Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Biology

During winter, common gulls feed mainly on earthworms; they are often attracted to recently ploughed fields for this reason (7). At other times of the year they will also feeds on insects, fish, small mammals, carrion and rubbish (3) (6). They are often attracted to rubbish dumps in harsh winter weather (6).  The nest is built on the ground, on boulders, in low trees or on buildings, typically near water (2). Occasionally common gulls nest in groups with herring gulls, but they may also nest alone (6). Pairs produce between two and five eggs, which are incubated for up to 28 days. The chicks are fully fledged after a further 35 days (3). These gulls are relatively long-lived, with the maximum recorded life-span being 24 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The name 'common gull' is rather misleading, as this gull is not all that common (5). It is generally similar in appearance to the herring gull (Larus argentatus) but is smaller, and has a smaller, thinner bill, a more rounded head and more active flight (2). The upperwings are pale grey in colour and have black tips featuring white spots known as 'mirrors' (6). The white head develops grey streaks in winter and the legs and bill are greenish-yellow. Juveniles are greyish brown with brown upperparts (2). The calls produced by common gulls are higher pitched than those of herring gulls; a 'ke ke ke ke kleeeh-a' call is said to resemble laughter (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Larus canus, the Mew Gull, has a range that spans throughout the Northern Hemisphere. It is found in Europe, Asia, North Africa and North America. (Bent, 1963; Felix, 1998)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oceanic islands (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Mew Gull breeds in northern Europe, northern Asia and north-west North America. Most populations, except those in Iceland, around the North and Baltic Sea, and some off the coast of Canada migrate south. This expands its range to include the Pacific coast of North America down to Baja California (Mexico), the Pacific coast of Asia down to northern Vietnam, the Atlantic coasts of France and Portugal, the southern and eastern coasts of the Mediterranean, the entire coasts of the Black Sea and Persian Gulf, and the south coast of the Caspian Sea (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: in North America from northern Alaska south along coast to British Columbia and in the interior, northeastern Saskatchewan, western Mackenzie, west into northeastern Alberta and southern Yukon. In Eurasia from Faroe Islands, British Isles, Scandinavia, northern Russia, and northern Siberia south to northern Europe, Black and Caspian Seas, Lake Baikal, northern Mongolia, Anadyrland, Sea of Okhotsk, Kamchatka, and Kurile Islands. NON-BREEDING: in North America mainly from southeastern Alaska south along Pacific coast to northern Baja California. In Old World from breeding range south to Mediterranean, northern Africa, Iraq, Persian Gulf, Afghanistan, Southeast Asia, coastal China, and Japan (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The common gull has a wide distribution, breeding throughout temperate and sub-Arctic parts of Eurasia. Two subspecies occur in Europe, the 'nominate' race L. c. canus is the subspecies occurring in Britain, extending through north-west Europe and reaching the White Sea in Russia. There is also a subspecies that occurs in North America (4). In Britain, this species breeds mainly in Scotland (4). In winter it is becomes more common in the rest of Britain, occurring inland and around the coast (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Mew gulls have an average length of 40 cm (1.3 ft.), with slender, yellowish-green legs and webbed feet. Male and Female gulls have a similar appearance, although males usually are a bit larger. They have gray wings and back with a plain white head and a greenish-yellow bill. The wingspan is usually around 119 to 122 cm (47 to 48 in.). Young gulls plummage is brown and spotted with tan; their beak is dark with a pink undertone. They will not develop adult coloration until about 27 months. (Felix, 1998; Del Hoya, 1996)

Range mass: 290 to 552 g.

Average mass: 432 g.

Range length: 40 to 46 cm.

Range wingspan: 119 to 122 cm.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 2.257 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 41 cm

Weight: 432 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mew gulls flourish in and along coastal ranges, tidal estuaries, interior lakes and marshy grasslands. (Bent, 1963)

Habitat Regions: saltwater or marine ; freshwater

Wetlands: marsh ; swamp ; bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1996). It breeds from May onwards in solitary pairs or in single- and mixed-species colonies of up to 300 pairs (Flint et al. 1984, del Hoyo et al. 1996) or more (e.g. 1,000 pairs in Baltic region (Snow and Perrins 1998)). Outside of the breeding season the species remains gregarious, foraging in flocks of up to one hundred or more individuals during the winter, flock sizes depending upon the habitat and conditions (Snow and Perrins 1998). Habitat Breeding The species breeds along the coast (Richards 1990, del Hoyo et al. 1996, Snow and Perrins 1998) and inland (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996, Snow and Perrins 1998) in a variety of sites not necessarily close to wetlands (del Hoyo et al. 1996). On the coast it nests on grassy and rocky cliff-ledges (del Hoyo et al. 1996, Snow and Perrins 1998), grassy slopes (Richards 1990, Snow and Perrins 1998), inshore rocky islets, islands and stacks (Richards 1990, del Hoyo et al. 1996, Snow and Perrins 1998), and on sand and shingle beaches, banks and dunes (del Hoyo et al. 1996, Snow and Perrins 1998) amongst tide-wrack or flood debris (Snow and Perrins 1998). Inland the species nests on small islands in freshwater and saline lakes (Flint et al. 1984), shingle bars or small islets in streams or rivers (Richards 1990), islets, artificial structures and shores of artificial waterbodies with short, sparse vegetation (Skorka et al. 2006), and on bogs (del Hoyo et al. 1996, Snow and Perrins 1998), marshes (del Hoyo et al. 1996), meadows (del Hoyo et al. 1996) and grass or heather moorland near small pools (Richards 1990, Snow and Perrins 1998) or lakes (Snow and Perrins 1998). After the young fledge the species often disperses to coasts, tidal estuaries, agricultural land and reservoirs (del Hoyo et al. 1996, Snow and Perrins 1998). Non-breeding Outside of the breeding season it occupies similar habitats to when it is breeding, although it may occur more frequently along the coast during this period (Snow and Perrins 1998) on estuaries with low salinities, sandy beaches and estuarine mudflats (Bukacinski and Bukacinska 2003). Diet Its diet consists of earthworms, insects, aquatic and terrestrial invertebrates (del Hoyo et al. 1996) (e.g. planktonic crustaceans (del Hoyo et al. 1996), crayfish and molluscs (Flint et al. 1984)) and small fish (del Hoyo et al. 1996). During the spring the species will also take agricultural grain (del Hoyo et al. 1996) and often scavanges (Bukacinski and Bukacinska 2003). Breeding site The nest is a shallow cup of vegetation placed on grass, rock, sand, shingle, earth or floating and marshy vegetation (del Hoyo et al. 1996) in a variety of coastal and inland locations (Flint et al. 1984, Richards 1990, del Hoyo et al. 1996, Snow and Perrins 1998). The species may also nest off the ground on artificial structures, in nest-boxes and in trees (Richards 1990, del Hoyo et al. 1996). Management information The species may benefit from the removal of introduced predators such as American mink Neovison vison from small breeding islands (Nordstrom et al. 2003), and has been known to nest on artificial rafts intended to encourage other species (e.g. Common Tern Sterna hirundo) to breed (Bukacinski and Bukacinska 2003).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Seacoasts, beaches, bays, and mudflats (AOU 1983). Nests inland along marshes, lakes, and rivers or along the rocky or sandy seacoast. May nest on the ground or occasionally in trees. Usually nests on islands. NON-BREEDING: In winter in British Columbia, tens of thousands frequent agricultural fields. Seldom found far offshore, but often feeds at herring spawning areas and along lines of tide convergence (Campbell et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 17743 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5234 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.577 - 15.249
  Nitrate (umol/L): 0.633 - 16.868
  Salinity (PPS): 5.715 - 35.485
  Oxygen (ml/l): 5.875 - 8.325
  Phosphate (umol/l): 0.231 - 0.890
  Silicate (umol/l): 0.987 - 12.889

Graphical representation

Temperature range (°C): 7.577 - 15.249

Nitrate (umol/L): 0.633 - 16.868

Salinity (PPS): 5.715 - 35.485

Oxygen (ml/l): 5.875 - 8.325

Phosphate (umol/l): 0.231 - 0.890

Silicate (umol/l): 0.987 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In summer this gull breeds on moorland on islands and cliffs close to lochs, lakes, bogs and marshes (3). During winter it can be seen on farmland, reservoirs, coasts, lakes and playing fields (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Found throughout the year in a portion of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mew gulls can be quite opportunistic, which certainly contributes to their adeptness at survival and their great abundance. As an example, the Mew gull, when it is able to get a clam or muscle, will fly over and drop the creature repeatedly on a hard surface until the shell gives way and cracks open. However the Mew gulls food of choice is almost always fish or seafood, which it will catch by dipping down into the water, or simply floating above and waiting for the fish. Worms, insects, mice, berries and grains from farmlands also make up the wide spectrum of food gulls will consume. Many times when food is scarce, gulls will resort to cannibalism, eating a large number of hatchlings and younger birds, which in many gull colonies leads to a high infant mortality rate.

Foods eaten include: cod, herring, worms, insects, berries, grains, crustaceans, clams, mussels and young sea birds.

(Time Life, 1976; Bent, 1963; Harrison, 1983)

Animal Foods: birds; mammals; fish; eggs; carrion ; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Along the coast feeds on fishes, crustaceans, and mollusks. Also scavenges in harbors. Inland follows farmers plowing fields and feeds on worms and insect larvae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Mew Gulls, as with their many relatives, are known as efficient garbage collectors. They scavenge off dead animals washed ashore and human debris left behind, in effect, keeping their habitat somewhat clean. (Time Life, 1976)

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cannibalistic adult gulls will eat eggs and hatchlings. Also, mammals such as foxes and weasels may at times kill more than they can eat at one time (Time Life, 1976; Ehrlich, Dobkin & Wheye 1988)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan of up to 24 years.

Average lifespan

Status: wild:
24 years.

Average lifespan

Status: wild:
218 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.7 years (wild) Observations: Maximum longevity from banding studies is 33.7 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding among Mew Gulls occurs in colonies on the coasts of Scandinavia, Finland, Russia, Great Britain, Ireland, Denmark, Poland, Germany, Alaska, northwest Canada and on occasion, Holland and France. They are usually already paired when they arrive in March and early April at the breeding grounds. During the initial courtship the female will make primary contact, begging the male for food in a crouched posture. They will generally create large nests, which are almost entirely constructed by the female, while the male keeps his distance, occasionally bringing building materials. The nest itself will be made up of many different materials, such as seaweed, twigs, mosses, bark, grasses, and weed stalks.Mew Gulls tend to build their nests on bare rocks or hummocks.(Bent, 1963; Harrison, 1983; Royal BC Museum, 1995; USGS, 2001; Ehrlich, Dobkin & Wheye, 1988)

Mating System: monogamous

Mew Gull eggs are a light brown/olive with brown markings, and are about 57 mm(2.2in) in length. They are laid in March and early April during the breeding season. The female gull will lay her first egg at anytime during a 24 hour period, but the majority of 2nd and 3rd eggs are laid from midday to evening. The eggs are incubated by both sexes at intervals of two to three hours, and will begin to hatch at around three to four weeks. When the chicks are hatched, they are tended by both parents. For the first four days, they will feed the hatchlings insects and small fish. At 20 days the young will begin to forage for food on their own, feeding on insects and their larvae, although they will still occasionally be fed by the parents, and will not be fully independent until about eight weeks.

The young gulls will stay in the nest until near to full growth, all the while being camoflouged by thick, speckled down. However, because many young gulls will often cannibalise their younger or weaker siblings, it is a rarity for more than one chick to survive.(Time Life, 1976; Skutch, 1976; Felix, 1998; Bent, 1963; Ehrlich, Dobkin & Wheye 1988)

Breeding season: March and early April

Range eggs per season: 3 to 5.

Average eggs per season: 3.

Average time to hatching: 25 days.

Average fledging age: 35 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 23 days.

Average eggs per season: 3.

Parental Investment: precocial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins is late May. Usually 2-3 eggs are incubated by both sexes for 22-25 days. Nestlings are semi-precocial, downy. Young are tended by both parents, fledge in about 35 days. May breed singly or in small colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Larus canus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTATACTTAATCTTCGGCGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTTATCCGTGCAGAACTTGGCCAACCCGGAACCCTCCTAGGAGACGACCAAATCTACAACGTAATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTGATACCAATCATGATCGGTGGATTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGATATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCCGGCACAGGATGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCTCATGCTGGAGCCTCAGTAGACCTAGCAATCTTCTCTCTTCACTTAGCAGGTGTGTCCTCCATTCTGGGTGCTATCAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATCACTGCCGTCCTATTACTACTTTCACTCCCAGTGCTTGCCGCAGGCATTACTATGCTACTCACAGACCGAAACCTAAACACAACGTTCTTCGATCCCGCCGGAGGCGGTGACCCTGTACTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTACCAGGATTTGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Larus canus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In some areas they are protected by law for their esteemed ability to keep beaches and coastal waters relatively clean of natural and human debris. (Time Life, 1976)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Amber List (medium conservation concern) (3). Receives general protection in Great Britain under the Wildlife and Countryside Act (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.2,500,000-3,700,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.100-10,000 breeding pairs and c.50-1,000 wintering individuals in China and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Breeding In north and west Europe the species is threatened at breeding colonies by predation from introduced ground predators such as American mink Neovison vison (Bukacinski and Bukacinska 2003), and by disturbance from tourism, angling and research activities during the laying period (Bukacinski and Bukacinska 2003). Inland populations breeding in colonies near rivers are also vulnerable to mass outbreaks of black flies (Simuliidae) (Bukacinski and Bukacinska 2003). The species is also threatened by the transformation and loss of its breeding habitats through land reclamation, drainage, afforestation (e.g. with conifers) and dam construction (Bukacinski and Bukacinska 2003). Non-breeding In its wintering range the species is potentially threatened by the activities of fisheries (e.g. reductions in fishing effort, increases in net mesh sizes and exploitation of formerly non-commercial fish species) and their effects on competition for prey resources (Bukacinski and Bukacinska 2003). Other threats to wintering sites include land reclamation and drainage (Bukacinski and Bukacinska 2003). Utilisation Egg collecting from in colonies occurs in Germany, Scotland, the Russian Federation and Poland, and the species is shot in the Russian Federation (Bukacinski and Bukacinska 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The common gull is not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

In some areas the gulls become too numerous and cause problems, such as crashing into planes, defecating on buildings and statues, and crowding out other species of birds from their habitats. (Time Life, 1976)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mew Gulls, along with many other types of gulls, have helped to keep beaches a bit cleaner due to their scavenging nature. This in effect, cuts the cost of maintenance of beaches. (Time Life, 1976)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common gull

"Mew Gull" redirects here. For the aircraft, see Percival Mew Gull.
For the common gull butterfly, see Cepora nerissa.

The common gull (European and Asian subspecies; see below) or mew gull (North American subspecies) Larus canus is a medium-sized gull which breeds in northern Asia, northern Europe and northwestern North America. It migrates further south in winter.[2] Its name does not indicate that it is an abundant species, but that during the winter it feeds on common land, short pasture used for grazing.[3]

Description[edit]

Adult common gulls are 40–46 cm long, noticeably smaller than the herring gull, and slightly smaller than the ring-billed gull, also differing from the latter in its shorter, more tapered bill with a more greenish shade of yellow, as well as being unmarked during the breeding season. The body is grey above and white below. The legs are greenish-yellow. In winter, the head is streaked grey, and the bill often has a poorly defined blackish band near the tip (sometimes sufficiently obvious to cause confusion with ring-billed gull). They have black wingtips with large white "mirrors". Young birds have scaly black-brown upperparts and a neat wing pattern, and grey legs. They take two to three years to reach maturity. The call is a high-pitched "laughing" cry.[2][4]

Taxonomy[edit]

There are four subspecies, two of them considered distinct species by some authorities:[2][5]

  • Larus canus canus Linnaeus, 1758 – common gull. Europe and western Asia. Small; mantle medium grey (palest subspecies); wingtips with extensive black; iris dark. Wingspan 110–125 cm; mass 290–480 g.
  • Larus canus heinei Homeyer, 1853 – Russian common gull. Central northern Asia. Medium size; mantle dark grey (darkest subspecies); wingtips with extensive black; iris dark. Mass 315–550 g.
  • Larus canus kamtschatschensis (Bonaparte, 1857); syn. L. kamtschatschensisKamchatka gull. Northeastern Asia. Large; mantle medium-dark grey; wingtips with extensive black; iris pale. Mass 394–586 g.
  • Larus canus brachyrhynchus Richardson, 1831; syn. L. brachyrhynchusmew gull or short-billed gull. Alaska and western Canada. Small; mantle medium-dark grey; wingtips with little black and much white; iris pale. Wingspan 96–102 cm; mass 320–550 g.

Ecology[edit]

Winter plumage

Both common and mew gulls breed colonially near water or in marshes, making a lined nest on the ground or in a small tree; colony size varies from 2 to 320 or even more pairs. Usually three eggs are laid (sometimes just one or two); they hatch after 24–26 days, with the chicks fledging after a further 30–35 days. Like most gulls, they are omnivores and will scavenge as well as hunt small prey. The global population is estimated to be about one million pairs; they are most numerous in Europe, with over half (possibly as much as 80-90%) of the world population.[6] By contrast, the Alaskan population is only about 10,000 pairs.[2]

Vagrancy[edit]

The common gull occurs as a scarce winter visitor to coastal eastern Canada and as a vagrant to the northeastern USA,[7] and there is one recent record of mew gull in Europe on the Azores.[8]

Etymology[edit]

The scientific name Larus canus simply translates from Latin as grey or hoary gull.[9] The name common gull was coined by Thomas Pennant in 1768 because he considered it the most numerous of its genus.[10] John Ray earlier used the name common sea-mall.[10] It is something of a cliche that uncommon gull is a more accurate description. There are many old British regional names for this species with variations on maa, mar and mew.[11]

Larus canus fishing sequence
Larus canus fishing sequence

References[edit]

  1. ^ BirdLife International (2012). "Larus canus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d del Hoyo, J., et al., eds. (1998). Handbook of the Birds of the World 3: 621. Lynx Edicions ISBN 84-87334-20-2.
  3. ^ Okill, Dave (2004) English names for Western Palearctic birds British Birds 97(7): 348-9
  4. ^ Snow, D. W. & Perrins, C. M. (1998). The Birds of the Western Palearctic Concise Edition. OUP ISBN 0-19-854099-X.
  5. ^ Olsen, K. M., & Larsson, H. (2004). Gulls of Europe, Asia and North America. Helm ISBN 0-7136-7087-8.
  6. ^ Hagemeijer, W. J. M., & Blair, M. J., eds. (1997). The EBCC Atlas of European Breeding Birds. Poyser, London ISBN 0-85661-091-7.
  7. ^ Sibley, D. (2000). The Sibley Guide to Birds. ISBN 0-679-45122-6.
  8. ^ Alfrey, P., & Ahmad, M. (2007). Short-billed Gull on Terceira, Azores, in February–March 2003 and identification of the 'Mew Gull complex'. Dutch Birding 29 (4): 201-212.
  9. ^ Jobling, James A (1991). A Dictionary of Scientific Bird Names. OUP. ISBN 0-19-854634-3. 
  10. ^ a b Lockwood, W B (1993). The Oxford Dictionary of British Bird Names. OUP. ISBN 978-0-19-866196-2. 
  11. ^ Jackson, Christine E. (1968). British Names of Birds. Witherby. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Composed of three groups: brachyrhynchus of North America (Short-billed Gull), canus of Eurasia (Mew Gull), and kamtschatschensis of Siberia (Kamchatka Gull) (AOU 1998). Some authors suggest that the larger Asiatic form, which has been reported from the western Aleutians, is a separate species, L. kamtschatschensis (AOU 1983). Populations on Asian and North American sides of Beringia exhibit mtDNA differentiation consistent with species-level distinctness (Zink et al. 1995); because sample sizes were small, Zink et al. (1995) did not recommend a formal taxonomic change. Known as Common Gull in Europe (Jonsson 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!