only varies a few degrees between the summer and winter seasons.

While king penguins prefer to live on islands south of the Polar Front, they prefer to fish in waters just north of it where surface air temperatures are around 4.5 degrees C. They have been known to dive to a maximum of 322 meters.

Range elevation: 433 to 2745 m.

Range depth: 0 to 322 m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Terrestrial Biomes: tundra

Aquatic Biomes: pelagic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 22500 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22487 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.161 - 9.020
  Nitrate (umol/L): 2.005 - 27.249
  Salinity (PPS): 33.682 - 34.198
  Oxygen (ml/l): 6.384 - 8.062
  Phosphate (umol/l): 0.324 - 1.848
  Silicate (umol/l): 2.879 - 47.448

Graphical representation

Temperature range (°C): -0.161 - 9.020

Nitrate (umol/L): 2.005 - 27.249

Salinity (PPS): 33.682 - 34.198

Oxygen (ml/l): 6.384 - 8.062

Phosphate (umol/l): 0.324 - 1.848

Silicate (umol/l): 2.879 - 47.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Aptenodytes patagonicus travels up to 500 km from its colony to the ocean to feed on cephalopods, small fish, and squid. They can remain underwater approximately 10 minutes and reach speeds of 12 km per hour while diving 25 to 322 m. Adults take turns returning at irregular intervals to supplement the young that stay in the breeding grounds. During their first winter the chicks predominantly survive from their stored fat.

Animal Foods: fish; mollusks; other marine invertebrates

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

King penguins occasionally serve as prey for Antarctic fur seals (Arctocephalus gazelle), subantarctic fur seals (Arctocephalus tropicalis), brown skuas (Catharacta lonnbergi) and giant petrels (Macronectes giganteus). None of these predators appear to control the king penguin population because they are not a primary food source, and the king penguin population is steadily growing. King penguins act as predators for cephalopods, small fish and squid found in their geographic range, but there is no documentation stating if the populations are controlled by this predation.

The hard tick, Ixodes uriae, is a parasite that infests king penguins. The mortality rate of adult king penguins due to hard ticks is unknown; however, there is documentation of death due to hyperinfestation of hard ticks. A bird louse, Austrogoniodes pauliani, is also a common parasite found on these penguins.

Commensal/Parasitic Species:

  • Hard ticks (Ixodes uriae)
  • Bird louse (Austrogoniodes pauliani)

  • Gauthier-Clerc, M., Y. Clerquin, Y. Handrich. 1998. Hyperinfestation by ticks Ixodes uriae: a possible cause of death in adult king penguins, a long-lived seabird. Colonial Waterbirds, 21: 229-233.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Antarctic fur seals, sub-Antarctic fur seals, leopard seals, and killer whales regularly prey on adult king penguins. Also, brown skuas and giant petrels prey on king penguin chicks.

Known Predators:

  • Charbonnier, Y., K. Delord, J. Thiebot. 2009. King-size fast food for Antartic fur seals. Polar Biology, 33: 721-724.
  • Emslie, S., N. Karnovsky, W. Trivelpiece. 1995. Avian predation at penguin colonies on King George Island, Antarctica. The Wilson Bulletin, 107: 317-327.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The primary form of communication in king penguins is a two-voice system that is produced by the syrinx, a two-part organ located where the bronchi join. Each part produces sound independently. In penguins, the syrinx is only found in the genus Aptenodytes. The UV reflective beak spots may be used for signaling, but the true use is unknown.

Due to the noisy environment of king penguin colonies, adults repeatedly call out 3 to 7 syllables of varying volumes with two frequencies to locate chicks. The chicks are thought to identify the calls by the lower of the two frequencies because they transmit farther in the seeming chaos of many adults calling at once. The higher frequency has no documented use. This ability has been termed "cocktail-party effect." The parental call is thought to be learned during the first five weeks of life and is important because of the lack of nests and landmarks in the king penguins' habitats.

At this time communication research is mainly focused on the parent/offspring connection, but it is believed that the two-voice systems are also used to locate mates.

King penguins also incorporate movements and behaviors into courtship rituals. Males will produce trumpeting calls and stretch to their maximum height to attract mates. Once a female accepts, the two will stand facing each other and will engage in a series of stretching, bobbing, shaking, bowing, and calling. Like all birds, king penguins perceive their environments through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

  • Aubin, T., P. Jouventin, C. Hildebrand. 2000. Penguins use the two-voice system to recognize each other. Proceedings of the Royal Society B: Biological Sciences, 267: 1081-1087.
  • Jouventin, P., T. Aubin, T. Lengagne. 1999. Finding a parent in a king penguin colony: the acoustic system of individual recognition. Animal Behavior, 57: 1175-1183.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Aptenodytes patagonicus has been generically documented as a long-lived bird. However, no numerical lifespan data has been published. Captive king penguins can live up to 26 years.

Range lifespan

Status: captivity:
26 (high) years.

Average lifespan

Status: captivity:
26 years.

  • Flower, 1938. Furter notes on the duration of life in animals. IV. Birds. Proceedings of the Zoological Society of London, Ser. A: 195-235.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

King penguins have a lower rate of monogamy than smaller penguin species. Currently, there is no definitive answer as to why this occurs; however, two explanations have merit: 1) mates not arriving to the colony at the same time, and 2) the amount of fat the penguin has stored. Fat storage plays a role in the low monogamy rate because if the penguins begin storing fat too early they become more vulnerable to predators. If they begin storing fat too late, they may not return to the colony at the same time as their mate. If both mates do not arrive at the colony at the same time, breeding can be delayed or a new mate may be chosen.

Females appear to be more selective than males when choosing a mate, but both sexes seem to choose a mate based on their plumage. Early breeding pairs have higher ultraviolet reflectance of beak spots than those breeding later in the season. The plumage color on the breasts and auricular areas are thought to directly reflect the health of a king penguin’s immune system. The healthier it is, the brighter the plumage.

Males advertise for mates with a combination of vocalizations and visual displays. Male king penguins produce a trumpeting call and then stretch to full height with bills raised. Once a female accepts, the two face each other and continue to engage in physical displays including strutting, bowing, shaking, calling, and stretching to maximum height with bills in the air.

Mating System: monogamous

King penguins breed yearly on the flat shorelines of the sub-Antarctic islands. Their cycle beings with a 1-month molting stage for both parents, which is complete by the end of October. Once the molt is complete, the courtship stage can last for just over a month. The female lays a single, greenish-white egg in November or December. This is transferred to the male penguin's feet and is incubated for approximately 54 days under a pouch of belly skin that keeps it at the penguin’s internal body temperature. After laying the egg, the female leaves to feed and replenish the weight that was lost. When the female returns, the partners take turns in incubating the egg, with shifts ranging from 5 to 22 days. The average birth mass for king penguin chicks is 430 g. Post-hatching, the parents continue taking turns to incubate and feed the chick until May, when it is big enough to survive on its own.

By May, the chicks are fairly independent. They stay with the colony and survive off their stored fat until the following October. In these months, both parents leave to forage and return periodically to feed their chick. During that time the chicks live in crèches (groups of juveniles) until they have gained enough weight to become completely independent. Birth to independence takes 14 to 16 months. Juvenile king penguins do not reach reproductive maturity until 3 to 5 years of age.

Successful parents do not begin their next breeding cycle until their chick has successfully fledged. This causes a successful breeding pair to begin the next season late. The outcome is usually a failed cycle because an egg laid after December typically is not successful. However, this failure allows them to breed earlier the following season. The earlier that the breeding cycle begins the more likely it is to be successful. This biennial pattern to their breeding cycle makes king penguin reproduction unique.

Not all breeding pairs in a colony are on the same biennial cycle, and not all are guaranteed to follow the success-fail-success-fail pattern. It is most likely for them to follow this pattern or a success-fail-fail-success pattern. Some are on alternating cycles so that there are chicks born during every breeding season.

It is believed that food availability plays a role in the timing and success rate of the breeding cycle because it directly affects the health of the parent.

Breeding interval: King penguins breed once yearly, but normally are successful twice over 3 calendar years.

Breeding season: King penguins breed between October and December.

Average eggs per season: 1.

Average time to hatching: 54 days.

Average birth mass: 430 g.

Range fledging age: 14 to 16 months.

Range time to independence: 14 to 16 months.

Range age at sexual or reproductive maturity (female): 3 (low) years.

Average age at sexual or reproductive maturity (female): 5 years.

Range age at sexual or reproductive maturity (male): 3 (low) years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

King penguin parents highly invest in their reproductive cycles. The males must begin the cycle with enough fat stored to sustain them through courtship, egg-laying and the first part of incubation. By the end of their first incubation shift the males have typically lost 30 percent of their body weight. A minimum body mass of 10 kg is considered to be a critical mass for male king penguins. When they are approaching 10 kg, the males must choose whether to abandon the egg or to continue waiting for the female to return and relieve them. Hatchlings are semi-altricial, and therefore have considerable development to achieve post-hatching. This requires a large parental investment to brood and nourish the young.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Aubin, T., P. Jouventin. 1998. Cocktail-party effect in king penguin colonies. Proceedings of the Royal Society B: Biological Sciences, 265: 1665-1673.
  • Bried, J., F. Jiguet, P. Jouventin. 1999. Why do Aptenodytes penguins have high divorce rates?. The Auk, 116: 504-512.
  • Cote, S. 2000. Aggressiveness in king penguins in relation to reproductive status and territory location. Animal Behaviour, 59: 813-821.
  • Dobson, F., P. Jouventin. 2003. Use of the nest site as a rendezvous in penguins. Waterbirds: The International Journal of Waterbird Biology, 26: 409-415.
  • Lockley, R. 1984. Seabirds of the World. New York, NY: Facts on File.
  • Nicolaus, M., C. Le Bohec, P. Nolan, M. Gauthier-Clerc, Y. Le Maho, J. Komdeur, P. Jouventin. 2007. Ornamental colors reveal age in the king penguin. Polar Biology, 31: 53-61.
  • Nolan, P., F. Dobson, M. Nicolaus, T. Karels, K. McGraw, P. Jouventin. 2010. Mutual mate choice for colorful traits in king penguins. Ethology, 116: 635-644.
  • Olsson, O. 1997. Clutch abandonment: a state-dependent decision in king penguins. Journal of Avian Biology, 28: 264-267.
  • Olsson, O. 1996. Seasonal effects of timing and reproduction in the king penguin: a unique breeding cycle. Journal of Avian Biology, 27: 7-14.
  • Shirihai, H. 2008. The Complete Guide to Antarctic Wildlife: Birds and Marine Mammals of the Antarctic Continent and the Southern Ocean. Princeton, NJ: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aptenodytes patagonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROMB007-06|KI 10|Aptenodytes patagonicus| AACCGATGACTATTTTCAACAAACCACAAAGATATCGGCACCCTCTACCTAATTTTCGGTGCATGAGCAGGCATGGCCGGAACCGCCCTC---AGCCTACTTATTCGTGCAGAACTCGGCCAACCGGGGACCCTCCTGGGAGAC---GACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGAGGGTTCGGAAACTGACTAGTCCCACTTATA---ATCGGCGCTCCAGACATAGCATTCCCCCGCATGAACAATATAAGCTTCTGACTACTGCCCCCTTCTTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGGATGAACCGTATACCCGCCACTAGCAGGCAACCTAGCCCACGCCGGCCCATCAGTAGACCTT---GCCATCTTCTCCCTTCACCTAGCAGGAGTCTCCTCCATCCTAGGGGCAATTAACTTCATCACCACCGCTATCAACATAAAACCCCCAGCCCTTTCACAATACCAAACCCCCCTATTCGTATGATCCGTTCTCATCACAGCTGTTCTCCTCCTACTCTCACTCCCCGTACTCGCTGCC---GGCATCACCATACTACTAACAGACCGAAACTTAAACACCACTTTCTTCGACCCAGCCGGAGGAGGAGACCCAGTCCTATACCAACATCTTTTCTGATTCTTCGGCCATCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCCCACGTAGTAACGTACTATGCAGGCAAAAAA---GAACCCTTCGGCTATATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aptenodytes patagonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The IUCN Red List states that king penguins have a status of Least Concern based on the following criteria: geographic range is greater than 20,000 square kilometers, population size is greater than 10,000 individuals, and the population size seems to be increasing.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative economic effects of king penguins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

King penguins are part of the ecotourism business. During a study of nature-based tourism on the Falkland Islands, king penguins were the most popular of the penguins in the area. All of the tourists visited the king penguin colony, versus only half of the tourists visiting the second most popular penguins species. The tourists also stayed to view the king penguins for the longest time frame at a mean of 63 minutes versus only 19 minutes for the second most popular penguin species.

Positive Impacts: ecotourism

  • Otley, H. 2005. Nature-based tourism: Experiences at the volunteer point penguin colony in the Falkland Islands. Marine Ornithology, 33: 181-187.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

King Penguin

The King Penguin (Aptenodytes patagonicus) is the second largest species of penguin at about 11 to 16 kg (24 to 35 lb), second only to the Emperor Penguin. There are two subspecies—A. p. patagonicus and A. p. halli; patagonicus is found in the South Atlantic and halli elsewhere.

King Penguins eat small fish, mainly lanternfish, and squid and rely less than most Southern Ocean predators on krill and other crustaceans. On foraging trips they repeatedly dive to over 100 metres (330 ft), and have been recorded at depths greater than 300 metres (980 ft). [1]

King Penguins breed on the subantarctic islands at the northern reaches of Antarctica, South Georgia, and other temperate islands of the region. The total population is estimated to be 2.23 million pairs and is increasing.[2]

Contents

Taxonomy

The King Penguin was described in 1778 by English naturalist and illustrator John Frederick Miller, its generic name derived from the Ancient Greek a/α 'without' pteno-/πτηνο- 'able to fly' or 'winged' and dytes/δυτης 'diver'.[3] Its specific epithet patagonicus derived from Patagonia.

Together with the similarly coloured but larger Emperor Penguin (A. forsteri), it is one of two extant species in the genus Aptenodytes. Fossil evidence of a third species—Ridgen's Penguin (A. ridgeni)—has been found in fossil records from the late Pliocene, about three million years ago, in New Zealand.[4] Studies of penguin behaviour and genetics have proposed that the genus Aptenodytes is basal; in other words, that it split off from a branch which led to all other living penguin species.[5] Mitochondrial and nuclear DNA evidence suggests this split occurred around 40 million years ago.[6]

Subspecies

In 1911, the ornithologist Gregory Mathews proposed the two subspecies currently recognised:[7]

Description

At St Andrews Bay, South Georgia, British Overseas Territories

The King Penguin is the second largest species of penguin at about 90 cm (3.0 ft) tall and weighing 11 to 16 kg (24 to 35 lb), second only to the Emperor Penguin. Like all penguin species, it has a streamlined body to minimise drag while swimming, webbed feet to propel more force when swimming, and wings that have become stiff, flat flippers.[9] There is little difference in plumage between the male and female, although the latter are slightly smaller.[8] The upper parts features of the King Penguin include a silvery-grey back with a blackish-brown head decorated with ear patches of bright golden-orange. However, rare individuals have been sighted that have varying degrees of melanism, including one individual spotted on a National Geographic Society expedition to South Georgia Island that was completely black.[10] The 12–13 cm (4¾–5 in) black bill is long and slender, and curved downwards like a banana peel. The lower mandible bears a striking pink or orange-coloured mandibular plate.[8]

The chick is first covered with brown-grey down, before moulting into a thick, woolly brown coat borne until around 10–12 months of age. Their mandibular plates are black until the moult into immature plumage.[8] An immature bird will have yellow, rather than orange-tinged markings, and grey tips to its black brown feathers. It moults into adult plumage after reaching two years of age.[11]

King Penguins live for an average of 15 to 20 years in the wild.[12]

Adaptations to the environment

King Penguins have adapted well to their extreme living conditions in the subantarctic. To keep warm, the penguins have four layers of feathering. King Penguins have 70 feathers per every square inch. The outer layer of feathers are oiled and waterproof, unlike the feathering of a duck, which reduces the amount of water absorbed that would otherwise increase their weight. The inner three layers are down feathers, very effective insulation. A chick is born without the oily outer layer, and therefore cannot fish until maturity. A King Penguin chick has dark down feathers. They remain on land and do not go into the water until their down feathers have fallen off.

Drinking

Like most penguins, King Penguins are able to drink salt water because of their supraorbital glands which filter excess salt from their blood stream by way of a capillary just above the eyes. The excess salt is then expelled through the nostrils as a concentrated brine.

Distribution and habitat

Great colony of King Penguins on Salisbury Plain in South Georgia

King Penguins breed on subantarctic islands between 45 and 55°S, at the northern reaches of Antarctica, as well as Tierra del Fuego, the Falkland Islands, and other temperate islands of the region. The total population is estimated to be 2.23 million pairs and is increasing.[2] The largest breeding populations are on Crozet Island, with around 455,000 pairs, 228,000 pairs on the Prince Edward Islands, 240,000–280,000 on the Kerguelen Islands and over 100,000 on the South Georgia Islands. Macquarie Island has around 70,000 pairs. The non-breeding range is poorly known though presumably the subantarctic waters of the southern Indian, South Atlantic and Asian part of the Southern Ocean. Vagrant birds have been recorded from the Antarctic peninsula as well as South Africa, Australia and New Zealand.

The Nature Protection Society released King Penguins in Gjesvær in Finnmark, and Røst in Lofoten in northern Norway in August 1936. Birds were reported in the area several times in the 1940s though none have been seen since 1949.[13]

Behaviour

A King Penguin chick

The American sicophysiologist Gerry Kooyman revolutionized the study of penguin foraging behaviour in 1971 when he published his results from attaching automatic dive-recording devices to Emperor Penguins,[14] and recording a dive of 235 metres (771 ft) by a King Penguin in 1982.[15] The current maximum dive recorded is 343 metres in the Falkland Islands region,[16] and a maximum time submerged of 552 seconds recorded at the Crozet Islands.[17] The King Penguin dives to depths of 100–300 meters (350–1000 feet), spending around 5 minutes submerged, during daylight hours, and less than 30 metres (98 ft) at night.[18][19]

King Penguin Rookery Audio.oga
Sound from Rookery at Lusitania Bay on Macquarie Island

The majority (around 88% in one study) of dives undertaken by King Penguins are flat-bottomed; that is, the penguin dives to a certain depth and remains there for a period of time hunting (roughly 50% of total dive time) before returning to the surface. They have been described as U-shaped or W-shaped, relating to the course of the dive. The bird dives in a V-shaped or 'spike' pattern in the remaining 12% of dives; that is the bird dives at an angle through the water column, reaches a certain depth and then returns to the surface. Other penguins dive in this latter foraging pattern in contrast.[18][20] Observations at Crozet Islands revealed most King Penguins were seen within 30 km (19 mi) of the colony.[21] Using the average swimming speed, Kooyman estimated the distance travelled to foraging areas at 28 km (17 mi).[18]

Its average swimming speed is 6.5–10 km/h (4–6 mph). On shallower dives under 60 m (200 ft), it averages 2 km/h (1.2 mph) descending and ascending, while on deeper dives over 150 m (490 ft) deep, it averages 5 km/h (3.1 mph) in both directions.[19][22] On land, the King Penguin alternates between walking with a wobbling gait and tobogganing—sliding over the ice on its belly, propelled by its feet and wing-like flippers. Like all penguins, it is flightless.[9]

Diet

An adult and a chick on South Georgia Island

King Penguins eat small fish, and squid and rely less than most Southern Ocean predators on krill and other crustaceans. Fish constitute 80–100% of the diet, except in winter months of July and August, when they make up only 30%.[19] Lanternfish are the main fish taken, principally the species Electrona carlsbergi and Krefftichthys anderssoni, as well as Protomyctophum tenisoni. Slender escolar (Paradiplospinus gracilis) of the Gempylidae, and Champsocephalus gunneri, is also consumed. Cephalopods consumed include those of the genus Moroteuthis, the hooked squid species Kondakovia longimana, the Sevenstar Flying Squid (Martialia hyadesii), young Gonatus antarcticus and Onychoteuthis species.[19]

Predators

The King Penguin's predators include birds and aquatic mammals; Skua species (Stercorarius spp.) take small chicks and eggs, while the Snowy Sheathbill (Chionis alba) scavenges for dead chicks and unattended eggs.[23] The Leopard Seal (Hydrurga leptonyx) takes adult birds at sea.[24] Orcas may also hunt King Penguins.

Courtship and breeding

Mating King Penguins at Macquarie Island

The King Penguin is able to breed at three years of age, although only a very small minority (5% recorded at Crozet Islands) actually do then; the average age of first breeding is around 6 years.[25] King Penguins are serially monogamous. They have only one mate each year, and stay faithful to that mate. However, fidelity between years is only about 29%.[26] The long breeding cycle may contribute to this low rate.[27]

The King Penguin has an unusually prolonged breeding cycle, taking some 14–16 months from laying to offspring fledging.[28] Although pairs will attempt to breed annually, they are generally only successful one year in two, or two years in three in a triennial pattern on South Georgia.[24] The reproductive cycle begins in September to November, as birds return to colonies for a prenuptial moult. Those that were unsuccessful in breeding the previous season will often arrive earlier. They then return to the sea for three weeks before coming ashore in November or December.[29] The female penguin lays one pyriform (pear-shaped) white egg weighing 300 g (⅔ lb).[30] It is initially soft, but hardens and darkens to a pale greenish colour. It measures around 10 × 7 cm (3.9 × 2.8 in).[30] The egg is incubated for around 55 days with both birds sharing incubation in shifts of 6–18 days each. Hatching may take up to 2–3 days to complete, and chicks are born semi-altricial and nidicolous. In other words, they have only a thin covering of down and are entirely dependent on their parents for food and warmth.[31] The young chick is brooded in what is called the guard phase, spending its time balanced on its parents' feet and sheltered by its pouch.[31] During this time, the parents alternate every 3–7 days, one incubating while the other forages. This period lasts for 30–40 days before the chicks form crèches, a group of many chicks together. A penguin can leave its chick at a crèche while it fishes as a few adult penguins stay behind to look after them. Other varieties of penguins also practice this method of communal care for offspring.

By April the chicks are almost fully grown, but lose weight by fasting over the winter months, gaining it again during spring in September. Fledging then takes place in late spring/early summer.

King Penguins form huge breeding colonies; for example, the colony on South Georgia Island at Salisbury Plain holds over 100,000 breeding pairs and the one at St. Andrew's Bay over 100,000 birds. Because of the long breeding cycle, colonies are continuously occupied.

The King Penguin feeds its chicks by eating a fish, digesting it slightly and regurgitating the food into the chick's mouth.

Because of their large size, King Penguin chicks take 14–16 months before they are ready to go to sea. This is markedly different from smaller penguins, who rear their chicks through a single summer when food is plentiful. King Penguins time their mating so the chicks will develop over the harshest season for fishing. In this way, by the time the young penguins are finally mature enough to leave their parents, it is summer when food is plentiful and conditions are more favorable for the young to survive alone.

Juvenile King Penguins (Aptenodytes patagonicus)

Relationship with humans

At Edinburgh Zoo

Considered a flagship species, 176 individuals were counted in captivity in North American Zoos and Aquaria in 1999.[32] The species has been bred in captivity at SeaWorld in San Diego, USA. The species is exhibited at SeaWorld in Orlando, Florida, USA, Indianapolis Zoo, USA,[33] Detroit Zoo, USA, Saint Louis Zoo, USA,[34] Newport Aquarium in Newport, Kentucky, USA, Edinburgh Zoo in Scotland, Berlin Zoological Garden in Germany, Zurich Zoo in Switzerland, 63 Seaworld in Seoul, South Korea, Melbourne Aquarium in Australia, Mar del Plata Aquarium in Argentina and Loro Parque in Spain.

It is also the emblem of Edinburgh Zoo.

Roger Tory Peterson's ornithological nickname was "King Penguin".

Notable King Penguins

  • Sir Nils Olav, mascot and Colonel in Chief of the Royal Norwegian Guard
  • Misha, a central character and metaphor in two novels by Ukrainian writer Andrey Kurkov
  • The King Penguin is also the species of penguin represented by the popular character Pondus, an image found on various paraphernalia in many retail stores throughout Canada. Pondus originates in Danish children's books written and photographed by Ivar Myrhøj and published in 1997 by Lademann publisher in the late 1960s. These penguins appeared in the production of Batman Returns.
  • Opus the Penguin, a fictional character in the comic strips Bloom County, Outland, and Opus, is a King Penguin and the most famous character of the comic strips.
  • Rex,a fictional penguin that is in a presentation (along with the other fictional penguin, Rocky)at the Newport Aquarium.

References

  1. ^ Culik, B. M; K. PÜTZ, R. P. WILSON, D. ALLERS, J. LAGE, C. A. BOST, Y. LE MAHO (January 1996). "DIVING ENERGETICS IN KING PENGUINS (Aptenodytes patagonicus)". Journal of Experimental Biology 199: 973–983. http://jeb.biologists.org/content/199/4/973.full.pdf. 
  2. ^ a b Shirihai, Hadoram (2002). A Complete Guide to Antarctic Wildlife. Alula Press. ISBN 951-98947-0-5. 
  3. ^ Liddell, Henry George and Robert Scott (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. http://www.perseus.tufts.edu/cgi-bin/ptext?doc=Perseus%3Atext%3A1999.04.0057%3Aentry%3D%2382741. 
  4. ^ Williams, (The Penguins) p. 13
  5. ^ Jouventin P (1982). "Visual and vocal signals in penguins, their evolution and adaptive characters". Adv. Ethol. 24: 1–149. 
  6. ^ Baker AJ, Pereira SL, Haddrath OP, Edge KA (2006). "Multiple gene evidence for expansion of extant penguins out of Antarctica due to global cooling". Proc Biol Sci. 273 (1582): 11–17. doi:10.1098/rspb.2005.3260. PMC 1560011. PMID 16519228. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1560011. 
  7. ^ Mathews, GM (1911). The Birds of Australia: Vol. 1. London: Witherby. 
  8. ^ a b c d e Williams (The Penguins) p. 143
  9. ^ a b Williams (The Penguins) p. 3
  10. ^ Nanos J (2010). "Today's Pic: Rare Black Penguin". National Geographic Traveller. http://blogs.nationalgeographic.com/blogs/intelligenttravel/2010/03/todays-pic-rare-black-penguin.html. 
  11. ^ Stonehouse, B (1960). "The King Penguin Aptenodytes patagonicus of South Georgia I. Breeding behaviour and development". Scientific Report of the Falkland Islands Dependencies Survey 23: 1–81. 
  12. ^ "King Penguin". Pittsburgh Zoo & PPG Aquarium. http://www.pittsburghzoo.org/ppganimal.aspx?id=63. Retrieved May 15, 2012. 
  13. ^ Long, John L. (1981). Introduced Birds of the World: The worldwide history, distribution and influence of birds introduced to new environments. Terrey Hills, Sydney: Reed. pp. 30. ISBN 0-589-50260-3. 
  14. ^ Kooyman GL, Drabek CM, Elsner R, Campbell WB (1971). "Diving behaviour of the Emperor Penguin Aptenodytes forsteri". Auk 88: 775–95. 
  15. ^ Kooyman GL, Davis RW, Croxall JP, Costa DP (1982). "Diving depths and energy requirements of the King Penguins". Science 217 (4561): 726–27. doi:10.1126/science.7100916. PMID 7100916. 
  16. ^ Pütz K, Cherel Y (2005) The diving behaviour of brooding king penguins (Aptenodytes patagonicus) from the Falkland Islands: variation in dive profiles and synchronous underwater swimming provide new insights into their foraging strategies. Marine Biology 147: 281-290
  17. ^ Pütz K, Wilson RP, Charrassin J-B, Raclot T, Lage J, Le Maho Y, Kierspel M, Culik BM, Adelung D (1998) Foraging strategy of king penguins (Aptenodytes patagonicus) during summer at the Crozet Islands. Ecology 79: 1905-1921
  18. ^ a b c Kooyman GL, Cherel Y, Le Maho Y, Croxall JP, Thorson PH, Ridoux V (1992). "Diving behaviour and energetics during foraging cycles in King Penguins". Ecological Monographs 62 (1): 143–63. doi:10.2307/2937173. JSTOR 2937173. 
  19. ^ a b c d Williams (The Penguins) p. 147
  20. ^ Williams (The Penguins) p. 87-88
  21. ^ (French)Ridoux V, Jouventin P, Stahl J-C, Weimerskirch H (1988). "Ecologie alimentaire comparée des manchots nicheurs aux Iles Crozet". Revues Ecologie 43: 345–55. 
  22. ^ Adams, NJ (1987). "Foraging ranges of King Penguins Aptenodytes patagonicus during summer at Marion Island". Journal of Zoology 212 (3): 475–82. doi:10.1111/j.1469-7998.1987.tb02918.x. 
  23. ^ Williams (The Penguins) p. 40
  24. ^ a b Stonehouse, B (1960). "The King Penguin Aptenodytes patagonicus of South Georgia I. Breeding behaviour and development". Falkland Islands Dependencies Survey Scientific Report 23: 1–81. 
  25. ^ Williams (The Penguins) p. 151
  26. ^ Williams (The Penguins) p. 54
  27. ^ Williams (The Penguins) p. 152
  28. ^ Williams (The Penguins) p. 148
  29. ^ Williams (The Penguins) p. 149
  30. ^ a b Williams (The Penguins) p. 150
  31. ^ a b Williams (The Penguins) p. 28
  32. ^ Diebold EN, Branch S, Henry L (1999). "Management of penguin populations in North American zoos and aquariums" (PDF). Marine Ornithology 27: 171–76. http://www.marineornithology.org/PDF/27/27_21.pdf. Retrieved 31 March 2008. 
  33. ^ "Penguin Feed/Chat". Indianapolis Zoo website. Indianapolis Zoo. http://www.indianapoliszoo.com/SitePages/PlanYourVisit/PenguinChat.aspx. Retrieved 2011-12-01. 
  34. ^ "Penguin & Puffin Coast". Saint Louis Zoo website. Saint Louis Zoo. 2009. http://www.stlzoo.org/yourvisit/thingstoseeanddo/thewild/penguinpuffincoast.htm. Retrieved 14 September 2009. 

Bibliography

  • Williams, Tony D. (1995). The Penguins. Oxford, England: Oxford University Press. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!