Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Black-headed gulls are not fussy eaters. They like everything, from worms to bird eggs to fish. Furthermore, they also profit from all kinds of human sources of rubbish such as garbage barrels. Not all black-headed gulls earn their meal in an honest way. They steal worms from shorebirds and fish from terns. Nor are people always safe. Should your ice cream or french fries fall on the ground, it quickly disappears in the beak of these master thieves. You find black-headed gulls almost everywhere. They are a common shorebird, land-bird and city-bird.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

These gregarious birds are usually seen in flocks or small groups (3). They feed on worms, other soil invertebrates, scraps, rubbish, carrion and fish (3) (5). During winter, black-headed gulls roost on open water, typically fresh water, although they may occasionally make use of sheltered estuaries (5). These gulls nest in colonies, within which pairs defend small territories. They will defend these territories from other birds using ritualised displays (7). Two to three eggs are produced which are incubated for up to 26 days. After a further 35 days the chicks will have fledged (3). Black-headed gulls are fairly long lived, with a maximum recorded life-span of 32 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The common name of this species is inaccurate, as adult black-headed gulls have a chocolate-brown head in summer (5). In winter, this brown hood retreats and the birds have a largely white head with a dark spot behind the eye (5). Other distinguishing features include the prominent white leading edge of the upper wing, which is visible from a fair distance, the tern-like slender wings and the reddish coloured bill and legs (2). Juveniles are different in appearance to adults; they have ginger-brown coloured upperparts and a yellowish bill with a black tip (2). This is a noisy species during the breeding season, producing a loud kwarr call and a short kwup (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 34-37 cm, envergure 100-110 cm, poids 200-400 g.

La Mouette rieuse s’installe toujours près d’eaux calmes ou stagnantes, le plus souvent des lacs, gravières, canaux, rivières lentes ou estuaires. En dehors de la saison de reproduction, elle fréquente les eaux intertidales, évitant les côtes rocheuses ou trop exposées, et de plus en plus les sites intérieurs tels que les réservoirs, les décharges et les parcs urbains.

Elle se nourrit surtout d’animaux, en particulier d’insectes et de vers de terre, mais complète fréquemment son alimentation avec des végétaux et des déchets ménagers ou industriels. Elle peut être kleptoparasite et charognarde. Les méthodes et le régime varient fortement selon les localités, la saison, la disponibilité des ressources et l’apprentissage individuel. La recherche se fait en marchant, nageant ou volant à différentes hauteurs selon le type d’aliment voulu.

L’espèce est grégaire tout au long de l’année, les colonies comme les dortoirs hivernaux pouvant compter plusieurs milliers d’oiseaux. Elle est monogame et les mêmes partenaires sexuels renouvellent parfois leur association d’une année sur l’autre, mais les cas sont rares.

Le nid est fait à même le sol ou dans la végétation basse, plus rarement dans la végétation aquatique, sur des bâtiments ou des arbustes bas. C’est une simple dépression recouverte d’éléments végétaux. La ponte de 2 ou 3 œufs (rarement 1 ou 4) débute en avril. L’incubation dure 23 à 26 jours et les jeunes sont volants à l’âge de 35 jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: Iceland, Faroe Islands, Eurasia, southeastern Canada, northeastern U.S. European population expanded northward since the mid-1800s, probably due to amelioration of climate, increase in food supply resulting from human activities, and reduced persecution (Nikula 1993). Increasing numbers occurred in the 1900s in southeastern Canada and the northeastern U.S., where nesting has occurred in several areas (Labrador to Maine and Massachusetts) beginning in the 1970s; U.S. nestings have been unsuccessful and population expansion does not seem to be on-going (Nikula 1993). See also Brown and Nettleship (1984). NON-BREEDING: in North America along Atlantic coast from Labrador, Newfoundland, New Brunswick, and Nova Scotia south to New York (Long Island), rarely farther south and west, and in Old World. In North America, the largest numbers occur in the St. John's/Conception Bay area, Newfoundland, where a peak of a couple hundred occurs in November, and in Nova Scotia around the Sydney/Glace Bay area and around Halifax (Nikula 1993). Casual in Hawaii, Puerto Rico, and along Pacific coast of North America. Regular in spring in Aleutian and Pribilof Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Labrador to North Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Black-headed Gull breeds in north-east North America and across much of Europe and Asia, excluding the north of each continent (northern Scandinavia and north Russia), and south Asia. Some populations in North America and the milder areas of Europe are resident, with the remaining populations wintering to the south over a large range, encompassing much of the southern coast of Asia and Europe, and the central and northern coast of Africa (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

N Palearctic; winters to Africa, s Asia and e North America.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The breeding range of Larus ridibundus is very broad, extending from the southern tip of Greenland and all of Iceland down through the majority of Europe and Central Asia. The Kamchatka Peninsula forms this species' eastern range; Ussuriland in Russia and Heilongjiang in northeast China lie at the extreme southeastern part of this range. Larus ridibundus is uncommon in northeastern North America.

The northern population of this species is migratory. Birds residing at lower latitudes, however, tend to be non-migratory. Most birds in the western Palearctic breed in central and north European wetlands and migrate to their winter grounds in the Mediterranean basin. Birds that breed in Scandinavia migrate to the Brittish Isles, and the majority migrate farther, flying along the Atlantic Coast to West Africa. Birds from Central Asia migrate south to India, Malaysia, and Philippines. North Africa, particularly Egypt, is a common destination for L. ridibundus (Howard and Moore, 1991; Cantos et al., 1994).

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native )

  • Cantos, F., A. Alonso-Gomez, M. Delgado. 1994. Seasonal changes in fat and protein reserves of the black-headed gull, Larus ridibundus, in relation to migration. Comparative Biochemical Physiology, Vol. 108A, No. 1: 117-122.
  • Howard, R., A. Moore. 1991. A Complete Checklist of the Birds of the World. Second edition.. London, San Diego: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This gull is widespread in Britain, in inland areas as well as by the coast (5). It is particularly common at inland sites in north England, Scotland and Wales (3). In winter the British population is augmented by birds from continental Europe (5). This gull has a wide global breeding range that extends through the Palaearctic (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution:


    S Greenland and Iceland through most of Europe and C Asia to Kamchatka, extreme SE Russia (Ussuriland) and NE China (Heilongjiang); marginal in NE North America. Winters S to W & E Africa, India, Malaysia and Philippines.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

In accordance with its common name, L. ridibundus is distinguished by its dark brown or grayish-black frontal hood. Its eye crescents (primarily behind the eye), neck, and underparts are all white as is the tail. The upper wing coverts, secondaries, inner primaries, and back are gray. The secondaries are tipped with white; the white outer primaries have black tips and edges. Other identifying characteristics of L. ridibundus include its red legs and bill, and dark brown eyes. Non-breeding adults have a white head, with only some blackish coloring on their nape. Juvenile birds are recognized by the beige to darker brown markings on their back and upper wing coverts. Also, they have a black terminal tail band. The species is sexually monomorphic. Larus ridibundus ranges from 37 to 43 cm in length and has a wingspan from 94 to 110 cm (Howard and Moore, 1991).

Range mass: 195 to 325 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 41 cm

Weight: 284 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 38-43 cm, Wingspan: 91-94 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 34-43 cm. Plumage: back and wings pale grey; rump and tail white; head white with black smudge behind ear; below white; breeding adult with black hood; spread wing shows white leading edge forming wedge at shoulder with white outer primaries; trailing edge white except outer primaries which are tipped black. Immature shows more brown in wings than adult and has a blackish band at tip of tail . Bare parts: iris dark brown or red-brown; bill red, orange-red with black tip in immature; feet and legs red, dull orange in immature. Habitat: coastal and inland waters. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: ALL SEASONS: Lakes, rivers, bogs, moors, grasslands, swamps, and coastal marshes. NON-BREEDING: seacoasts, estuaries, and bays (AOU 1983). In Europe, also city parks and agricultural fields (Nikula 1993). Strongly attracted to sewer outfalls (Nikula 1993). BREEDING: Nests usually on ground along seacoast, coastal islands, or in freshwater marshes (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Northern breeding populations of this species are strongly migratory although populations at lower latitudes tend to be sedentary or locally dispersive (del Hoyo et al. 1996). The species breeds between April and May (del Hoyo et al. 1996) in dense colonies of up to several thousand pairs (del Hoyo et al. 1996, Snow and Perrins 1998) often with other gull or tern species (Flint et al. 1984). It generally remains gregarious throughout the year (Snow and Perrins 1998) and may roost in large flocks during the winter (Richards 1990). Habitat Breeding The species chiefly breeds inland and shows a preference for shallow, calm (Snow and Perrins 1998), temporarily flooded wetland habitats (del Hoyo et al. 1996) with lush vegetation (Flint et al. 1984, del Hoyo et al. 1996). It forms nesting colonies on the margins of lakes (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996), lagoons (Flint et al. 1984, Snow and Perrins 1998), slow-flowing rivers, deltas, estuaries (Snow and Perrins 1998) and on tussocky marshes (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996), but may also nest on the upper zones of saltmarshes (del Hoyo et al. 1996, Snow and Perrins 1998), coastal dunes and offshore islands in more coastal areas (del Hoyo et al. 1996). The species will also utilise artificial sites such as sewage ponds, gravel- and clay-pits, ponds, canals and floodlands (Snow and Perrins 1998) and may nest on the dry ground of heather moors, sand-dunes, beaches (del Hoyo et al. 1996, Snow and Perrins 1998) and stony islets (Snow and Perrins 1998). Non-breeding During the winter the species is most common in coastal habitats (del Hoyo et al. 1996) and tidal inshore waters, showing a preference for inlets or estuaries with sandy or muddy beaches, and generally avoiding rocky or exposed coastlines (Snow and Perrins 1998). It may also occur inland during this season, frequenting ploughed fields, moist grasslands, urban parks, sewage farms, refuse tips, reservoirs, ponds and ornamental waters (Snow and Perrins 1998), and roosts on sandy and gravel sites or on inland reservoirs (Richards 1990). Diet Its diet consists predominantly of aquatic and terrestrial insects, earthworms and marine invertebrates (e.g. molluscs, crustaceans and marine worms) (del Hoyo et al. 1996) although it may also take fish (del Hoyo et al. 1996) (usually dead or sick) (Flint et al. 1984), rodents (e.g. voles) (Flint et al. 1984) and agricultural grain (del Hoyo et al. 1996). During the non-breeding season the species may rely heavily on artificial food sources provided by man, especially in Western Europe (del Hoyo et al. 1996), and often scavenges from refuse tips during this period (Richards 1990). Breeding site The nest is a rough construction of vegetation (Richards 1990) based on a shallow scrape (Snow and Perrins 1998) and placed on a floating mat, in broken reeds, on a hummock, or sometimes on dry, grassy or sandy ground (Flint et al. 1984, del Hoyo et al. 1996). The species shows a strong preference for nesting near vegetation (although vegetation overgrowth can lead to the desertion of colony sites) (del Hoyo et al. 1996). It usually nests in dense colonies with neighbouring nests placed an average of 1 m apart (del Hoyo et al. 1996).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Larus ridibundus inhabits the temperate zone to the rim of the Palearctic boreal forests. It is found mostly at low attitudes and in or around placid, shallow coastal or inland water bodies, including rivers and their estuaries. In some areas, such as Scandinavia, it has adapted to settle in salt marshes, clay pits, and coastal dunes and offshore islands. The distribution of this highly adaptable species has increased to encompass areas near canals or sewage treatment facilities (Howard and Moore, 1991; Cantos et al., 1994).

Habitat Regions: temperate ; terrestrial

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2859 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1045 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 1.627 - 13.837
  Nitrate (umol/L): 1.206 - 16.868
  Salinity (PPS): 6.218 - 35.485
  Oxygen (ml/l): 5.914 - 8.325
  Phosphate (umol/l): 0.231 - 0.890
  Silicate (umol/l): 0.987 - 12.889

Graphical representation

Temperature range (°C): 1.627 - 13.837

Nitrate (umol/L): 1.206 - 16.868

Salinity (PPS): 6.218 - 35.485

Oxygen (ml/l): 5.914 - 8.325

Phosphate (umol/l): 0.231 - 0.890

Silicate (umol/l): 0.987 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal waters, protected bays, estuaries. Range: Europe and Asia, coast of Northern Africa. East coast of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In winter, found in a wide range of habitats including coastal marshes, farmland, rubbish tips, urban parks, gardens and playing fields (5). Usual breeding habitats include marshes, ponds, lakes, bogs, gravel pits and dry sites next to water bodies, such as sand-dunes and moorland (4) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Some may spend summer in winter range along east coast (Terres 1980). Often returns to same wintering locale in successive years (Nikula 19930.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Winters in warmer parts of range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Highly opportunistic. Hawks for insects, searches muddy places for worms, plunges and dips into water for food, eats weed seeds and waste grain in fields, grasslands, and marshes, scavenges in harbors or mudflats where sewage discharged (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Aquatic and terrestrial insects, earthworms, and marine invertebrates compose the bulk of L. ridibundus diet. This species also feeds on fish and grains, although to a lesser extent. Studies have shown that adults store greater nutrient reserves (fat and protein depots) not only for migration, but for reproductive activity as well.

This species forages by swimming and snatching food from the water surface, or by submerging its head under the water surface. These birds forage along coastal areas. Adults have more efficient foraging skills than do immature birds. Due to this inefficiency, immature birds feed in areas separate from the adult sites. Immature birds also display greater aggression, often winning fights over food. Interestingly, they are also more brazen in approaching humans, thus gaining a better chance to secure food.

The gulls are also kleptoparasitic on occasion, meaning that they steal food that has already been caught by a member of the same or different species. For example, in the Netherlands, sandwich terns (Sterna sandvicensis) nearly always stake their breeding ground in close proximity to colonies of L. ridibundus. In this arrangement, the gulls help protect the terns by driving out both avian and ground predators. The gulls, though, are major predators of tern eggs and chicks, and steal fish that tern parents have procured for their chicks. Larus ridibundus prefers to eat tern chicks up to two weeks old. Several scientists have suggested that kleptoparasitism occurs more often when other food sources are scarce.

Larus ridibundus displays high flexibility in diet. In western Europe, for instance, it has come to rely on human trash as an artificial food source. Researchers have attributed the significant increase in distribution of L. ridibundus to this influx of readily available food (Howard and Moore, 1991; Cantos et al., 1994; Stienen and Brenninkmeijer, 1999; Nuyts et al., 1996).

Animal Foods: birds; fish; eggs

Primary Diet: carnivore (Piscivore )

  • Stienen, E., A. Brenninkmeijer. 1999. Keep the chicks moving: how Sandwich terns can minimize kleptoparasitism by black-headed gulls. Animal Behaviour, 57: 1135-1144.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Insects, earthworms, marine worms, mollusks, crustaceans, small fish, carrion, seeds and small fruits.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish and water insect.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
fluke of Diplostomum gasterostei endoparasitises Larus ridibundus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Larus ridibundus (Larus ridibundis black headed full) preys on:
Sprattus sprattus
Clupea harengus
Platichthys flesus
Crangon crangon
Nereis diversicolor
Neomysis integer
Corophium volutator
Gammarus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Larus ridibundus (Larus ridibundis black headed full) is prey of:
Cryptocotyle lingua
Himasthla elongata
Renicola roscorita
Psilostomum brevicolle
Maritrema gratiosum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In North America, often associates with flocks of migrant and wintering Bonaparte's gulls or other gulls (Nikula 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
218 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 63 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of 3 eggs. Incubation reportedly 20-24 or 23-26 days. Young first fly at about 35-40 days. One banded bird lived over 32 years. Usually nests in large colonies in Eurasian range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on the mating system of these animals is not available.

After returning to its colonies between late February and late March, L. ridibundus lays its eggs in late April and May. Females lay from one to three eggs and incubate them for 22 to 26 days. Larus ridibundus is strongly inclined to nest near vegetation. At the very beginning of the breeding season, male L. ridibundus congregate in larges areas close to the nesting colony before females arrive. In these areas, termed "clubs," each bird is semi-territorial in that it does not stay in one particular area for a considerable amount of time. A male first regards visiting females as a threat, showing his aggressive oblique display and making long calls. In response, the female extends her neck upward and faces away, a display that makes her sex and potential as a mate known. The male then mitigates his response. The mating process continues when females keep coming back to a selected male, staying with him for progressively longer periods of time. The potential pair exchanges mutual displays. Their courtship culminates in the male regurgitating food for the female, an act followed by copulation.

As soon the pair of L. ridibundus settle into their colony area, they become territorial and defend their area against intruders (primarily conspecifics). They clearly mark their pairing territories, which range in size from 9 to 11 square meters. Their territorial boundaries are subject to slight changes as dictated by daily disputes with neighbors or intruders.

Colonies of L. ridibundus are made up of 11 to 100 breeding pairs; however, a few colonies reach numbers greater than 10,000 birds. These colonies are loosely divided: a breeding bird will eventually become accustomed to its neighbors, but will become very aggressive towards birds that it cannot recognize.

Research has shown that L. ridibundus is a philopatric species in which individuals are inclined to return to breed in the subcolony in which they were born. This tendency is especially evident within a large colony located in a relatively unstable habitat. Philopatry encourages the establishment of kin groups and eventually heightened cooperation among neighbors (Howard and Moore, 1991; Moynihan, 1955; Prevot-Julliard et al., 1998; Gill, 1995).

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average time to hatching: 22 days.

Average eggs per season: 3.

  • Gill, F. 1995. Ornithology. Second edition.. W.H. Freeman and Company.
  • Howard, R., A. Moore. 1991. A Complete Checklist of the Birds of the World. Second edition.. London, San Diego: Academic Press.
  • Moynihan, M. 1955. Some Aspects of Reproductive Behavior in the Black-headed Gull (Larus ridibundus L.)and Related Species. Leiden, The Netherlands: E.J. Brill.
  • Prevot-Julliard, A., R. Pradel, J. Lebreton, F. Cezilly. 1998. Evidence for birth-site tenacity in breeding Common Black-headed Gulls, Larus ridibundus. Canadian Journal of Zoology, 76: 2295-2298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting occurs mostly in colonies, sometimes as isolated pairs. Nest is built by both sexes in vegetation on the ground. 2-3 eggs incubated by both sexes for 23-26 days. Young are fed by both parents. Capable of first flights at around 5 weeks old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Larus ridibundus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAAGACATGGGCACCCTATATTTAATCTTCGGCGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTTATTCGTGCAGAACTTGGCCAACCCGGAACCCTCCTAGGGGACGACCAAATCTATAACGTAATTGTCACCGCCCACGCCTTCGTGATAATCTTCTTCATAGTAATACCAATCATGATCGGCGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCCGACATAGCATTTCCACGTATAAACAACATAAGCTTCTGACTACTACCCCCATCATTCTTACTCCTCCTAGCCTCTTCCACAGTAGAAGCCGGAGCCGGTACAGGGTGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCCCATGCTGGAGCTTCAGTAGACCTAGCAATCTTCTCCCTTCACTTAGCAGGTGTATCCTCCATTCTAGGTGCTATTAACTTTATCACTACAGCCATCAACATAAAACCTCCCGCTCTCTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATTACTGCCGTACTATTACTACTCTCACTTCCAGTGCTTGCTGCAGGCATCACTATACTACTTACAGACCGAAACCTAAACACAACATTCTTCGATCCCGCCGGAGGCGGTGACCCTGTACTGTATCAACACCTCTTCTGATTTTTTGGCCACCCAGAAGTATATATCCTAATCCTACCAGGATTTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Larus ridibundus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3B,N4N : N3B: Vulnerable - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N3N - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Larus ridibundus is not globally threatened, with a population approximated at two million pairs or perhaps more. As many as 1,500,000 to 1,800,000 have been estimated in Western Europe alone. From 1950 to 1980, this species underwent an impressive increase in numbers and subsequent increase in distribution (Howard and Moore, 1991).

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Green List (low conservation concern) (3). Receives general protection in Great Britain under the Wildlife and Countryside Act (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.4,800,000-8,900,000 individuals (Wetlands International 2006), while national population estimates include: > c.1,000 individuals on migration and > c.1,000 wintering individuals in China; c.1,000-10,000 individuals on migration and > c.1,000 wintering individuals in Taiwan; > c.1,000 individuals on migration and > c.1,000 wintering individuals in Korea; < c.10,000 individuals on migration and c.1,000-10,000 wintering individuals in Japan and c.10,000-1 million breeding pairs and > c.1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is susceptible to avian influenza (Melville and Shortridge 2006) and avian botulism so may be threatened by future outbreaks of these diseases (Hubalek et al. 2005). It may also be threatened by future coastal oil spills (Gorski et al. 1977) and has suffered local population declines in the past as a result of egg collecting (del Hoyo et al. 1996). In some areas of its breeding range the species may also suffer from reduced reproductive successes due to contamination with chemical pollutants (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black-headed gull

The black-headed gull (Chroicocephalus ridibundus) is a small gull which breeds in much of Europe and Asia, and also in coastal eastern Canada. Most of the population is migratory, wintering further south, but some birds in the milder westernmost areas of Europe are resident. Some birds will also spend the winter in northeastern North America, where it was formerly known as the common black-headed gull. As is the case with many gulls, it had previously been placed in the genus Larus.

Description[edit]

This gull is 38–44 cm (15-17½ in) long with a 94–105 cm (37–41 in) wingspan. In flight, the white leading edge to the wing is a good field mark. The summer adult has a chocolate-brown head (not black, although does look black from a distance), pale grey body, black tips to the primary wing feathers, and red bill and legs. The hood is lost in winter, leaving just 2 dark spots. It breeds in colonies in large reedbeds or marshes, or on islands in lakes, nesting on the ground. Like most gulls, it is highly gregarious in winter, both when feeding or in evening roosts. It is not a pelagic species and is rarely seen at sea far from coasts.

The black-headed gull is a bold and opportunistic feeder and will eat insects, fish, seeds, worms, scraps and carrion in towns, or take invertebrates in ploughed fields with equal relish. This is a noisy species, especially in colonies, with a familiar "kree-ar" call. Its scientific name means "laughing gull".

This species takes two years to reach maturity. First-year birds have a black terminal tail band, more dark areas in the wings, and, in summer, a less fully developed dark hood. Like most gulls, black-headed gulls are long-lived birds, with a maximum age of at least 32.9 years recorded in the wild, in addition to an anecdote now regarded to be of dubious authenticity regarding a 63-year old bird.[2]

In popular culture[edit]

Uses[edit]

The eggs of the black-headed gull are considered a delicacy by some in the UK and are eaten hard boiled.[3][4]

Australian discovery[edit]

In the 1990s, local Broome birder Brian Kane saw a strange species of bird while trawling the local sewer ponds. Upon seeing this bird, he called one of his many bird-watcher friends to verify the species, who confirmed that it was indeed a black-headed gull that Brian had stumbled across. This was the first recorded sighting of the species in Australia.[5][6]

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Larus ridibundus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Longevity, ageing, and life history of Chroicocephalus ridibundus". The Animal Ageing and Longevity Database. Retrieved 7 November 2012. 
  3. ^ Copping, Jasper (28 March 2009). "Top restaurants face shortage of seagull eggs". The Daily Telegraph (London). 
  4. ^ Conservation (Natural Habitats&c
  5. ^ Kane, Brian (31 January 2002). "Notes on the Black-headed Gull Larus ridibundus at the Broome Sewage Ponds". Notes on the Black-headed Gull Larus ridibundus at the Broome Sewage Ponds (Broome). 
  6. ^ [1]
  • Harrison P. Seabirds of the World. Princeton University Press, Princeton (NJ), 1987 ISBN 0-691-01551-1
  • Dunn JL, Alderfer J. National Geographic Field Guide to the Birds of North America National Geographic Society 2006 ISBN 0-7922-6877-6
  • Pons J.M., Hassanin, A., and Crochet P.A.(2005). Phylogenetic relationships within the Laridae (Charadriiformes: Aves) inferred from mitochondrial markers. Molecular phylogenetics and evolution 37(3):686-699
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in Larus but separated on the basis of genetic data (Pons et al., 2005) that indicate that the genus would be paraphyletic if the following species were included: C. philadelphia, C. cirrocephalus, and C. ridibundus (AOU, 2008). Considered conspecific with with South American L. maculipennis by some authors. Regarded as monotypic by most authorities. See Nikula (1993) for information on hybridization with other gull species. Formerly named "common black-headed gull" (AOU, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!