Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Description

This charismatic marine bird is easily distinguished from other penguins by its bright orange-red bill and the conspicuous white patches above each eye (3). These white patches, which usually meet across the crown, contrast highly with the black head and throat, but there may also be a scattering of white feathers on the head. The white underparts are sharply separated from the penguin's bluish-black back, which appears browner as the feathers become worn (3). The gentoo penguin has pale whitish-pink webbed feet and a fairly long tail - the most prominent tail of all penguins (2) (3) (4). As the gentoo penguin waddles along on land, its tail sticks out behind, sweeping from side to side, hence the scientific name Pygoscelis, which means 'brush-tailed' (4). The gentoo penguin calls in a variety of ways, but the most frequently heard is a loud trumpeting which is emitted with its head thrown back (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

A gregarious bird, but less so than some other penguin species (2), the gentoo can form breeding colonies ranging from thirty to thousands of pairs (5). Arriving at suitable nesting ground between June and November (the exact date depending on the location) (2), each pair of penguins will set about the task of constructing a nest from stones, tussock grass and moss (2). The penguins tear up plants to use as nest material and fertilise the ground with their droppings, resulting in grass growing well the subsequent year, hence their favourable reputation with sheep farmers (5). Into these nests two white, spherical eggs are laid, which are incubated by both the male and female for 31 to 39 days (2). The penguin chicks fledge after 85 to 117 days, but continue to be fed by their parents for a further 5 to 50 days. Gentoo penguins, which reach sexual maturity at the age of two years (2), are not only faithful to certain nest sites, with most returning to the previous year's nest, but they are also loyal to breeding partners, with many forming long-lasting pair bonds (3). Walking with a rather comedic, waddling gait on land, the gentoo penguin shows its true talents when in the water. With its stream-lined body and 'flippers' that provide effective propulsion through the water (6), the gentoo penguin dives deep into the ocean in pursuit of its prey, and is capable of reaching impressive depths of up to 170 metres (3). The exact diet of the gentoo penguin varies depending on location, but can include Atlantic krill, other crustaceans, fish, cephalopods and polychaetes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

New Zealand Exclusive Economic Zone, Southern Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Pygoscelis papua breeds on South Georgia (Georgia del Sur) and the South Sandwich Islands (Islas Sandwich del Sur), the Falkland Islands (Malvinas), on Martillo Island, Argentina9, the South Orkney and South Shetland Islands, Prince Edward and Marion Islands (South Africa), Crozet and Kerguelen Islands (French Southern Territories), Heard Island (Heard and McDonald Islands [to Australia]) and Macquarie Island (Australia), and the Antarctic Peninsula. The total (minimum) population has been estimated at 314,000 pairs6. Populations on the Antarctic Peninsula (25% of the total) are increasing at most sites, some (e.g. Signy Island) have doubled in the last 20 years3. Conversely, populations at sub-Antarctic islands (75% of the total) may have decreased substantially. For example, populations at Bird Island (the only monitored population at South Georgia - 33% of the total) decreased by c.67% over the last 25 years4, at Marion Island (3% of the total) by 11% over the period 1994-19971 and on the Falklands (21% of the total) by c.45% from 1932-33 to 1995-952. More recent surveys on the Falklands have shown the population to have increased from 65,000 pairs in 1995-96 to 113,000 pairs in 20007, whilst a suggested increase at Macquarie needs confirming5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pygoscelis papua, or more commonly known as gentoo penguins, are exclusively found in the Southern Hemisphere between 45 and 65 degrees south latitude. Within this range, gentoos are found on the Antarctic Peninsula as well as many sub-Antarctic islands. Only about 13% of all gentoo penguins live south of the Antarctic ice pack.

One of the most predominant locations gentoos inhabit is the Falkland Islands in the South Atlantic Ocean. Around 40% of P. papua worldwide are found within this archipelago.

Biogeographic Regions: antarctica (Native )

  • Pistorius, P., N. Huin, S. Crofts. 2010. Population change and resilience in gentoo penguins Pygoscelis papua at the Falkland Islands. Marine Ornithology, 38/1: 49-53.
  • Quintana, R. 2001. Nest-site characteristics of a gentoo penguin Pygoscelis papau colony at Cierva Point, Antarctic Peninsula. Marine Ornithology, 29/2: 109-112.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The gentoo penguin has a circumpolar distribution, breeding on sub-Antarctic Islands and the Antarctic peninsula (3). Two subspecies of the gentoo penguin are recognised (2): Pygoscelis papua papua breeds mainly on the Falkland Islands and South Georgia, Kerugulen, Heard, Macquarie and Staten Islands, while Pygoscelis papua ellsworthi breeds on the Antarctic Peninsula, South Shetland Island, South Orkney and South Sandwich Island (3). The gentoo's non-breeding range is not fully known, but they have been found as far north as New Zealand, Australia and Argentina (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Like all penguin species, the ventral side of gentoo penguins is white while the dorsal side is black. This color pattern is known as countershading. This adaptation is useful while swimming underwater; the lightly colored ventral side helps penguins blend in with the sky for predators or prey that are looking up. The dark dorsal side blends in with the ocean floor for predators or prey looking down.

The major difference between gentoo penguins and other penguin species are their head markings. Gentoos feature two white wedges around their eyes that are connected by a medium-sized line across the tops of their heads. Their heads are mostly covered in black feathers but small flecks of white feathers can also be found.

The feathers of gentoos are very fine; every square inch of their body can be covered with up to 70 feathers. Gentoos are part of a group called the "brush-tail penguins" which characterizes their tails as having longer feathers than those of other penguin species. Their tails consist of 14 to 18 feathers and are about 15 centimeters long. Because gentoos are aquatic, they must make their feathers waterproof. Using their bills, they do so by covering their feathers with oil found in the uropygial gland near the base of their tails.

Of the 17 penguin species, gentoo penguins are the third largest in size. They stand roughly at 76 centimeters when they reach adulthood. Depending on the time of the year, they can weigh anywhere from 4.5 to 8.5 kilograms. Heavier weights are seen during their month-long molting phase.

Their feet are stout, fat, and webbed. They are bright orange with long black claws extending from the webbing. The beak of a gentoo is partially black but has a bright dark-orange to red spot on either side. The color of the spot is attributed to the carotenoids absorbed from the krill they eat.

There is very little difference between the males and females. The main characteristic differentiating between the sexes is size. Males are significantly larger than females in almost all respects such as bill length, flipper length, and height.

Gentoo penguins look very similar from the time they hatch until their first molt which occurs at around 14 months. Chicks have downy-gray feathers and a weak, dull-colored bill. The white wedges around the eyes are noticeable at a young age; however, they are not as well-defined or connected along the top of their head like the adults.

Range mass: 4.5 to 8.5 kg.

Range length: 70 to 95 cm.

Average length: 75 cm.

Range wingspan: 22.2 to 25.6 cm.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

  • Cuervo, J., M. Palacios, A. Barbosa. 2009. Beak colouration as a possible sexual ornament in gentoo penguins: Sexual dichromatism and relationship to body condition. Polar Biology, 32/9: 1305-1314.
  • McMillan, B. 1993. Penguins at Home: Gentoos of Antarctica. New York, NY: Houghton Mifflin Company.
  • Naveen, R. 1999. Waiting to Fly. New York, NY: William Morrow & Company.
  • Renner, M., J. Valencia, L. Davis, D. Saez, O. Cifuentes. 1998. Sexing of adult gentoo penguins in Antarctica using morphometrics. Colonial Waterbirds, 21/3: 444-449.
  • Williams, T. 1995. The Penguins: Spheniscidae. New York, NY: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a partially migratory marine species which nests on rocky coasts, sometimes amongst vegetation8.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gentoo penguins typically are found along the shoreline. This allows the penguins to be able to quickly access food while remaining close to their nest. They prefer elevations close to 115 meters above sea level along the shore because the snow in these areas tends to melt first. The higher the altitude, the decreased likelihood of nest-flooding as the snow starts to melt during the summer. The terrain in these areas is also flat which helps to stabilize their nests. Gentoo penguins prefer north-facing locations for nesting, which is thought to be linked to absorbing solar radiation. The main feature of gentoo habitats is the prevalence of small pebbles, typically under 5 centimeters in diameter. These pebbles are the main building blocks in creating a sufficient nest to hold the eggs during breeding season.

Gentoo penguins also spend some of their day underwater for feeding excursions. These aquatic trips are typically short; the longest dive on record is only two minutes long. Gentoos typically dive down only 3 to 20 meters, with occasional deeper dives up to 70 meters.

Average elevation: 115 m.

Range depth: 3.5 to 70.0 m.

Average depth: 9.0 m.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Terrestrial Biomes: tundra ; icecap

Aquatic Biomes: coastal

  • Adams, N., C. Brown. 1983. Diving depths of the gentoo penguin (pygoscelis papua). The Condor, 85: 503-504.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 307 specimens in 1 taxon.
Water temperature and chemistry ranges based on 124 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.348 - 9.650
  Nitrate (umol/L): 8.380 - 28.640
  Salinity (PPS): 32.635 - 34.147
  Oxygen (ml/l): 6.231 - 8.188
  Phosphate (umol/l): 1.263 - 1.977
  Silicate (umol/l): 2.879 - 89.471

Graphical representation

Temperature range (°C): -1.348 - 9.650

Nitrate (umol/L): 8.380 - 28.640

Salinity (PPS): 32.635 - 34.147

Oxygen (ml/l): 6.231 - 8.188

Phosphate (umol/l): 1.263 - 1.977

Silicate (umol/l): 2.879 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This marine bird can be found searching for food in inshore waters (2). When breeding, the gentoo penguin favours flat ground (2), either close to the coast or a considerable distance inland (3), where it nests in rocky areas, sometimes amongst vegetation (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gentoo penguins are carnivores and mainly consume fish, crustaceans, and cephalopods. Different times of the year mark different percentages of their diet. Krill (Euphausia vallentini) and shrimp (Nauticaris marioni) make up most of the crustacean diet. In February and March, crustaceans make up about 10% of their diet but from March to June it jumps to 75%. All other times of the year, crustaceans are absent from their diet.

From June to October, rockcod (Lepidonotothen squamifrons) make up 90% of their diet, but they also consume unicorn icefish (Channichthys rhinoceratus). Cephalopods only make up 10% of their diet during the year. The main types of cephalopods foraged on are octopi and sometimes small squid. The seasonal diet variation is due the presence of other penguin species during breeding season, seasonal migration of prey, as well as the availability of prey at varying depths. Most other penguins forage in deeper waters which will push some prey species closer to shore and into the prime range for gentoos.

Gentoo penguins feed in shallow regions. When they are underwater, their metabolic rate slows down enabling them to stay underwater for longer periods to forage.

During the chick-rearing stage, parent gentoos will return to the nest and regurgitate their freshly caught food for their chicks to eat.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Adams, N., N. Klages. 1989. Temporal variation in the diet of the gentoo penguin Pygoscelis papua at sub-antarctic Marion Island. Colonial Waterbirds, 12/1: 30-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Gentoos live in colonies with other gentoos, but are also known to live in colonies with other penguin species. Although the species all forage in the ocean, different species are partitioned to forage at different depths or distances. P. papau do not negatively affect other penguin species since they mainly forage right offshore.

Because gentoos live in large colonies with thousands of birds, flea and tick prevalence is high. Fleas from the genus Parapsyllus are common. The most prevalent tick is Ixodes uriae, which mainly affects the exposed skin of chicks such as ear canals, feet, and faces.

Cestodes, members of the genus Tetrabothrius, have been found in the intestines of Pygoscelis papau but little is known about their life cycle. The cestodes are found in various crustaceans that make up the gentoos' diet. Members of the genus Corynosoma also have been reported in gentoos.

Parorchites zederi, another species of cestode, latches onto the inside of gentoos' intestines. These parasites create small pouches in the intestines and insert their pseudoscoleces ("false heads") in them to feed. The areas that P. zederi latch onto increase in volume due to the creation of more intestinal cells and blood flow to the area increases.

Commensal/Parasitic Species:

  • Duignan, P. 2001. Disease of penguins. Surveillance, 28/4: 5-11.
  • Tzvetkov, Y., A. Kril, B. Georgiev, N. Chipev. 1999. Morphology of lesions in the intestinal wall of gentoo penguin, Pygoscelis papau, caused by Parorchites zederi. Bulgarian Anarctic Research, 2: 62-67.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Young chicks are at much greater risk of predation than adults. Brown skuas (Catharacta lonnbergi) are the main predators of penguin chicks. Skuas mainly feed on the chicks and eggs found along the edge of the population which are perceived as weak and solitary. The formation of chick crèches act as an anti-predator-defense. Skuas are less likely to attack the crèches of gentoo chicks because it is hard to distinguish where one chick is within a group.

In the water, waddell seals (Leptonychotes weddellii) have been seen feeding on gentoos. Leopard seals (Hydrurga leptonyx) will travel in the gentoo breeding grounds and attack penguins leaving and returning to the colony. They are most often seen eating chicks as they first enter the water during fledging. Other species of seals such as fur seals from the genus Arctocephalus and southern sea-lions from the genus Otaria have been observed eating gentoos, although their impact on the population is unknown.

The main adaptation to evade predators is countershading. Aquatic predators can look down and see the black dorsal side of the gentoo, which blends in with the ocean floor. Likewise, seals looking up see the white ventral side, which blends in with the light from the sky.

Known Predators:

Anti-predator Adaptations: cryptic

  • Cobley, N., G. Bell. 1998. Weddell seal (Leptonychotes weddellii) feeding on gentoo penguins (Pygoscelis papau). Marine Mammal Science, 14/4: 881-883.
  • Emslie, S., N. Karnovsky, W. Trivelpiece. 1995. Avian predation at penguin colonies on King George Island, Antarctica. The Wilson Bulletin, 107/2: 317-327.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Breeding
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Visually speaking, gentoo penguins see excellently underwater, although they are impaired when on land. Their retinas are very sensitive to the colors seen underwater such as green, blue, and purple. However this vision becomes impaired once they reach the surface of the water.

Gentoo penguins communicate with each other through a squawking vocalization. These calls typically are higher pitched and louder in males. Gentoos vocalize for a variety of reasons for example, when a male or female returns after feeding they will point their beaks straight up into the air and bellow out squawks to announce their return.

During incubation the parents take turns sitting on the eggs. When the other parent returns (mainly from feeding), a series of displays ensue. The arriving penguin does either a loud display in which he/she bellows out into the air or can do a bowing display in which the penguin bows down to the nest and gives a low hissing sound. Either of these displays communicates to the penguin on the egg that the returning penguin is ready to watch over the nest. The change-over of the nest between parents usually takes three minutes. Sometimes, the displays are reciprocated by the current incubator.

At times during the mating season, the male will rub the female's face and then the two of them will rub their bills together. Also, when one returns to the breeding ground with a stone to use for the nest, the other will bow repeatedly to accept the stone. These displays likely serve to strengthen the pair bond.

Gentoo penguins will also make sounds when another penguin is encroaching on its territory. Gentoos will make low hissing sounds if the interaction is not a high threat level. As a threat looms closer, gentoos will let out grunts.

Chicks communicate with their parents when they want food with high-pitched chirping sounds. In other situations, chicks make a modified whistle call until they reach their first molt where they develop the adult call. Chicks can distinguish their parents call apart from the calls of the thousands of other gentoos that may be nesting within the colony. Like all birds, gentoo penguins perceive their environments through visual, auditory, tactile, and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: duets

  • Müller-Schwarze, D., C. Müller-Schwarze. 1980. Display rate and speed of nest relief in antarctic Pygoscelid penguins. The Auk, 97/4: 825-831.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

On average, gentoo penguins live to be 13 years old. Most deaths occur within the first year of life, with only a 30 to 50 percent chance of surviving until the next year. Beyond the first year, survival increases to an annual rate of 80 percent.

In captivity, the mean life span for P. papau is 10.5 years. Some individuals have lived to be older; however there are many deaths due to weather patterns (for outside exhibits) and for not maintaining a sufficient diet for the penguins.

Average lifespan

Status: wild:
13 years.

Average lifespan

Status: captivity:
10.5 years.

  • Gailey-Phipps, J. 1978. A world survey of penguins in captivity. International Zoo Yearbook, 18/1: 7-13.
  • Gilpin, D. 2007. Penguins: Lifestyle - Habitat - Feeding - Behavior. New York, NY: Parragon Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females' choice of male mates is based on male behaviors. First, the male gentoos find the best spot for a potential nest. The prime areas are those that are flat with little to no snow or ice. Once a potential nest site is chosen, the males point their bills vertically in the air and bellow out calls. The calls announce to the females to come and investigate their nest site. If a female waddles by and "likes" the nest site, the male and female will mutually display by trumpeting or bowing.

Gentoo penguins are monogamous during a breeding season, with some pair bonds lasting a lifetime. "Divorces" (the breaking of pair-bonds) do occur between breeding seasons. In this case, females choose a new partner that has displayed greater reproductive success. As colonial breeders, direct observation of nesting success is possible. The divorce rate in gentoos is less than 20 percent, which is relatively low compared to other penguin species. The benefit to a monogamous relationship is that mates do not have to expend time and energy finding new mates each year.

Mating System: monogamous

Gentoo penguins can begin breeding at two years of age, although most don't until they are about three or four. Living in colonies, gentoo penguins can gather in groups of over 2,000 pairs at one breeding site. At the beginning of the breeding season, nests are built by the parents. Gentoo nests are spaced about a meter apart. The egg-laying season for P. papau begins from June to mid-August and usually finishes in late October to late November.

After the nest has been completed, the female will stay at the nest and lay her egg 5 days post-breeding. A second egg is laid three days later. The eggs are spherical and greenish-white. The weight of the first egg in relation to the second egg varies between nesting locations, but on average egg weight is 125 grams. There have been rare cases where one or three eggs were laid.

If the set of eggs is lost, gentoo penguins can lay a second set of eggs during the same breeding season. These eggs are laid near the end of the breeding season when the female regains sufficient energy. The downside to a late laying is reduced energy, causing a late molting period. Females do not have enough energy to begin their molt right after breeding and therefore delay molting. This, in turn, delays egg-laying the following year. Indeed, the female may not have enough energy to lay a clutch the next year.

The eggs are incubated for an average of 35 days before hatching. Although the eggs are laid days apart from each other, they typically hatch on the same day or one day apart. The chicks are frail and weigh about 96 grams. The chicks stay at the nest for the first 75 days until they are ready to fledge and visit the ocean for the first time. During this fledging period, gentoo chicks make an average of 5 trips to sea. The young reach independence 20 days post-fledging.

Breeding interval: Gentoo penguins breed once a year.

Breeding season: The breeding season for gentoo penguins starts in June to mid-August and ends in late October to late November.

Range eggs per season: 1 to 3.

Range time to hatching: 34 to 35 days.

Average time to hatching: 37 days.

Range birth mass: 85 to 107 g.

Range fledging age: 75 to 105 days.

Average fledging age: 80 days.

Range time to independence: 85 to 105 days.

Average time to independence: 100 days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents are involved in nest-building. The nest is bowl shaped with a wide edge and a hollow center. Nest size ranges between 10 to 20 cm in height and around 45 cm in diameter. Nests are made from small stones found around the nesting site, including stones stolen from other nests. Medium-sized nests can contain over 1,700 pebbles. Although pebbles are the main component of nests, sometimes molted feathers, twigs, and vegetation are used.

Members of both sexes defend their nests from other birds that come too close. P. papau will stick out its bill toward the invader and let out a low hiss. Competition for territory exists between two adjacent nests in which parents will turn their neck towards their neighbor and try to grab and twist their bill. Although rare, fighting with bills and flippers has been observed.

The female lays two eggs within 3 days of each other. The eggs are kept safely under the male or female for the 35 days of incubation. For the first three to four weeks, the chicks are guarded in the nest. The parents take turns getting food and regurgitating it for the chicks. Near the end of this stage, the chicks begin to move short distances away from the nest and form groups with other chicks (creches). These groups serve to protect against predators while both parents to forage for the growing young. The young fledge at 70 days old and will enter the sea for the first time. Both parents will still feed their chicks (although not as often) during the fledging period. Feedings have occasionally been recorded post-independence.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female); pre-independence (Provisioning: Male, Female)

  • Bost, C., P. Jouventin. 1990. Laying asynchrony in gentoo penguins on Crozet Islands: Causes and consequences. Ornis Scandinavica, 21/1: 63-70.
  • Croxall, J., L. Davis. 1999. Penguins: Paradoxes and patterns. Marine Ornithology, 27: 1-12.
  • Frédérique, D., F. Cézilly, M. Pagel. 1998. Mate fidelity and coloniality in waterbirds: A comparative analysis. Oecologia, 116/3: 433-440.
  • Gales, R., B. Green, J. Libke, K. Newgrain, D. Pemberton. 2009. Breeding energetics and food requirements of gentoo penguins (Pygoscelis papua) at Heard and Macquarie Islands. Journal of Zoology, 231/1: 125-139.
  • McMillan, B. 1993. Penguins at Home: Gentoos of Antarctica. New York, NY: Houghton Mifflin Company.
  • Naveen, R. 1999. Waiting to Fly. New York, NY: William Morrow & Company.
  • Polito, M., W. Trivelpiece. 2008. Transition to independence and evidence of extended parental care in the gentoo penguin (Pygoscelis papua). Marine Biology, 154/2: 231-240.
  • Spilsbury, R., L. Spilsbury. 2004. A Rookery of Penguins. Chicago, IL: Heinemann Library.
  • Williams, T. 1995. The Penguins: Spheniscidae. New York, NY: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feathers protect from water: Gentoo penguin
 

The feathers of penguins prevent water from penetrating to the skin due to their stiff, tightly packed structure.

   
  "The penguins (below) lost the power of flight some 100 million years ago, and have no flight feathers on their wings. Their stiff close-packed feathers form a think insulating mat that is impervious to water and provides a good streamlined surface for swimming." (Foy and Oxford Scientific Films 1982:111)


"Several studies have investigated the thermal resistance of penguin 'coats' (feather and skin assembly) and found it to be surprisingly low—an average of 0.74 m2KW-1 or 7.4 Tog. Penguin feathers are heavily modified, being short (30-40 mm), stiff and lance shaped. Insulation is provided by a long (20-30 mm) afterfeather. Penguins are unique in that the feathers are evenly packed over the surface of the body (30-40 per cm2) rather than arranged in tracts. For insulation the penguin requires a thick, air-filled, windproof coat (similar to an open-cell foam covered with a windproof layer) that eliminates convection and reduces radiative and convective heat losses to a minimum. However, when diving, the penguin requires a thin, smooth and waterproof coat with no trapped air (positive buoyancy would be a big disadvantage to an active swimming hunter). It achieves this by using muscles attached to the shaft of the feather to 'lock down' the feathers to create a water-tight barrier. In addition, the feather rachis is flattened dorso-ventrally allowing it to bend and conform to the body shape readily with increasing water pressure." (Dawson et al. 1999:199)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
  • Dawson C; Vincent JFV; Jeronimides G; Rice G; Forshaw P. 1999. Heat transfer through penguin feathers. Journal of Theoretical Biology. 199: 291-295.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pygoscelis papua

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGGTGATTATTCTCAACTAACCACAAAGATATCGGCACCCTCTACCTAATTCTTGGCGCATGAGCGGGCATAGCCGGAACCGCTCTCAGCCTACTCATTCGCGCAGAGCTTGGCCAGCCCGGAACTCTCCTAGGAGATGACCAAATTTACAACGTAATCGTCACTGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGATCGGAGGATTCGGAAACTGACTAGTACCACTTATAATTGGTGCCCCCGATATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTACTCCTACTAGCCTCATCCACAGTAGAAGCAGGAGCTGGCACAGGATGAACTGTGTACCCACCACTAGCAGGTAATCTAGCCCATGCCGGTGCTTCAGTAGATCTAGCTATCTTCTCCCTCCACCTAGCAGGGGTCTCTTCCATCCTAGGAGCCATCAACTTTATCACCACCGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACTCCCCTATTTGTGTGATCCGTCCTTATCACAGCTGTCCTCCTACTACTATCGCTCCCTGTACTCGCTGCTGGCATCACCATACTACTAACCGACCGAAACCTAAACACCACCTTTTTTGACCCTGCCGGAGGAGGAGACCCAGTCCTATACCAACACCTTTTCTGATTCTTCGGTCACCCAGAAGTCTATATCCTAATCCTTCCAGGTTTCGGAATTATCTCCCACGTAGTAACATACTATGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGGTTCCTTGGCTTCATCGTGTGGGCCCACCACATATTCACAGTCGGAATAGACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pygoscelis papua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s
Croxall, J.

Justification
This species qualifies as Near Threatened because, while some populations have apparently increased, rapid declines in some key populations are suspected to be driving a moderately rapid global population decline.

History
  • 2008
    Near Threatened
  • 2004
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The worldwide gentoo penguin population is stable with around 628,000 individuals. Some of these colonies are increasing moderately while others are declining rapidly. The constant, and sometimes drastic, changes in population size has gentoos listed as "Near Threatened" on the IUCN Red List. There are currently no conservation efforts in action, although some proposals suggest extending long-term observations on breeding colonies to limit disturbances of nesting sites. Protected areas have been set up in gentoo breeding grounds, including those on MacQuarie Island and Heard Island.

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total (minimum) population has been estimated at 314,000 pairs (Woehler, 1993).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threats include disturbance by humans, local pollution, and potential interactions with fisheries5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although not globally threatened with extinction, some gentoo penguin colonies have declined (1). While those on the Antarctic Peninsula appear to be increasing overall, populations on sub-Antarctic islands may have decreased considerably (1). For example, populations on Bird Island (South Georgia) have decreased by around 67 percent since 1980 (1). In the past, some colonies were affected by the collection of eggs for human consumption and the hunting of adults for their oil (2). Today, possible reasons behind population declines include local pollution, interaction with fisheries, and disturbance by humans (1); colonies on Kerguelen Island and Possession Island are said to have been disturbed by the presence of scientific bases (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
None known.

Conservation Actions Proposed
Continue/extend long-term monitoring of breeding colonies. Prevent disturbance to breeding colonies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The gentoo penguin breeds in a number of protected areas, including MacQuarie Island and Heard Island, which are both Natural World Heritage Sites (7), and Prince Edward Islands Special Nature Reserve (8). To prevent the charming gentoo becoming threatened with extinction, the global bird conservation organization BirdLife International have recommended that efforts need to be made to avoid any disturbance of breeding colonies, and that colonies should be subject to long-term monitoring (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Pygoscelis papau on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Penguins have been hunted for their blubber, which can be purified to oil and used for fuel. Hundreds of thousands of penguins were killed for their blubber, with some breeding colonies becoming obsolete. Gentoo skins are also collected and used to make caps, clothes, slippers, and purses. In the late 1980's, egg collecting was popular by sailors and by locals. These eggs also were consumed in large quantities.

Positive Impacts: body parts are source of valuable material

  • Johnson, S. 1981. Penguins. Minneapolis, MN: Lerner Publications Co..
  • Peterson, R. 1979. Penguins. Boston: Houghton Mifflin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Near Threatened
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gentoo Penguin

The long-tailed Gentoo penguin (pron.: /ˈɛnt/ JEN-too), Pygoscelis papua, is a penguin species in the genus Pygoscelis, most closely associated with the Adélie penguin (P. adeliae) and the Chinstrap penguin (P. antarcticus). The first scientific description was made in 1781 by Johann Reinhold Forster on the basis of Falkland Islands. They call in a variety of ways, but the most frequently heard is a loud trumpeting which is emitted with its head thrown back.[2]

The application of Gentoo to the penguin is unclear. The Oxford English Dictionary notes that Gentoo used to be an Anglo-Indian term used as early as 1638 to distinguish Hindus in India from Muslims. The English term originated from the Portuguese gentio (compare "gentile"); in the 20th century the term came to be regarded as derogatory.[citation needed]

Contents

Taxonomy [edit]

The Gentoo penguin is one of three species in the genus Pygoscelis. Mitochondrial and nuclear DNA evidence suggests the genus split from other penguins around 38 million years ago, about 2 million years after the ancestors of the genus Aptenodytes. In turn, the Adelie Penguins split off from the other members of the genus around 19 million years ago, and the Chinstrap and Gentoo finally diverging around 14 million years ago.[3]

Two sub-species of this penguin are recognised: Pygoscelis papua papua and the smaller Pygoscelis papua ellsworthii'

Description [edit]

Saunders Island, Falkland Islands.

The gentoo penguin is easily recognized by the wide white stripe extending like a bonnet across the top of its head and its bright orange-red bill. They have pale whitish-pink webbed feet and a fairly long tail - the most prominent tail of all penguins. Chicks have grey backs with white fronts. As the Gentoo penguin waddles along on land, its tail sticks out behind, sweeping from side to side, hence the scientific name Pygoscelis, which means "rump-tailed".[4]

Adult Gentoos reach a height of 51 to 90 cm (20–36 in),[5][6] making them the third largest species of penguin after the two giant species, the Emperor Penguin and the King Penguin. Males have a maximum weight of about 8.5 kg (19 lb) just before molting, and a minimum weight of about 4.9 kg (10.8 lb) just before mating. For females the maximum weight is 8.2 kg (18 lb) just before moulting, but their weight drops to as little as 4.5 kg (10 lb) when guarding the chicks in the nest.[7] Birds from the north are on average 700 g (1.5 lb) heavier and 10 cm (4 in) taller than the southern birds. Southern Gentoo penguins reach 75–80 cm (30–31 in) in length.[8] They are the fastest underwater swimming penguins, reaching speeds of 36 km/h.[9] Gentoo are adapted to very harsh cold climates.

Breeding [edit]

A family on Wiencke Island, Palmer Archipelago, off the coast of the Antarctic Peninsula.

The breeding colonies of gentoo penguins are located on ice-free surface. Colonies can be directly dependent on the shoreline but are also considerably located inland. They prefer shallow coastal areas and often nest between tufts of grass. In South Georgia, for example, breeding colonies are two kilometres inland. Whereas in colonies farther inland, where the penguins nest between tufts of grass, they shift location slightly every year because the grass may get trampled over time.

Gentoos breed on many sub-Antarctic islands. The main colonies are on the Falkland Islands, South Georgia and Kerguelen Islands; smaller populations are found on Macquarie Island, Heard Islands, South Shetland Islands and the Antarctic Peninsula. The total breeding population is estimated to be over 300,000 pairs. Nests are usually made from a roughly circular pile of stones and can be quite large, 20 cm high and 25 cm in diameter. The stones are jealously guarded and their ownership can be the subject of noisy disputes between individual penguins. They are also prized by the females, even to the point that a male penguin can obtain the favors of a female by offering her a nice stone.

Two eggs are laid, both weighing around 500 g. The parents share incubation, changing duty daily. The eggs hatch after 34 to 36 days. The chicks remain in the nests for about 30 days before forming creches. The chicks molt into sub-adult plumage and go out to sea at about 80 to 100 days.

Diet [edit]

Gentoos live mainly on crustaceans such as krill, with fish making up only about 15% of the diet. However, they are opportunistic feeders, and around the Falklands are known to take roughly equal proportions of fish (Patagonotothen sp., Thysanopsetta naresi, Micromesistius australis), crustaceans (Munida gregaria) and squid (Loligo gahi, Gonatus antarcticus, Moroteuthis ingens).

Threats [edit]

Brown Skua snatches Gentoo Penguin Chick At Godthul, South Georgia

In the water, sea lions, leopard seals, and orca are all predators of the Gentoo. On land there are no predators of full grown Gentoos. Skua can steal their eggs; however, some other seabirds have managed to snatch their young.

Conservation status [edit]

The IUCN Red List lists the gentoo as "near threatened", due to a rapid decline in some key populations which is believed to be driving a moderate overall decline in the species population. Examples include the population at Bird Island, South Georgia, where the population fell by two thirds in 25 years.[10]

Gallery [edit]

Cultural references [edit]

References [edit]

This article incorporates text from the ARKive fact-file "Gentoo Penguin" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!