Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The Emperor Penguin has a circumpolar range, restricted to the coast of Antarctica where major breeding colonies can be found, amongst other places in the Ross Sea sector, along the coast of Queen Maud Land and Enderby Land1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Emperor penguins are restricted to the cold waters of the Antarctic. Their terrestrial range is limited to the fast ice, continental shelf, and surrounding islands between 66 and 78 degrees south latitude.

Biogeographic Regions: antarctica (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Emperor penguins are strikingly colored, with deep black feathers dorsally, including the head, chin, throat, back, dorsal part of the wings (flippers), and tail. This dark coloration fades to a brownish color as it becomes worn, between December and February. The belly is satin white from the upper breast to venter and including the underparts of the wings. Auricular patches are bright yellow at the head, fading to a less vivid yellow as the patch meets the white breast feathers. The upper mandible is black and the lower mandible is pink, orange, or lilac colored. Males and females are similar in size and coloration throughout the year. Immature emperor penguins are similar in size and coloration to adults, except that their auricular patches, chin, and throat are white. Chicks are covered with silvery-grey downy feathers with a black head and distinctive white eye and cheek patches. Adults weigh from 22 to 37 kg, depending on where they are in the reproductive cycle, as both males and females lose substantial portions of their mass while incubating eggs and tending to hatchlings. They stand up to about 115 cm.

Range mass: 22000 to 37000 g.

Average length: 115 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is marine and pelagic feeding mainly on fish in Antarctic waters (although krill and cephalopods can be important in places). It nests on ice floes near the coast or on the coast iteself, sometimes up to as much as 200 km from the open sea in large colonies. It has an annual breeding cycle, arriving at the colony between March and April, laying between May and June1.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Emperor penguins forage exclusively in the cold waters of the Antarctic, with rare individuals being found further north than 65 degrees South. They breed almost exclusively on stable pack ice near coastal areas and up to 18 km offshore. Only two, small breeding colonies are known to occur on land. Breeding colonies usually occur in sheltered areas, where ice cliffs and icebergs protect the site from the harshest of winds.

Habitat Regions: polar ; saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 19104 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12353 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.719 - -0.665
  Nitrate (umol/L): 15.317 - 29.312
  Salinity (PPS): 33.605 - 34.447
  Oxygen (ml/l): 7.464 - 8.248
  Phosphate (umol/l): 1.248 - 1.937
  Silicate (umol/l): 24.419 - 70.104

Graphical representation

Temperature range (°C): -1.719 - -0.665

Nitrate (umol/L): 15.317 - 29.312

Salinity (PPS): 33.605 - 34.447

Oxygen (ml/l): 7.464 - 8.248

Phosphate (umol/l): 1.248 - 1.937

Silicate (umol/l): 24.419 - 70.104
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Emperor penguins eat primarily crustaceans, fish, and cephalopods. The proportions of prey they take vary seasonally and geographically, depending on the abundance of prey in the area. Crustaceans eaten are primarily amphipods (Amphipoda) or from the family Euphausiidae (krill), making up to 75% of the diet in some areas. Cephalopods eaten include Psychroteuthis glacialis, Alluroteuthis antarcticus, and Kondakovia longimana. Fish prey include Gymndraco acuticeps, Pleuragramma antarcticum, Trematomus eulepidotus, other Trematomus species, Pagothenia species, Notolepis coatsi, Electrona antarctica, and fish in the family Channichthyidae.

Emperor penguins search for prey in the open water of the Southern Ocean or in ice-free polynyas (an area of open water) and tidal cracks in pack ice. They have been recorded diving to depths of 400 to 450 meters and traveling 150 to 1000 km in a single foraging trip.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Emperor penguins are important members of the Antarctic ecosystem. They are predators of small fish, cephalopods, and crustaceans and are, in turn, important prey for larger predators such as leopard seals (Hydrurga leptonyx) and large sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Antarctic giant petrels (Macronectes giganteus) and Antarctic skuas (Stercorarius maccormicki) are the primary predators of chicks in colonies, taking from 7 to 34% of young. Leopard seals (Hydrurga leptonyx) take young when they enter the sea after moulting and adults (0.5% of breeding population during November and December in one study). Adults are also taken by killer whales (Orca orcinus). Little is known about specific anti-predatory adaptations, although emperor penguins probably use their speed and agility in the water to escape some predation and may be warned of predators by group members.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Emperor penguins use a complex set of vocalizations that are critical in individual recognition between mates and parents and offspring. Their calls are known for using two frequency bands simultaneously, a "two-voice" system. Aside from the mate attraction and recognition calls described above, emperor penguins use contact calls to maintain contact with conspecifics during feeding or travel. Chicks use a frequency-modulated whistle to beg for food and to contact a parent. Physical displays are also used to communicate among conspecifics. An appeasement posture, where the flippers are held slightly out and the bill is raised, is used to avoid aggression when moving through the colony. It is unknown how emperor penguins perceive prey, as they can dive to depths of 400 to 450 meters in pursuit of prey, depths at which there is little to no light.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average longevity for emperor penguins has been estimated at 19.9 years. At least 19.1% of young survive their first year and 95.1% of adults are estimated to survive from year to year.

Average lifespan

Status: wild:
19.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: These animals have been estimated to have an average lifespan around 20 years in the wild (Tony Williams 1995). Although there are no detailed studies, anecdotal reports suggest they may live over 40 years, which seems plausible.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Emperor penguins are monogamous during each breeding season. Although most individuals form a new pair bond with a new individual each year, one study found that 14.6% of pairs in one year were re-formed the next year, and 4.9% in the third year. Males arrive at the nesting site shortly before females and begin to display to attract females. There is an unequal sex ratio in emperor penguins, with more females than males (at one site 39.5% males, 60.5% females). This unequal sex ratio leads to intense competition for mates among females. Males use the "ecstatic" display to attract females - in which they stand still, let the head fall to the chest, inhales, gives a courtship call, and holds his position for a few seconds before moving on to another position. Courtship calls are characterized by repeated syllables separated by silent periods, and are performed by both sexes. Calls are highly variable among individuals and serve a critical role in individual recognition.

Mating System: monogamous

Emperor penguins travel to colonial nesting areas in March or early April, when pair formation and breeding occurs. In May or early June a single, large (460 to 470 g) egg is laid and is passed to the male parent for incubation. Females then return to their foraging areas until the end of incubation. All egg laying and hatching is highly synchronous in colonies. Parental protection of eggs and hatchlings is critical, as incubation and brooding occurs during the depths of the Antarctic winter in some of the most severe and frigid conditions on earth. Exposure of eggs and hatchlings to the cold can result in rapid death. Chicks grow rapidly , fledgling at about 50% of adult mass. Most emperor penguins make their first return to the nesting colony at about 4 years old, but age at first breeding is usually 5 to 6 years in males and 5 years in females.

Breeding interval: Emperor penguins breed once yearly, although not all individuals breed each year.

Breeding season: Breeding occurs in March and April.

Range eggs per season: 1 (high) .

Average eggs per season: 1.

Average time to hatching: 64 days.

Average fledging age: 150 days.

Average age at sexual or reproductive maturity (female): 5 years.

Average age at sexual or reproductive maturity (male): 5-6 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Males are solely responsible for incubating the eggs, a period of about 64 days. Females invest significant portions of energy into egg laying and leave to forage soon after. When the eggs begin to hatch, females return to take over brooding and feeding of the hatchling. Males can feed the hatchlings with an esophageal secretion for up to 10 days after hatching, if the female hasn't returned. At this point males have been fasting for about 115 days. Males and females then alternate brooding responsibilities with foraging trips for 45 to 50 days after hatching. Males and females regurgitate food for the young from these foraging trips. As the chicks grow the frequency of foraging trips by both parents increases, as the area of open water comes closer to the colony during the Antarctic summer. Young emperor penguins then form large creches of chicks until they leave the nesting area, at about 150 days old, in December or early January. At this point they have been abandoned by their parents and have not begun yet to moult their downy feathers. By the time they reach open water foraging areas they have nearly completed their moult.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Group organization protects from the cold: emperor penguins
 

Groups of emperor penguins save energy and protect from the cold during incubation thanks to social huddling.

       
  "Although huddling was shown to be the key by which emperor penguins (Aptenodytes forsteri) save energy and sustain their breeding fast during the Antarctic winter, the intricacies of this social behavior have been poorly studied. We recorded abiotic variables with data loggers glued to the feathers of eight individually marked emperor penguins to investigate their thermoregulatory behavior and to estimate their 'huddling time budget' throughout the breeding season (pairing and incubation period). Contrary to the classic view, huddling episodes were discontinuous and of short and variable duration, lasting 1.6 ± 1.7 (S.D.) h on average. Despite heterogeneous huddling groups, birds had equal access to the warmth of the huddles. Throughout the breeding season, males huddled for 38 ± 18% (S.D.) of their time, which raised the ambient temperature that birds were exposed to above 0 °C (at average external temperatures of − 17 °C). As a consequence of tight huddles, ambient temperatures were above 20 °C during 13 ± 12% (S.D.) of their huddling time. Ambient temperatures increased up to 37.5 °C, close to birds' body temperature. This complex social behavior therefore enables all breeders to get a regular and equal access to an environment which allows them to save energy and successfully incubate their eggs during the Antarctic winter." (Gilbert 2006:479)

"For Emperor penguins (Aptenodytes forsteri), huddling is the key to survival during the Antarctic winter. Penguins in a huddle are packed so tightly that individual movements become impossible, reminiscent of a jamming transition in compacted colloids. It is crucial, however, that the huddle structure is continuously reorganized to give each penguin a chance to spend sufficient time inside the huddle, compared with time spent on the periphery. Here we show that Emperor penguins move collectively in a highly coordinated manner to ensure mobility while at the same time keeping the huddle packed. Every 30–60 seconds, all penguins make small steps that travel as a wave through the entire huddle. Over time, these small movements lead to large-scale reorganization of the huddle. Our data show that the dynamics of penguin huddling is governed by intermittency and approach to kinetic arrest in striking analogy with inert non-equilibrium systems, including soft glasses and colloids." (Zitterbart et al. 2011:e20260)
  Learn more about this functional adaptation.
  • Gilbert C; Robertson G; Le Maho Y; Naito Y; Ancel A. 2006. Huddling behavior in emperor penguins: dynamics of huddling. Physiology & Behavior. 88(4-5): 479-488.
  • Zitterbart DP; Wienecke B; Butler JP; Fabry B. 2011. Coordinated movements prevent jamming in an emperor penguin huddle. PLoS ONE [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Feathers trap air to provide warmth: emperor penguin
 

Feathers of penguins trap air to retain warmth by being filamentous and forming a continuous layer around the body.

   
  "As insulators, feathers are even more efficient than fur. Only a bird--the penguin--can survive on the Antarctic ice-cap in winter, the coldest place on earth. The penguin's feathers are devoted entirely to this task. They are filamentous and trap the air in a continuous layer all round the body. This, reinforced by a thick coat of fat just beneath the skin, enables the hot-blooded penguins to stand about in a blizzard in temperatures of forty degrees below freezing and remain there for weeks on end, even without stoking their internal warmth with a meal." (Attenborough 1979:178-179)
  Learn more about this functional adaptation.
  • Attenborough, David. 1979. Life on Earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Beaks reflect UV light: emperor penguin
 

The beaks of emperor penguins reflect UV light via a multilayer reflector photonic microstructure.

     
  "Although the mouths and flanges of begging passerines have been reported to reflect in the ultraviolet (Hunt et al. 2003), this is the first time that the nature of the UV-reflecting microstructures has been characterized in beak tissue of any bird. The ultrastructure of the photonic microstructures found in the present study differs radically from that of those previously described in either bird feathers or skin. The regular multilayer membrane arrays found in the beak horn microstructures closely approximate to two dimensional crystal lattices, strongly suggesting that UV reflectance here is produced by interference between incident light and that reflected from successive folds in these microstructures (Prum & Torres 2003)." (Dresp 2005:312)
  Learn more about this functional adaptation.
  • Dresp, B; Jouventin, P; Langley, K. 2005. Ultraviolet reflecting photonic microstructures in the King Penguin beak. Biology Letters. 1(3): 310-313.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aptenodytes forsteri

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROMB002-06|EGR3|Aptenodytes forsteri| AACCGATGACTATTCTCAACAAACCACAAAGATATCGGCACCCTTTACCTAATTTTCGGTGCATGAGCAGGCATGGCCGGAACCGCCCTC---AGCCTGCTTATTCGTGCAGAACTCGGCCAGCCAGGAACCCTCCTAGGAGAC---GACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTCCCACTTATA---ATCGGCGCTCCAGACATAGCATTCCCCCGTATGAACAACATAAGCTTCTGACTGCTACCCCCCTCTTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGTACAGGATGAACCGTATACCCACCGCTAGCAGGCAACCTAGCCCACGCCGGCCCATCAGTAGACCTT---GCCATCTTCTCCCTTCACCTAGCAGGAGTCTCCTCCATCCTAGGGGCAATCAACTTCATCACTACCGCTATCAACATAAAACCCCCGGCTCTTTCACAATACCAAACCCCCCTATTCGTATGGTCCGTTCTCATCACAGCTGTTCTCCTTCTACTCTCACTCCCCGTACTCGCTGCC---GGCATCACCATACTACTAACAGACCGAAACTTAAACACCACTTTCTTCGACCCGGCCGGAGGAGGAGACCCGGTCTTATACCAACACCTTTTCTGATTCTTCGGTCACCCAGAAGTCTATATCCTAATTCTACCAGGCTTCGGAATCATCTCCCACGTAGTAACATACTATGCAGGCAAAAAA---GAACCCTTCGGCTATATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTCGGCTTCATCGTATGAGCTCACCACATATTCACAGTCGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aptenodytes forsteri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Emperor penguins are not considered endangered and are not currently protected under international or regional laws. In areas where reliable population counts have been conducted, the evidence suggests that populations are stable. However, some colonies have not been monitored consistently and human disturbance may result in declines in breeding populations. Estimates of population sizes (as of 1995) were 195,400 breeding pairs, or a total population size of 400,000 to 450,000.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Over the past 50 years, the west coast of the Antarctic Peninsula has been among the most rapidly-warming parts of the planet. The east coast of the Peninsula has also warmed, though less rapidly. Significant warming has also been observed in the Southern Ocean, with upper ocean temperatures to the west of the Antarctic Peninsula having increased by over 1°C since 1955. Associated with this warming trend, sea ice declines in the Antarctic Peninsula region have already been observed (IUCN 2009).

Changes in seasonal sea ice are potentially a significant threat to breeding Emperor Penguins. Although it is possible that a reduction in sea ice could actually benefit Emperor Penguins by reducing the distance adults must travel to feed during the breeding season, there are important negative effects that should be considered. Pack ice extent reaches its minimum in late summer. At this time, however, ice is still essential as a platform for crèched chicks before they fledge, as it is later for adults to moult successfully. Growing chicks and moulting adults are unable to survive in the ocean without their waterproof feathers. Early ice break-up in warm years has caused chicks to be swept into the ocean and drown (IUCN 2009).

Should global temperatures increase by 2°C, scientists estimate that colonies to the north of 70°S would probably become unviable. This would impact 40 percent of all colonies, and nearly 40 percent of the total breeding population of Emperor Penguins (IUCN 2009).

In 2001, a large iceberg collided with the Ross Sea ice shelf in the vicinity of a well-established Emperor Penguin breeding colony. The sea ice supporting a considerable proportion of the colony was broken. In addition to the direct impacts of the collision, the colony was affected for several years afterwards by the continued presence of the iceberg. Chick production was markedly reduced and remained lower than usual for some years (IUCN 2009). With increases in temperature and thinning of the sea ice, such events are likely to occur more frequently.

Reduced food availability is another potentially serious consequence of a warming climate. Antarctic krill are small, extremely abundant shrimplike invertebrates that form the basis of much of the Antarctic food web. Krill feed on phytoplankton in the open ocean or on the underside of sea ice. Projected declines in sea ice extent are likely to reduce the number of krill in the Southern Ocean, which would, in turn, have profound effects on the Antarctic food web. In addition to its direct effects on Emperor Penguins, krill availability is likely to impact the abundance of penguin prey species such as fishes and squid, which also feed on krill (IUCN 2009).

Emperor Penguin colonies exist at the edge of the Antarctic continent, so there is little potential for colonies to move southward. However, two Emperor Penguin colonies are known to occur on land rather than on ice, and these have remained stable over the last 20 years. This suggests that other colonies might potentially shift to land as sea ice decreases, though this would depend on finding land areas with suitable access to food resources, a feature that is likely key to determining the location of Emperor Penguin colonies (IUCN 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative impacts of Emperor penguins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Research on the extraordinary abilities of Emperor penguins to withstand extreme cold, and to successfully reproduce under those conditions, can help us to understand and appreciate the evolution of these incredible adaptations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Emperor Penguin

The Emperor Penguin (Aptenodytes forsteri) is the tallest and heaviest of all living penguin species and is endemic to Antarctica. The male and female are similar in plumage and size, reaching 122 cm (48 in) in height and weighing anywhere from 22 to 45 kg (49 to 99 lb). The dorsal side and head are black and sharply delineated from the white belly, pale-yellow breast and bright-yellow ear patches. Like all penguins it is flightless, with a streamlined body, and wings stiffened and flattened into flippers for a marine habitat.

Its diet consists primarily of fish, but can also include crustaceans, such as krill, and cephalopods, such as squid. In hunting, the species can remain submerged up to 18 minutes, diving to a depth of 535 m (1,755 ft). It has several adaptations to facilitate this, including an unusually structured hemoglobin to allow it to function at low oxygen levels, solid bones to reduce barotrauma, and the ability to reduce its metabolism and shut down non-essential organ functions.

The Emperor Penguin is perhaps best known for the sequence of journeys adults make each year in order to mate and to feed their offspring. The only penguin species that breeds during the Antarctic winter, it treks 50–120 km (31–75 mi) over the ice to breeding colonies which may include thousands of individuals. The female lays a single egg, which is incubated by the male while the female returns to the sea to feed; parents subsequently take turns foraging at sea and caring for their chick in the colony. The lifespan is typically 20 years in the wild, although observations suggest that some individuals may live to 50 years of age.

Contents

Taxonomy

The Emperor Penguin was described in 1844 by English zoologist George Robert Gray, who created its generic name from Ancient Greek word elements, ἀ-πτηνο-δύτης [a-ptēno-dytēs], "without-wings-diver". Its specific name is in honour of the German naturalist Johann Reinhold Forster, who accompanied Captain James Cook on his second Pacific Voyage and officially named five other penguin species.

Together with the similarly coloured but smaller King Penguin (A. patagonicus), the Emperor Penguin is one of two extant species in the genus Aptenodytes. Fossil evidence of a third species—Ridgen's Penguin (A. ridgeni)—has been found in fossil records from the late Pliocene, about three million years ago, in New Zealand.[2] Studies of penguin behaviour and genetics have proposed that the genus Aptenodytes is basal; in other words, that it split off from a branch which led to all other living penguin species.[3] Mitochondrial and nuclear DNA evidence suggests this split occurred around 40 million years ago.[4]

Description

Adults with chicks

The adult Emperor Penguin stands up to 122 cm (48 in) tall. The weight ranges from 22.7 to 45.4 kg (50 to 100 lb) and varies by sex, with males weighing more than females.[5] The weight also varies by season, as both male and female penguins lose substantial mass while raising hatchlings and incubating eggs. A male Emperor penguin must withstand the Antarctic cold for more than two months to protect his eggs from extreme cold. During this entire time he doesn't eat a thing. Most male penguins will lose about 12 kg (26 lb) while they wait for their babies to hatch.[6] The mean weight of males at the start of the breeding season is 38 kg (84 lb) and that of females is 29.5 kg (65 lb). After the breeding season this drops to 23 kg (51 lb) for both sexes.[7][8][9]

Like all penguin species, the Emperor has a streamlined body to minimise drag while swimming, and wings that have become stiff, flat flippers.[10] The tongue is equipped with rear-facing barbs to prevent prey from escaping when caught.[11] Males and females are similar in size and colouration.[7] The adult has deep black dorsal feathers, covering the head, chin, throat, back, dorsal part of the flippers, and tail. The black plumage is sharply delineated from the light-coloured plumage elsewhere. The underparts of the wings and belly are white, becoming pale yellow in the upper breast, while the ear patches are bright yellow. The upper mandible of the 8 cm (3 in) long bill is black, and the lower mandible can be pink, orange or lilac.[12] In juveniles, the auricular patches, chin and throat are white, while its bill is black.[12] The Emperor Penguin chick is typically covered with silver-grey down and has a black head and white mask.[12] A chick with all-white plumage was found in 2001, but was not considered to be an albino as it did not have pink eyes.[13] Chicks weigh around 315 g (11 oz) after hatching, and fledge when they reach about 50% of adult weight.[14]

The Emperor Penguin's dark plumage fades to brown from November until February, before the yearly moult in January and February.[12] Moulting is rapid in this species compared with other birds, taking only around 34 days. Emperor Penguin feathers emerge from the skin after they have grown to a third of their total length, and before old feathers are lost, to help reduce heat loss. New feathers then push out the old ones before finishing their growth.[15]

The average yearly survival rate of the Emperor Penguin has been measured at 95.1%, with an average life expectancy of 19.9 years. The same researchers estimated that 1% of Emperor Penguins hatched could feasibly reach an age of 50 years.[16] In contrast, only 19% of chicks survive their first year of life.[17] Therefore, 80% of the Emperor Penguin population comprises adults five years and older.[16]

Vocalization

As the species has no fixed nest sites that individuals can use to locate their own partner or chick, the Emperor Penguin must rely on vocal calls alone for identification.[18] It uses a complex set of calls that are critical to individual recognition between parents, offspring, and mates,[7] displaying the widest variation in individual calls of all penguins.[18] Vocalizing Emperor Penguins use two frequency bands simultaneously.[19] Chicks use a frequency-modulated whistle to beg for food and to contact parents.[7]

Adaptations to cold

An Emperor Penguin can hold its breath for 20 minutes, and dive to depths of over 550 m (1,800 ft).[20]

The Emperor Penguin breeds in the coldest environment of any bird species; air temperatures may reach −40 °C (−40 °F), and wind speeds may reach 144 km/h (89 mph). Water temperature is a frigid −1.8 °C (28.8 °F), which is much lower than the Emperor Penguin's average body temperature of 39 °C (102 °F). The species has adapted in several ways to counteract heat loss.[21] Feathers provide 80–90% of its insulation, and it has a layer of sub-dermal fat which may be up to 3 cm (1.2 in) thick before breeding.[22] This resultant blubber layer impedes the mobility of the Emperor on land compared to its less well fat-insulated cousin, the Magellanic Penguin.[23] Its stiff feathers are short, lanceolate (spear-shaped), and densely packed over the entire skin surface. With around 100 feathers covering one square inch (15 feathers per cm2), it has the highest feather density of any bird species.[24] An extra layer of insulation is formed by separate shafts of downy filaments between feathers and skin. Muscles allow the feathers to be held erect on land, reducing heat loss by trapping a layer of air next to the skin. Conversely, the plumage is flattened in water, thus waterproofing the skin and the downy underlayer.[25] Preening is vital in facilitating insulation and in keeping the plumage oily and water-repellent.[26]

The Emperor Penguin is able to thermoregulate (maintain its core body temperature) without altering its metabolism, over a wide range of temperatures. Known as the thermoneutral range, this extends from -10 to 20 °C (14 to 68 °F). Below this temperature range, its metabolic rate increases significantly, although an individual can maintain its core temperature from 38.0 °C (100.4 °F) down to −47 °C (−53 °F).[27] Movement by swimming, walking, and shivering are three mechanisms for increasing metabolism; a fourth process involves an increase in the breakdown of fats by enzymes, which is induced by the hormone glucagon.[28] At temperatures above 20 °C (68 °F), an Emperor Penguin may become agitated as its body temperature and metabolic rate rise to increase heat loss. Raising its wings and exposing the undersides increases the exposure of its body surface to the air by 16%, facilitating further heat loss.[29]

Adaptations to pressure and low oxygen

Mounted skeleton at the AMNH

In addition to the cold, the Emperor Penguin encounters another stressful condition on deep dives—markedly increased pressure of up to 40 times that of the surface, which in most other terrestrial organisms would cause barotrauma. The bones of the penguin are solid rather than air-filled[30], which eliminates the risk of mechanical barotrauma.

While diving, the Emperor Penguin's oxygen use is markedly reduced, as its heart rate is reduced to as low as 15-20 beats per minute and non-essential organs are shut down, thus facilitating longer dives.[11] Its hemoglobin and myoglobin are able to bind and transport oxygen at low blood concentrations; this allows the bird to function with very low oxygen levels that would otherwise result in loss of consciousness.[31]

Distribution and habitat

The Emperor Penguin has a circumpolar distribution in the Antarctic almost exclusively between the 66° and 77° south latitudes. It almost always breeds on stable pack ice near the coast and up to 18 km (11 mi) offshore.[7] Breeding colonies are usually located in areas where ice cliffs and icebergs shelter them from the wind.[7] The total population is estimated at around 400,000–450,000 individuals, which are distributed among as many as 40 independent colonies.[9] Around 80,000 pairs breed in the Ross Sea sector.[32] Major breeding colonies are located at Cape Washington (20,000–25,000 pairs), Coulman Island in Victoria Land (around 22,000 pairs), Halley Bay, Coats Land (14,300–31,400 pairs), and Atka Bay in Queen Maud Land (16,000 pairs).[9] Two land colonies have been reported: one on a shingle spit at Dion Island on the Antarctic Peninsula,[33] and one on a headland at Taylor Glacier in the Australian Antarctic Territory.[34] Vagrants have been recorded on Heard Island,[35] South Georgia, and in New Zealand.[9][36]

Conservation status

Adult

The Emperor Penguin is listed as a species of "least concern" by the IUCN.[1] Along with nine other species of penguin, it is currently under consideration for inclusion under the US Endangered Species Act. The primary reasons for this are declining food availability due to the effects of climate change and industrial fisheries on the crustacean and fish populations. Other reasons for their potential placement on this list include disease, habitat destruction, and disturbance at breeding colonies by humans. Of particular concern is the impact of tourism.[37] One study has shown Emperor Penguin chicks in a créche become more apprehensive following helicopter approach to 1,000 m (3,281 ft).[38]

Population declines of 50% in the Terre Adélie region have been observed due to increased adult mortality, especially of males, during an abnormally prolonged warm period in the late 1970s, which resulted in reduced sea-ice coverage. On the other hand, egg hatching success rates declined when the sea-ice extent increased. The species is therefore considered to be highly sensitive to climatic changes.[39]

A Woods Hole Oceanographic Institution study in January 2009 found Emperor Penguins could be pushed to the brink of extinction by the year 2100 due to global climate change. By applying mathematical models to predict how the loss of sea ice from climate warming would affect a big colony of Emperor Penguins at Terre Adélie, Antarctica, they forecast a decline of 87% in the colony's population by the end of the century, from the current 3,000 breeding pairs in the colony to 400 breeding pairs. The decline may be mirrored in the total Emperor Penguin population, estimated at about 238,000 breeding pairs in 46 colonies, using a satellite based census.[40]

Behaviour

Emperor Penguin colony

The Emperor Penguin is a social animal in its nesting and its foraging behaviour; birds hunting together may coordinate their diving and surfacing.[41] Individuals may be active day or night. A mature adult travels throughout most of the year between the nesting area and ocean foraging areas; the species disperses into the oceans from January to March.[9]

The American physiologist Gerry Kooyman revolutionized the study of penguin foraging behaviour in 1971 when he published his results from attaching automatic dive-recording devices to Emperor Penguins. He found that the species reaches depths of 265 m (869 ft), with dive periods of up to 18 minutes.[41] Later research revealed a small female had dived to a depth of 535 m (1,755 ft) near McMurdo Sound. It is possible that the Emperor Penguin can dive even deeper, as the accuracy of the recording devices is diminished at greater depths.[42] Further study of one bird's diving behaviour revealed regular dives to 150 m (490 ft) in water around 900 m (3,000 ft) deep, and shallow dives of less than 50 m (160 ft), interspersed with deep dives of more than 400 m (1,300 ft) in depths of 450 to 500 m (1,480 to 1,600 ft).[43] This was suggestive of feeding near or at the sea bottom.[44]

Both male and female Emperor Penguins forage for food up to 500 km (311 mi) from colonies while collecting food to feed chicks, covering 82–1,454 km (51–903 mi) per individual per trip. A male returning to the sea after incubation heads directly out to areas of permanent open water, known as polynyas, around 100 km (62 mi) from the colony.[43]

An efficient swimmer, the Emperor Penguin exerts pressure with both its upward and downward strokes while swimming.[24] The upward stroke works against buoyancy and helps maintain depth.[45] Its average swimming speed is 6–9 km/h (4–6 mph).[46] On land, the Emperor Penguin alternates between walking with a wobbling gait and tobogganing—sliding over the ice on its belly, propelled by its feet and wing-like flippers. Like all penguins, it is flightless.[10]

As a defence against the cold, a colony of Emperor Penguins forms a compact huddle (also known as the turtle formation) ranging in size from ten to several hundred birds, with each bird leaning forward on a neighbour. Those on the outside upwind tend to shuffle slowly around the edge of the formation and add themselves to its leeward edge, producing a slow churning action, and giving each bird a turn on the inside and on the outside.[47][48]

Diet

The Emperor Penguin's diet consists mainly of fish, crustaceans and cephalopods,[49] although its composition varies from population to population. Fish are usually the most important food source, and the Antarctic silverfish (Pleuragramma antarcticum) makes up the bulk of the bird's diet. Other prey commonly recorded include other fish of the family Nototheniidae, the Glacial Squid (Psychroteuthis glacialis), and the hooked squid species Kondakovia longimana, as well as Antarctic krill (Euphausia superba).[44] The Emperor Penguin searches for prey in the open water of the Southern Ocean, in either ice-free areas of open water or tidal cracks in pack ice.[7] One of its feeding strategies is to dive to around 50 m (164 ft), where it can easily spot sympagic fish like the Bald notothen (Pagothenia borchgrevinki) swimming against the bottom surface of the sea-ice; it swims up to the bottom of the ice and catches the fish. It then dives again and repeats the sequence about half a dozen times before surfacing to breathe.[50]

Predators

Skua flying over Emperor Penguin chicks, Ross Sea, Antarctica

The Emperor Penguin's predators include birds and aquatic mammals. The Southern Giant Petrel (Macronectes giganteus) is the predominant land predator of chicks, responsible for up to 34% of chick deaths in some colonies though they often scavenge dead penguins as well. The South Polar Skua (Stercorarius maccormicki) mainly scavenges for dead chicks, as the live chicks are too large to be attacked by the time of its annual arrival in the colony.[51]

The known aquatic predators are both mammals: the Leopard Seal (Hydrurga leptonyx), which takes some adult birds, as well as fledglings soon after they enter the water,[26] and the Orca (Orcinus orca), which takes adult birds.[52]

If one of a breeding pair dies or is killed during the breeding season, the surviving parent must abandon its egg or young and go back to the sea to feed.

Courtship and breeding

The Emperor Penguin is able to breed at around three years of age, and usually commences breeding around one to three years later.[14] The yearly reproductive cycle begins at the start of the Antarctic winter, in March and April, when all mature Emperor Penguins travel to colonial nesting areas, often walking 50 to 120 km (31 to 75 mi) inland from the edge of the pack ice.[53] The start of travel appears to be triggered by decreasing day lengths; Emperor Penguins in captivity have been induced successfully into breeding by using lighting systems mimicking seasonal Antarctic day lengths.[54]

The life-cycle of the Emperor Penguin

The penguins start courtship in March or April, when the temperature can be as low as −40 °C (−40 °F). A lone male gives an ecstatic display, where it stands still and places its head on its chest before inhaling and giving a courtship call for 1–2 seconds; it then moves around the colony and repeats the call. A male and female then stand face to face, with one extending its head and neck up and the other mirroring it; they both hold this posture for several minutes. Once in pairs, couples waddle around the colony together, with the female usually following the male. Before copulation, one bird bows deeply to its mate, its bill pointed close to the ground, and its mate then does the same.[55]

Emperor Penguins are serially monogamous. They have only one mate each year, and stay faithful to that mate. However, fidelity between years is only about 15%.[55] The narrow window of opportunity available for mating appears to be an influence, as there is a priority to mate and breed which often precludes waiting for the appearance of the previous year's partner.[56]

The egg of the Emperor Penguin. It is 12 × 8 cm and vaguely pear-shaped.

The female penguin lays one 460–470 g (1 lb) egg in May or early June;[55] it is vaguely pear-shaped, pale greenish-white, and measures around 12 × 8 cm (4¾ x 3 in).[53] It represents just 2.3% of its mother's body weight, making it one of the smallest eggs relative to the maternal weight in any bird species.[57] 15.7% of the weight of an Emperor Penguin egg is shell; like those of other penguin species, the shell is relatively thick, which minimises risk of breakage.[58]

After laying, the mother's nutritional reserves are exhausted and she very carefully transfers the egg to the male, before immediately returning to the sea for two months to feed.[53] The transfer of the egg can be awkward and difficult, and many couples drop the egg in the process. When this happens, the chick inside is quickly lost, as the egg cannot withstand the freezing temperatures on the icy ground. The male spends the winter incubating the egg in his brood pouch, balancing it on the tops of his feet, for 64 consecutive days until hatching.[55] The Emperor Penguin is the only species where this behaviour is observed; in all other penguin species both parents take shifts incubating.[59] By the time the egg hatches, the male will have fasted for around 115 days since arriving at the colony.[55] To survive the cold and winds of up to 200 km/h (120 mph), the males huddle together, taking turns in the middle of the huddle. They have also been observed with their backs to the wind to conserve body heat. In the four months of travel, courtship, and incubation, the male may lose as much as 20 kg (44 lb), from around 38 kg to just 18 kg (84 lb to 40 lb).[60][61]

Hatching may take as long as two or three days to complete, as the shell of the egg is thick. Newly hatched chicks are semi-altricial, covered with only a thin layer of down and entirely dependent on their parents for food and warmth.[62] If the chick hatches before the mother's return, the father feeds it a curd-like substance composed of 59% protein and 28% lipid, which is produced by a gland in his esophagus.[63] The young chick is brooded in what is called the guard phase, spending time balanced on its parent's feet and sheltered in the brood pouch.[62]

Emperor Penguin feeding a chick

The female penguin returns at any time from hatching to ten days afterwards, from mid-July to early August.[53] She finds her mate among the hundreds of fathers by his vocal call and takes over caring for the chick, feeding it by regurgitating the food that she has stored in her stomach. The male then leaves to take his turn at sea, spending around 24 days there before returning.[53] The parents then take turns, one brooding while the other forages at sea.[55]

About 45–50 days after hatching, the chicks form a crèche, huddling together for warmth and protection. During this time, both parents forage at sea and return periodically to feed their chicks.[62] A crèche may comprise up to several thousand birds densely packed together and is essential for surviving the low Antarctic temperatures.[64]

From early November, chicks begin moulting into juvenile plumage, which takes up to two months and is often not completed by the time they leave the colony; adults cease feeding them during this time. All birds make the considerably shorter trek to the sea in December or January and spend the rest of the summer feeding there.[26][65]

Emperor Penguin courtship involves trumpeting and bonding of pairs.

Relationship with humans

On Snow Hill Island, Antarctica

The species has been bred outside Antarctica at SeaWorld San Diego; more than 20 individuals have hatched there since 1980.[66][67] Considered a flagship species, 55 individuals were counted in captivity in North American zoos and aquaria in 1999.[68] The species is kept in captivity in only two places in the world.[69]

Penguin rescue, rehabilitation and release

In June 2011, a juvenile Emperor Penguin was found on the beach at Peka Peka, north of Wellington in New Zealand. He had been consuming 3 kg of sand, which he had mistaken for snow, as well as sticks and stones, and had to undergo a number of operations to remove these and save his life. Following recovery, on 4 September, the juvenile, named "Happy Feet" (after the name of the 2006 film), was fitted with a tracking device and released into the Southern Ocean 80 km north of Campbell Island.[70][71][72] However, 8 days later scientists lost contact with the bird, suggesting that the transmitter had fallen off (considered likely) or that he had been eaten by a predator (considered less likely).[73]

Cultural references

The species' unique life cycle in such a harsh environment has been described in print and visual media. Apsley Cherry-Garrard, the Antarctic explorer, said: "Take it all in all, I do not believe anybody on Earth has a worse time than an Emperor Penguin".[74] Widely distributed in cinemas in 2005, the French documentary La Marche de l'empereur, which was also released with the English title March of the Penguins, told the story of the penguins' reproductive cycle.[69][75] The subject has been covered for the small screen three times by the BBC and presenter David Attenborough, first in episode five of the 1993 series on the Antarctic Life in the Freezer,[76] again in the 2006 series Planet Earth,[77] and finally Frozen Planet in 2011.[78]

The computer-animated movie Happy Feet (2006) features Emperor Penguins as its primary characters, with one in particular that loves to dance; although a comedy, it too depicts their life cycle and promotes an underlying serious environmental message of threats from global warming and depletion of food sources by overfishing.[79] The computer-animated movie Surf's Up (2007) features a surfing Emperor Penguin named Zeke "Big-Z" Topanga.[80] More than 30 countries have depicted the bird on their stamps – Australia, Great Britain, Chile and France have each issued several.[81] It has also been depicted on a 1962 10 franc stamp as part of an Antarctic expedition series.[82] Canadian band The Tragically Hip included a song 'Emperor Penguin' on their 1998 album Phantom Power.

Notes

  1. ^ a b BirdLife International (2009). "Aptenodytes forsteri". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/144799. Retrieved 13 August 2011. 
  2. ^ Williams, (The Penguins) p. 13
  3. ^ Jouventin P (1982). "Visual and vocal signals in penguins, their evolution and adaptive characters". Adv. Ethol. 24: 1–149. 
  4. ^ Baker AJ, Pereira SL, Haddrath OP, Edge KA (2006). "Multiple gene evidence for expansion of extant penguins out of Antarctica due to global cooling". Proc Biol Sci. 273 (1582): 11–17. doi:10.1098/rspb.2005.3260. PMC 1560011. PMID 16519228. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1560011. 
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  6. ^ http://www2.canada.com/calgaryherald/news/story.html?id=59132c88-d1ec-434c-b16f-d15eb1ceb16b&p=2
  7. ^ a b c d e f g University of Michigan Museum of Zoology. "Aptenodytes forsteri". http://animaldiversity.ummz.umich.edu/site/accounts/information/Aptenodytes_forsteri.html. Retrieved 2008-01-01. 
  8. ^ "Emperor Penguin, Aptenodytes forsteri at MarineBio.org". Marinebio.org. MarchineBio Advertising. http://marinebio.org/species.asp?id=534. Retrieved 2008-11-03. 
  9. ^ a b c d e Marchant, S; Higgins PJ (1990). Handbook of Australian, New Zealand and Antarctic Birds, Vol. 1A. Melbourne: Oxford University Press. 
  10. ^ a b Williams (The Penguins) p. 3
  11. ^ a b Owen J (2004-01-30). ""Penguin Ranch" Reveals Hunting, Swimming Secrets". National Geographic website. National Geographic. http://news.nationalgeographic.com/news/2004/01/0130_040130_penguincam.html. Retrieved 2008-03-26. 
  12. ^ a b c d Williams (The Penguins) p. 152
  13. ^ CDNN (2001-09-08). "Scientists find rare all-white emperor penguin". CDNN. Cyber Diver News Network. http://www.cdnn.info/eco/e010908/e010908.html. Retrieved 2008-03-29. 
  14. ^ a b Williams 1995, p. 159.
  15. ^ Williams 1995, p. 45.
  16. ^ a b (French) Mougin J-L, van Beveren M (1979). "Structure et dynamique de la population de manchots empereur Aptenodytes forsteri de la colonie de l'archipel de Pointe Géologie, Terre Adélie". Compte Rendus Academie Science dé Paris 289D: 157–60. 
  17. ^ Williams 1995, p. 47.
  18. ^ a b Williams 1995, p. 68.
  19. ^ Robisson P (1992). "Vocalizations in Aptenodytes Penguins: Application of the Two-voice Theory" (PDF). Auk 109 (3): 654–658. http://elibrary.unm.edu/sora/Auk/v109n03/p0654-p0658.pdf. 
  20. ^ Antarctic Photo Library of the US Antarctic Program retrieved May 30, 2008
  21. ^ Williams 1995, p. 107.
  22. ^ Williams 1995, p. 108.
  23. ^ C. Michael Hogan (2008) Magellanic Penguin, GlobalTwitcher.com, ed. N. Stromberg
  24. ^ a b Hile J (2004-03-29). "Emperor Penguins: Uniquely Armed for Antarctica". National Geographic website. National Geographic. http://news.nationalgeographic.com/news/2004/03/0329_040329_TVpenguins.html. Retrieved 2008-03-31. 
  25. ^ Williams 1995, pp. 107–108.
  26. ^ a b c Kooyman GL, Gentry RL, Bergman WP, Hammel HT (1976). "Heat loss in penguins during immersion and compression". Comparative Biochemistry and Physiology 54A: 75–80. 
  27. ^ Williams 1995, p. 109.
  28. ^ Williams 1995, p. 110.
  29. ^ Williams 1995, p. 111.
  30. ^ "Emperor Penguins: Uniquely Armed for Antarctica". National Geographic. http://news.nationalgeographic.com/news/2004/03/0329_040329_TVpenguins.html. 
  31. ^ Norris S (2007-12-07). "Penguins Safely Lower Oxygen to "Blackout" Levels". National Geographic website. National Geographic. http://news.nationalgeographic.com/news/2007/12/071207-penguins-dive.html. Retrieved 2008-03-26. 
  32. ^ Harper PC, Knox GA, Wilson GJ, Young EC (1984). "The status and conservation of birds in the Ross Sea sector of Antarctica". In Croxall JP, Evans PGH, Schreiber RW. Status and Conservation of the World's Seabirds. Cambridge: ICBP. pp. 593–608. 
  33. ^ Stonehouse, B (1953). "The Emperor Penguin Aptenodytes forsteri Gray I. Breeding behaviour and development". Falkland Islands Dependencies Survey Scientific Report 6: 1–33. 
  34. ^ Robertson, G (1992). "Population size and breeding success of Emperor Penguins Aptenodytes forsteri at Auster and Taylor Glacier colonies, Mawson Coast, Antarctica". Emu 92 (2): 65–71. doi:10.1071/MU9920065. 
  35. ^ Downes MC, Ealey EHM, Gwynn AM, Young PS (1959). "The Birds of Heard Island". Australian National Antarctic Research Report Series B1: 1–35. 
  36. ^ Croxall JP, Prince PA (1983). "Antarctic Penguins and Albatrosses". Oceanus 26: 18–27. 
  37. ^ Burger J., Gochfeld M. (2007). "Responses of Emperor Penguins (Aptenodytes forsteri) to encounters with ecotourists while commuting to and from their breeding colony". Polar Biology 30 (10): 1303–1313. doi:10.1007/s00300-007-0291-1. 
  38. ^ Giese M, Riddle M (1997). "Disturbance of emperor penguin Aptenodytes forsteri chicks by helicopters". Polar Biology 22 (6): 366–71. doi:10.1007/s003000050430. http://www.springerlink.com/content/vy4wbkfdlmqjj196/fulltext.pdf. Retrieved 2008-03-22. 
  39. ^ Barbraud, C.; Weimerskirch H. (2001). "Emperor penguins and climate change". Nature 411 (6834): 183–186. doi:10.1038/35075554. PMID 11346792. 
  40. ^ Fretwell PT, LaRue MA, Morin P, Kooyman GL, B Wienecke, N Ratcliffe, AJ Fox, AH Fleming, C Porter, PN Trathan (2012). "An Emperor Penguin Population Estimate: The First Global, Synoptic Survey of a Species from Space.". PLoS ONE 7 (4): e33751. doi:10.1371/journal.pone.0033751. 
  41. ^ a b Kooyman GL, Drabek CM, Elsner R, Campbell WB (1971). "Diving behaviour of the Emperor Penguin Aptenodytes forsteri". Auk 88: 775–95. http://elibrary.unm.edu/sora/Auk/v088n04/p0775-p0795.pdf. 
  42. ^ Williams 1995, p. 89.
  43. ^ a b Ancel A, Kooyman GL, Ponganis PJ, Gendner JP, Lignon J, Mestre X (1992). "Foraging behaviour of Emperor Penguins as a resource detector in Winter and Summer". Nature 360 (6402): 336–39. doi:10.1038/360336a0. 
  44. ^ a b Williams 1995, p. 156.
  45. ^ Lovvorn, J. R. (2001). "Upstroke thrust, drag effects, and stroke-glide cycles in wing-propelled swimming by birds". American Zoologist 41 (2): 154–165. doi:10.1093/icb/41.2.154. http://icb.oxfordjournals.org/cgi/content/full/41/2/154. 
  46. ^ Kooyman GL, Ponganis PJ, Castellini MA, Ponganis EP, Ponganis KV, Thorson PH, Eckert SA, LeMaho Y (1992). "Heart rates and swim speeds of emperor penguins diving under sea ice". Journal of Experimental Biology 165 (1): 1161–80. http://jeb.biologists.org/cgi/reprint/165/1/161.pdf. 
  47. ^ Pinshow B., Fedak M.A., Battles D.R, Schmidt-Nielsen K. (1976). "Energy expenditure for thermoregulation and locomotion in emperor penguins". American Journal of Physiology 231 (3): 903–12. PMID 970474. 
  48. ^ Rebecca Morelle (2 June 2011). "Penguin huddle secrets revealed with time lapse footage". BBC News. http://www.bbc.co.uk/news/science-environment-13616778. Retrieved 2011-06-04. "The mystery of how penguins stay warm while they huddle has been revealed by an international team of scientists. ... Dr Zitterbart explained: "The colony would stay still for most of the time, but every 30-60 seconds one penguin or a group of penguin starts to move - just a little bit. "This makes the surrounding ones move - and all of a sudden this moves throughout the colony like a wave."" 
  49. ^ Cherel Y, Kooyman GL (1998). "Food of emperor penguins (Aptenodytes forsteri) in the western Ross Sea, Antarctica" (PDF). Marine Biology 130 (3): 335–44. doi:10.1007/s002270050253. http://www.springerlink.com/content/gpuy6dtmwnkxc5t8/fulltext.pdf. 
  50. ^ Ponganis PJ, Van Dam RP, Marshall G, Knower T, Levenson DH (2003). "Sub-ice foraging behavior of emperor penguins". Journal of Experimental Biology 203 (21): 3275–78. http://jeb.biologists.org/cgi/reprint/203/21/3275.pdf. 
  51. ^ Williams, p. 40.
  52. ^ Prévost, J (1961). Ecologie du manchot empereur. Paris: Hermann. 
  53. ^ a b c d e Williams 1995, p. 158.
  54. ^ Groscolas, R; Jallageas, M; Goldsmith, A; Assenmacher, I (1986). "The endocrine control of reproduction and molt in male and female Emperor (Aptenodytes forsteri) and Adélie (Pygoscelis adeliae) Penguins. I. Annual changes in plasma levels of gonadal steroids and luteinizing hormone". Gen. Comp. Endocrinol 62 (1): 43–53. doi:10.1016/0016-6480(86)90092-4. PMID 3781216. 
  55. ^ a b c d e f Williams 1995, p. 157.
  56. ^ Williams 1995, p. 55.
  57. ^ Williams 1995, p. 23.
  58. ^ Williams 1995, p. 24
  59. ^ Williams 1995, p. 27.
  60. ^ Robin, J. P.; M. Frain, C. Sardet, R. Groscolas, and Y. Le Maho (1988). "Protein and lipid utilization during long-term fasting in emperor penguins". Am. J. Physiol. Regul. Integr. Comp. Physiol. 254: R61–R68. 
  61. ^ Le Maho, Y.; P. Delclitte, and J Chatonnet (1976). "Thermoregulation in fasting emperor penguins under natural conditions". Am. J. Physiol. 231 (3): 913–922. PMID 970475. 
  62. ^ a b c Williams 1995, p. 28.
  63. ^ (French) Prévost J, Vilter V (1963). "Histologie de la sécrétion oesophagienne du Manchot empereur". Proceedings of the XIII International Ornithological Conference: 1085–94. 
  64. ^ Williams 1995, p. 30.
  65. ^ Pütz, K.; Plötz, J. (1991). "Moulting starvation in emperor penguin (Aptenodytes forsteri) chicks". Polar Biology 11 (4): 253–258. doi:10.1007/BF00238459. http://www.springerlink.com/content/n27q005gj4631654/fulltext.pdf. .
  66. ^ Todd, FS (1986). "Techniques for propagating King and Emperor penguins Aptenodytes patagonica and A. forsteri at Sea World, San Diego". International Zoo Yearbook 26 (1): 110–24. doi:10.1111/j.1748-1090.1986.tb02208.x. 
  67. ^ "Animal Bytes - Penguins". SeaWorld official website. SeaWorld. 2008. http://www.seaworld.org/animal-info/animal-bytes/animalia/eumetazoa/coelomates/deuterostomes/chordata/craniata/aves/sphenisciformes/emperor-penguin.htm. Retrieved 2008-03-23. 
  68. ^ Diebold EN, Branch S, Henry L (1999). "Management of penguin populations in North American zoos and aquariums" (PDF). Marine Ornithology 27: 171–76. http://www.marineornithology.org/PDF/27/27_21.pdf. Retrieved 2008-03-31. 
  69. ^ a b Bowes P (2005-08-19). "Penguin secrets captivate US viewers". BBC website. British Broadcasting Corporation. http://news.bbc.co.uk/1/hi/entertainment/film/4165858.stm. Retrieved 2008-03-23. 
  70. ^ "Happy Feet's trek a boon for scientists". Television New Zealand. 6 September 2011. http://tvnz.co.nz/national-news/happy-feet-s-trek-boon-scientists-4387573. Retrieved 29 September 2011. 
  71. ^ New Zealand releases penguin Happy Feet
  72. ^ Lost Happy Feet needs a helping hand as he returns home after life-saving surgery
  73. ^ Concern mounts for 'missing' penguin Happy Feet
  74. ^ Cherry-Garrard, A (1922). "introduction". The Worst Journey in the World. Carroll & Graf. pp. xvii. ISBN 0-88184-478-0. 
  75. ^ (French) "La Marche de l'empereur, un film de Luc Jacquet". Official Site. http://empereur.luc-jacquet.com/index_flash.htm. Retrieved 2008-03-19. 
  76. ^ Presenter – David Attenborough (1993). "The Big Freeze". Life in the Freezer. episode 5. season 1. BBC. 
  77. ^ Presenter – David Attenborough (2006). "Ice Worlds". Planet Earth. episode 6. season 1. BBC. 
  78. ^ Presenter – David Attenborough (2011). "Winter". Frozen Planet. episode 5. season 1. BBC. 
  79. ^ Lovgren S (2006-11-16). ""Happy Feet": Movie Magic vs. Penguin Truths". National Geographic website. National Geographic. http://news.nationalgeographic.com/news/2006/11/061116-happy-feet.html. Retrieved 2008-03-26. 
  80. ^ Lovgren S (2007). "Behind the Scenes of the New Movie "Surf's Up"". National Geographic website. National Geographic. Archived from the original on March 10, 2008. http://web.archive.org/web/20080310002959/http://kids.nationalgeographic.com/Stories/WackyStories/Surfs-up. Retrieved 2008-03-26. 
  81. ^ Scharning K (2008). "Penguins Spheniscidae". Theme Birds on Stamps. self. http://www.birdtheme.org/mainlyimages/index.php?comb=7002000&s=7. Retrieved 2008-03-29. 
  82. ^ Scharning K (2008). "Bird stamps from Belgium". Theme Birds on Stamps. self. http://www.birdtheme.org/country/belgium.html. Retrieved 2008-03-29. 

References

  • Williams, Tony D. (1995). The Penguins. Oxford, England: Oxford University Press. ISBN 0-19-854667-X. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!