You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The Emperor Penguin (Aptenodytes forsteri) is the tallest and heaviest of all living penguin species and is endemic to Antarctica. The male and female are similar in plumage and size, reaching 122 cm (48 in) in height and weighing anywhere from 22 to 45 kg (49 to 99 lb). The dorsal side and head are black and sharply delineated from the white belly, pale-yellow breast and bright-yellow ear patches. Like all penguins it is flightless, with a streamlined body, and wings stiffened and flattened into flippers for a marine habitat.

Read more...

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia Editors and contributors

Supplier: Jeff Holmes

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Aptenodytes forsteri has a circumpolar range, restricted when breeding to the coast of Antarctica where major breeding colonies can be found, amongst other places in the Ross Sea sector, along the coast of Queen Maud Land and Enderby Land (del Hoyo et al. 1992). A survey of satellite images from 2009 found 46 colonies containing c.238,000 breeding pairs, suggesting a total of c.595,000 individuals (Fretwell et al. 2012). This species's breeding colonies are predicted to decline in the northern part of its range by 2025-2052, owing to projected changes in sea ice thickness and extent, as influenced by wind strength and persistence (Ainley et al. 2010, D. Ainley in litt. 2010), although there are considerable uncertainties over this. Jenouvrier et al. (2009) predict a decline in the population viability of the Terre Adelie colony (c.66S) with increasing frequency of warm events, which are defined by reduced sea ice extent.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Emperor penguins are restricted to the cold waters of the Antarctic. Their terrestrial range is limited to the fast ice, continental shelf, and surrounding islands between 66 and 78 degrees south latitude.

Biogeographic Regions: antarctica (Native )

  • Williams, T. 1995. The Penguins. Oxford, England: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Antarctic continent and seas to edge of ice pack.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Emperor penguins are strikingly colored, with deep black feathers dorsally, including the head, chin, throat, back, dorsal part of the wings (flippers), and tail. This dark coloration fades to a brownish color as it becomes worn, between December and February. The belly is satin white from the upper breast to venter and including the underparts of the wings. Auricular patches are bright yellow at the head, fading to a less vivid yellow as the patch meets the white breast feathers. The upper mandible is black and the lower mandible is pink, orange, or lilac colored. Males and females are similar in size and coloration throughout the year. Immature emperor penguins are similar in size and coloration to adults, except that their auricular patches, chin, and throat are white. Chicks are covered with silvery-grey downy feathers with a black head and distinctive white eye and cheek patches. Adults weigh from 22 to 37 kg, depending on where they are in the reproductive cycle, as both males and females lose substantial portions of their mass while incubating eggs and tending to hatchlings. They stand up to about 115 cm.

Range mass: 22000 to 37000 g.

Average length: 115 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is marine and pelagic, feeding mainly on fish in Antarctic waters (although krill and cephalopods can be important dietary components in places). It nests almost exclusively on fast ice near the coast or on the coast itself, sometimes up to as much as 200 km from the open sea in large colonies. Only three colonies are known to occur on land (Trathan et al. 2011). It has an annual breeding cycle, arriving at colonies between March and April, with egg-laying between May and June (del Hoyo et al. 1992).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19104 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12353 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - -0.665
  Nitrate (umol/L): 15.317 - 29.312
  Salinity (PPS): 33.605 - 34.447
  Oxygen (ml/l): 7.464 - 8.248
  Phosphate (umol/l): 1.248 - 1.937
  Silicate (umol/l): 24.419 - 70.104

Graphical representation

Temperature range (°C): -1.719 - -0.665

Nitrate (umol/L): 15.317 - 29.312

Salinity (PPS): 33.605 - 34.447

Oxygen (ml/l): 7.464 - 8.248

Phosphate (umol/l): 1.248 - 1.937

Silicate (umol/l): 24.419 - 70.104
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

breeding on Antarctica
  • UNESCO-IOC Register of Marine Organisms
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

breeding on Antarctica
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Emperor penguins forage exclusively in the cold waters of the Antarctic, with rare individuals being found further north than 65 degrees South. They breed almost exclusively on stable pack ice near coastal areas and up to 18 km offshore. Only two, small breeding colonies are known to occur on land. Breeding colonies usually occur in sheltered areas, where ice cliffs and icebergs protect the site from the harshest of winds.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19104 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12353 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - -0.665
  Nitrate (umol/L): 15.317 - 29.312
  Salinity (PPS): 33.605 - 34.447
  Oxygen (ml/l): 7.464 - 8.248
  Phosphate (umol/l): 1.248 - 1.937
  Silicate (umol/l): 24.419 - 70.104

Graphical representation

Temperature range (°C): -1.719 - -0.665

Nitrate (umol/L): 15.317 - 29.312

Salinity (PPS): 33.605 - 34.447

Oxygen (ml/l): 7.464 - 8.248

Phosphate (umol/l): 1.248 - 1.937

Silicate (umol/l): 24.419 - 70.104
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Emperor penguins eat primarily crustaceans, fish, and cephalopods. The proportions of prey they take vary seasonally and geographically, depending on the abundance of prey in the area. Crustaceans eaten are primarily amphipods (Amphipoda) or from the family Euphausiidae (krill), making up to 75% of the diet in some areas. Cephalopods eaten include Psychroteuthis glacialis, Alluroteuthis antarcticus, and Kondakovia longimana. Fish prey include Gymndraco acuticeps, Pleuragramma antarcticum, Trematomus eulepidotus, other Trematomus species, Pagothenia species, Notolepis coatsi, Electrona antarctica, and fish in the family Channichthyidae.

Emperor penguins search for prey in the open water of the Southern Ocean or in ice-free polynyas (an area of open water) and tidal cracks in pack ice. They have been recorded diving to depths of 400 to 450 meters and traveling 150 to 1000 km in a single foraging trip.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Emperor penguins are important members of the Antarctic ecosystem. They are predators of small fish, cephalopods, and crustaceans and are, in turn, important prey for larger predators such as leopard seals (Hydrurga leptonyx) and large sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Antarctic giant petrels (Macronectes giganteus) and Antarctic skuas (Stercorarius maccormicki) are the primary predators of chicks in colonies, taking from 7 to 34% of young. Leopard seals (Hydrurga leptonyx) take young when they enter the sea after moulting and adults (0.5% of breeding population during November and December in one study). Adults are also taken by killer whales (Orca orcinus). Little is known about specific anti-predatory adaptations, although emperor penguins probably use their speed and agility in the water to escape some predation and may be warned of predators by group members.

Known Predators:

  • Antarctic giant petrels (Macronectes giganteus)
  • Antarctic skuas (Stercorarius maccormicki)
  • leopard seals (Hydrurga leptonyx)
  • killer whales (Orca orcinus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Breeding
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Category

Breeding
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Emperor penguins use a complex set of vocalizations that are critical in individual recognition between mates and parents and offspring. Their calls are known for using two frequency bands simultaneously, a "two-voice" system. Aside from the mate attraction and recognition calls described above, emperor penguins use contact calls to maintain contact with conspecifics during feeding or travel. Chicks use a frequency-modulated whistle to beg for food and to contact a parent. Physical displays are also used to communicate among conspecifics. An appeasement posture, where the flippers are held slightly out and the bill is raised, is used to avoid aggression when moving through the colony. It is unknown how emperor penguins perceive prey, as they can dive to depths of 400 to 450 meters in pursuit of prey, depths at which there is little to no light.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average longevity for emperor penguins has been estimated at 19.9 years. At least 19.1% of young survive their first year and 95.1% of adults are estimated to survive from year to year.

Average lifespan

Status: wild:
19.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: These animals have been estimated to have an average lifespan around 20 years in the wild (Tony Williams 1995). Although there are no detailed studies, anecdotal reports suggest they may live over 40 years, which seems plausible.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Emperor penguins are monogamous during each breeding season. Although most individuals form a new pair bond with a new individual each year, one study found that 14.6% of pairs in one year were re-formed the next year, and 4.9% in the third year. Males arrive at the nesting site shortly before females and begin to display to attract females. There is an unequal sex ratio in emperor penguins, with more females than males (at one site 39.5% males, 60.5% females). This unequal sex ratio leads to intense competition for mates among females. Males use the "ecstatic" display to attract females - in which they stand still, let the head fall to the chest, inhales, gives a courtship call, and holds his position for a few seconds before moving on to another position. Courtship calls are characterized by repeated syllables separated by silent periods, and are performed by both sexes. Calls are highly variable among individuals and serve a critical role in individual recognition.

Mating System: monogamous

Emperor penguins travel to colonial nesting areas in March or early April, when pair formation and breeding occurs. In May or early June a single, large (460 to 470 g) egg is laid and is passed to the male parent for incubation. Females then return to their foraging areas until the end of incubation. All egg laying and hatching is highly synchronous in colonies. Parental protection of eggs and hatchlings is critical, as incubation and brooding occurs during the depths of the Antarctic winter in some of the most severe and frigid conditions on earth. Exposure of eggs and hatchlings to the cold can result in rapid death. Chicks grow rapidly , fledgling at about 50% of adult mass. Most emperor penguins make their first return to the nesting colony at about 4 years old, but age at first breeding is usually 5 to 6 years in males and 5 years in females.

Breeding interval: Emperor penguins breed once yearly, although not all individuals breed each year.

Breeding season: Breeding occurs in March and April.

Range eggs per season: 1 (high) .

Average eggs per season: 1.

Average time to hatching: 64 days.

Average fledging age: 150 days.

Average age at sexual or reproductive maturity (female): 5 years.

Average age at sexual or reproductive maturity (male): 5-6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Males are solely responsible for incubating the eggs, a period of about 64 days. Females invest significant portions of energy into egg laying and leave to forage soon after. When the eggs begin to hatch, females return to take over brooding and feeding of the hatchling. Males can feed the hatchlings with an esophageal secretion for up to 10 days after hatching, if the female hasn't returned. At this point males have been fasting for about 115 days. Males and females then alternate brooding responsibilities with foraging trips for 45 to 50 days after hatching. Males and females regurgitate food for the young from these foraging trips. As the chicks grow the frequency of foraging trips by both parents increases, as the area of open water comes closer to the colony during the Antarctic summer. Young emperor penguins then form large creches of chicks until they leave the nesting area, at about 150 days old, in December or early January. At this point they have been abandoned by their parents and have not begun yet to moult their downy feathers. By the time they reach open water foraging areas they have nearly completed their moult.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Williams, T. 1995. The Penguins. Oxford, England: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Group organization protects from the cold: emperor penguins
 

Groups of emperor penguins save energy and protect from the cold during incubation thanks to social huddling.

       
  "Although huddling was shown to be the key by which emperor penguins (Aptenodytes forsteri) save energy and sustain their breeding fast during the Antarctic winter, the intricacies of this social behavior have been poorly studied. We recorded abiotic variables with data loggers glued to the feathers of eight individually marked emperor penguins to investigate their thermoregulatory behavior and to estimate their 'huddling time budget' throughout the breeding season (pairing and incubation period). Contrary to the classic view, huddling episodes were discontinuous and of short and variable duration, lasting 1.6 ± 1.7 (S.D.) h on average. Despite heterogeneous huddling groups, birds had equal access to the warmth of the huddles. Throughout the breeding season, males huddled for 38 ± 18% (S.D.) of their time, which raised the ambient temperature that birds were exposed to above 0 °C (at average external temperatures of − 17 °C). As a consequence of tight huddles, ambient temperatures were above 20 °C during 13 ± 12% (S.D.) of their huddling time. Ambient temperatures increased up to 37.5 °C, close to birds' body temperature. This complex social behavior therefore enables all breeders to get a regular and equal access to an environment which allows them to save energy and successfully incubate their eggs during the Antarctic winter." (Gilbert 2006:479)

"For Emperor penguins (Aptenodytes forsteri), huddling is the key to survival during the Antarctic winter. Penguins in a huddle are packed so tightly that individual movements become impossible, reminiscent of a jamming transition in compacted colloids. It is crucial, however, that the huddle structure is continuously reorganized to give each penguin a chance to spend sufficient time inside the huddle, compared with time spent on the periphery. Here we show that Emperor penguins move collectively in a highly coordinated manner to ensure mobility while at the same time keeping the huddle packed. Every 30–60 seconds, all penguins make small steps that travel as a wave through the entire huddle. Over time, these small movements lead to large-scale reorganization of the huddle. Our data show that the dynamics of penguin huddling is governed by intermittency and approach to kinetic arrest in striking analogy with inert non-equilibrium systems, including soft glasses and colloids." (Zitterbart et al. 2011:e20260)
  Learn more about this functional adaptation.
  • Gilbert C; Robertson G; Le Maho Y; Naito Y; Ancel A. 2006. Huddling behavior in emperor penguins: dynamics of huddling. Physiology & Behavior. 88(4-5): 479-488.
  • Zitterbart DP; Wienecke B; Butler JP; Fabry B. 2011. Coordinated movements prevent jamming in an emperor penguin huddle. PLoS ONE [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Feathers trap air to provide warmth: emperor penguin
 

Feathers of penguins trap air to retain warmth by being filamentous and forming a continuous layer around the body.

   
  "As insulators, feathers are even more efficient than fur. Only a bird--the penguin--can survive on the Antarctic ice-cap in winter, the coldest place on earth. The penguin's feathers are devoted entirely to this task. They are filamentous and trap the air in a continuous layer all round the body. This, reinforced by a thick coat of fat just beneath the skin, enables the hot-blooded penguins to stand about in a blizzard in temperatures of forty degrees below freezing and remain there for weeks on end, even without stoking their internal warmth with a meal." (Attenborough 1979:178-179)
  Learn more about this functional adaptation.
  • Attenborough, David. 1979. Life on Earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Beaks reflect UV light: emperor penguin
 

The beaks of emperor penguins reflect UV light via a multilayer reflector photonic microstructure.

     
  "Although the mouths and flanges of begging passerines have been reported to reflect in the ultraviolet (Hunt et al. 2003), this is the first time that the nature of the UV-reflecting microstructures has been characterized in beak tissue of any bird. The ultrastructure of the photonic microstructures found in the present study differs radically from that of those previously described in either bird feathers or skin. The regular multilayer membrane arrays found in the beak horn microstructures closely approximate to two dimensional crystal lattices, strongly suggesting that UV reflectance here is produced by interference between incident light and that reflected from successive folds in these microstructures (Prum & Torres 2003)." (Dresp 2005:312)
  Learn more about this functional adaptation.
  • Dresp, B; Jouventin, P; Langley, K. 2005. Ultraviolet reflecting photonic microstructures in the King Penguin beak. Biology Letters. 1(3): 310-313.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aptenodytes forsteri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTAACCGATGACTATTCTCAACAAACCACAAAGATATCGGCACCCTTTACCTAATTTTCGGTGCATGAGCAGGCATGGCCGGAACCGCCCTCAGCCTGCTTATTCGTGCAGAACTCGGCCAGCCAGGAACCCTCCTAGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTCCCACTTATAATCGGCGCTCCAGACATAGCATTCCCCCGTATGAACAACATAAGCTTCTGACTGCTACCCCCCTCTTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGTACAGGATGAACCGTATACCCACCGCTAGCAGGCAACCTAGCCCACGCCGGCCCATCAGTAGACCTTGCCATCTTCTCCCTTCACCTAGCAGGAGTCTCCTCCATCCTAGGGGCAATCAACTTCATCACTACCGCTATCAACATAAAACCCCCGGCTCTTTCACAATACCAAACCCCCCTATTCGTATGGTCCGTTCTCATCACAGCTGTTCTCCTTCTACTCTCACTCCCCGTACTCGCTGCCGGCATCACCATACTACTAACAGACCGAAACTTAAACACCACTTTCTTCGACCCGGCCGGAGGAGGAGACCCGGTCTTATACCAACACCTTTTCTGATTCTTCGGTCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCCCACGTAGTAACATACTATGCAGGCAAAAAAGAACCCTTCGGCTATATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGCTCACCACATATTCACAGTCGGGATAGACGTAGATACCCGAGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aptenodytes forsteri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Ainley, D., Kooyman, G., Trathan, P. & Woehler, E.

Justification
This species has been uplisted to Near Threatened because it is projected to undergo a moderately rapid population decline over the next three generations owing to the effects of projected climate change. However, it should be noted that there is considerable uncertainty over future climatic changes and how these will impact the species.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5