Articles on this page are available in 3 other languages: Spanish (7), Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

With their intense yellow eyes, herring gulls look quite agressive. Their downout brutal behavior contributes further to this poor image. They shamelessly steal bread from your hand and are seen as predators of young animals and eggs. However, it has never been proved that gulls are the cause of declining bird or other animal populations. What's more, they clean up lots of litter: ice cream cones that fall on the ground or french fries are gone in no time.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Larus argentatus

A large (23-26 inches) seagull, the Herring Gull is most easily identified by its black-tipped wings, pale yellow eye, pink legs, and yellow bill with red spot on the lower half. Winter and immature gulls of many species are notoriously difficult to identify as these birds may be splotched or streaked with brown on the head and breast. Male and female Herring Gulls are similar to one another in all seasons. The Herring Gull inhabits a wide portion of the Northern Hemisphere. In North America, this species breeds across Alaska, Canada, the Northern United States, and the Mid-Atlantic region. Populations breeding in southern Alaska, the Great Lakes, and the Mid-Atlantic region are non-migratory, while those breeding in the interior migrate south to the Pacific coast from southern Alaska south to central Mexico, along the coast and in the interior in the southeastern U.S., in eastern Mexico, in Central America, and in the West Indies. In Eurasia, the Herring Gull breeds in northern Europe and Asia, wintering south to North Africa and South Asia. Herring Gulls breed on rocky or sandy islands and beaches by lakes, in marshes, and along the coast. Similar habitats are utilized in winter as in summer. Herring Gulls eat a variety of foods, including crustaceans, fish, carrion, garbage, and, occasionally, other birds. Herring Gulls are most easily seen foraging for food along sandy beaches. In many areas, this is one of the most common “seagulls,” and may be seen foraging for refuse and carrion on the beach, flying over the water and plunging in to catch fish, or floating on the water’s surface while catching fish with its bill. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Coast, Belgian Exclusive Economic Zone, Djibouti, Eritrea, Eurasia, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Kenya, North America, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Red Sea, Somalia, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; range extends throughout the Canadian Atlantic and south to the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Herring Gull breeds in most of Canada and Alaska, as well as the north-east USA, on the northern coastline of Europe including inland Iceland, Ireland, Scandinavia and the United Kingdom, and in the north of Russia from the centre to its eastern tip. Some populations winter further south, being found in much of the USA, Mexico and Central America, on the northern coasts of Spain and France, in much of Japan and on the south-eastern coast of China1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Larus argentatus is found across Eurasia and North America. The herring gull geographic range stretches across the northern hemisphere through Alaska, northern Canada, and Russia. Herring gulls are found on both North American coasts, having gradually extended in range down the Atlantic coast. They can be found year-round in the lower Great Lakes area, but generally breed in the northern area of their range and winter in the south along the Pacific and Atlantic coasts, the Gulf of Mexico, and on several Caribbean Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Kubetzki, U., S. Garthe. 2003. Distribution, diet and habitat selection by four sympatrically breeding gull species in the south-eastern North Sea. Marine Biology, 143/1: 199-207.
  • Goryaeva, A. 2007. Reproduction success of the herring gull Larus argentatus in Murmansk in 2006. Doklady Biological Sciences, 416: 389-390.
  • Cornell Lab of Ornithology. 2003. "All About Birds" (On-line). Herring Gull. Accessed April 05, 2008 at http://www.birds.cornell.edu/AllAboutBirds/BirdGuide/Herring_Gull_dtl.html.
  • Canadian Wildlife Service & Canadian Wildlife Federation. 2008. "Hinterland Who's Who" (On-line). Herring Gull. Accessed April 05, 2008 at http://www.hww.ca/hww2.asp?cid=7&id=49.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northern Alaska across northern Canada (including southern Baffin Island) to northern Labrador, south to British Columbia, central Saskatchewan, northern Wisconsin, northern Ohio, and northern New York, and along coast to North Carolina or South Carolina. NON-BREEDING: Aleutians, Great Lakes, and Newfoundland south to Panama (increasingly regular in southern Central America), West Indies; occasional to frequent in Hawaii. Nonbreeders widespread in summer throughout range. Also occurs in Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern Europe, Canada, coastal United States and along major river system.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Herring gulls are fairly large gulls. Male herring gulls range in size from 60 to 66 centimeters in length and 1050 and 1250 grams in weight, while female herring gulls range from 56 to 62 centimeters in length and 800 to 980 grams in weight. The wing span of herring gulls ranges from 137 to 146 centimeters. While male herring gulls are larger than female herring gulls, the sexes have similar plumage. Their heads and underparts are white, and they have light gray backs. Herring gulls have yellow bills with a red spot on the lower mandible and pink or flesh-colored legs. Herring gull outermost wing feathers are black and have a white spot. During winters, adult gulls have streaks of brown coloring on their heads. Adult herring gulls have golden eyes surrounded by a yellow-orange ring of skin.

Herring gulls take four years to acquire standard adult plumage and are mottled brown during their first four years. The eyes of immature herring gulls are dark brown, rather than golden, and are surrounded by blackish skin, rather than orange-yellow. Their bills are black and their legs are dark gray.

Herring gulls belong to a complex of gulls, all of which share similarities and may be confused with one another. Because of hybridization and other factors, the taxonomy of gulls is complicated. Great black-backed gulls (Larus marinus), are much larger than herring gulls and have a lighter bill and darker mantle. Lesser black-backed gulls (Larus fuscus) have a dark mantle and yellow legs. Both great and lesser black-backed gulls have occasionally hybridized with herring gulls. Ring-billed gulls (Larus delawarensis) are smaller than herring gulls, with yellow legs in adulthood and possessing a bill with a distinct black ring and lacking a red spot. Thayer's gulls (Larus thayeri) are quite similar to herring gulls, but adult Thayer's gulls have dark eyes and much less black coloring under the wingtip. The species status of Thayer's gulls has been questioned. They may be a form of Larus argentatus or Iceland gulls (Larus glaucoides).  California gulls (Larus californicus) have yellowish green legs, a black spot in front of the red spot on the bill, and are smaller than herring gulls. Western gulls (Larus occidentalis) are similar in size but have a darker mantle. Glaucous-winged gulls (Larus glaucescens) are similar in color but somewhat larger in size compared to herring gulls, and have pale gray rather than black wingtips in addition to a dark iris and purplish skin around their eyes. Hybrids between western gulls and glaucous-winged gulls can appear quite like herring gulls, but often with less black wingtips. Mew gulls (Larus canus) are much smaller than herring gulls and have yellow legs and unmarked yellow bills.

Range mass: 800 to 1250 g.

Range length: 56 to 66 cm.

Range wingspan: 137 to 146 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 64 cm

Weight: 1226 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 56-66 cm, Wingspan: 137-142 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 56-66 cm. Plumage: back grey; head and below white; outer primaries black with white mirrors on outer two; leading and trailing edges of upper wing white; inner wing linings white. Immature with head and neck streaked grey-brown; rest of plumage like adult but grey replaced by rusty brown. Bare parts: iris white to yellow; eyering vermilion; bill yellow with red patch near tip; feet and legs bright yellow, pink or bluish. Habitat: estuaries and marine shores. Uncommon palearctic visitor. <389><391><393>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Northern breeding populations of this species are migratory1 although populations in the south are nomadic or completely non-migratory3. The species breeds between mid-April and late-June1, 3 in colonies of up to several thousand pairs, occasionally nesting solitarily or as single pairs on the edge of other seabird colonies1. Outside of the breeding season the species is highly gregarious and gathers in large flocks in favoured sites2, 4. Individuals show foraging site fidelity8. Habitat The species inhabits coastal and near-coastal areas1 but may also forage inland on large lakes and reservoirs, fields and refuse dumps1. It has no specific breeding habitat1 but may show a preference for rocky shores with cliffs, outlying stacks or islets1, 4, otherwise nesting on rocky and grassy islands, sandy beaches1, dunes2, gravel bars, saltmarshes, rocky outcrops, buildings, claypits1, tundra with reeds or hummocks3, swampy lowlands near lakes and on river islands3. When inland on migration the species also shows a preference for large river valleys3. Diet The species has a highly opportunistic diet and will exploit almost any superabundant source of food1. It takes fish, earthworms, crabs and other marine invertebrates (e.g. molluscs, starfish or marine worms), adult birds, bird eggs and young, rodents, insects (e.g. ants), berries and tubers (e.g. turnips)1. It also scavenges at refuse dumps, fishing wharves and sewage outfall zones and frequently follows fishing boats1,9. Breeding site The nest is a depression in a mound of vegetation2, 3 placed on the ground, e.g. on a cliff ledge or roof, usually in the shelter of vegetation1. Although Herring Gulls exploit refuse tips and farmland extensively all year round, their breeding distribution is extremely coastal compared to other Larus gulls (other than L. marinus)10. Foraging range The species shows increasing foraging distances later in the breeding period11. The feeding range has been variously reported as 35 km (for breeding herring gulls in a Dutch colony)12, 41 km (in Westphalia, Germany, outside the breeding season)13, 50 km (for breeding birds in Morocco)19 and 70 to 100 km (for herring gulls breeding in Denmark)14. Several other studies have reported shorter foraging distances15,16,17,18,19,20,21,22. Refuse tips are frequently exploited by foraging individuals16,17,20 and so the feeding distribution of some colonies will be determined by location of refuse dumps22. On the basis of a simple density model of birds at sea, it has been estimated that 95% of herring gulls breeding on Terschelling in the Dutch Wadden Sea foraged within 54 km of the colony22. Radio-tracking of four gulls at an inland lake in Ontario indicated extreme specialisation in foraging patterns, with two of the gulls feeding within 1 km whereas two others took extended flights to destinations more than 30 km away22,23.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Herring gulls tend to live and breed in coastal areas and generally only live inland in small numbers and near bodies of water. The most important habitat requirements are the nearby presence of a food source, distance from major predators, and shelter from prevailing winds. Herring gulls prefer to breed on flat ground on offshore islands, on the mainland these gulls prefer cliffs, where there is less risk of exposure to predatory mammals. Although herring gulls prefer to nest on rock or sand, highest breeding success has often been observed in birds that nest in vegetated areas. Herring gull foraging habitat is not typically the same as their nesting habitat; in coastal areas herring gulls search for food in the intertidal zone and at sea. Herring gulls are also found in coastal urban areas, nesting on roofs and eating urban refuse.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: lakes and ponds; coastal

Other Habitat Features: urban

  • Rodway, M., H. Regehr. 1999. Habitat selection and reproductive performance of food-stressed herring gulls. The Condor, 101/03: 566-576.
  • Finney, S., M. Harris, L. Keller, D. Elston, P. Monaghan, S. Wanless. 2003. Reducing the density of breeding gulls influences the pattern of recruitment of immature Atlantic puffins Fratercula arctica to a breeding colony. The Journal of Applied Ecology, 40/3: 545-552.
  • Pierotti, R., T. Good. 1994. "Herring Gull (Larus argentatus)" (On-line). The Birds of North America Online. Accessed April 09, 2008 at http://bna.birds.cornell.edu/bna/species/124/articles/introduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 81560 specimens in 5 taxa.
Water temperature and chemistry ranges based on 36154 samples.

Environmental ranges
  Depth range (m): 0 - 1750
  Temperature range (°C): -0.326 - 26.954
  Nitrate (umol/L): 0.038 - 18.311
  Salinity (PPS): 5.715 - 36.874
  Oxygen (ml/l): 4.607 - 9.061
  Phosphate (umol/l): 0.037 - 1.130
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Depth range (m): 0 - 1750

Temperature range (°C): -0.326 - 26.954

Nitrate (umol/L): 0.038 - 18.311

Salinity (PPS): 5.715 - 36.874

Oxygen (ml/l): 4.607 - 9.061

Phosphate (umol/l): 0.037 - 1.130

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: NON-BREEDING: Seacoasts, bays, estuaries, lakes, rivers, dumps. BREEDING: along rocky and sandy coasts, on tundra, on islands in larger lakes and rivers, or on sea cliffs. Most colonies are on low, rocky, grassy, or sandy islands with low sparse vegetation, but may nest in wide variety of habitats (see Spendelow and Patton 1988 for details on nesting habitat in several regions).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ocean coasts, bays, beaches, lakes, piers, farmland, dumps, large lakes, along major river systems. Always near water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates north to northern breeding areas, arriving April-May (Bent 1921). Nonbreeders may not migrate. Migrants reach Costa Rica (mainly 1st and 2nd year birds) early November, most depart by mid-May (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Herring gulls are opportunistic predators of marine invertebrates, fishes, insects, other seabirds, other birds, bird eggs, and are opportunistic scavengers of dead animals and garbage. Herring gulls are omnivorous but prefer animal foods. Herring gulls at sea forage in scattered groups that converge quickly once prey has been located; the birds follow foraging whales or even fishing boat nets, eating fish, squid, and zooplankton at the surface. Individual specialization in feeding is common, i.e., a particular bird will seek out the same type of food again and again. The type of food consumed differs by the given bird's location and the time of year. For example, in Newfoundland, herring gulls often eat mussels (Mytilus edulis) and refuse during incubation, switch to capelin (Mallotus villosus) when chicks hatch, and then switch to squid (Illex illecebrosus) later in the summer. Herring gulls appear to choose foods according to their dietary needs (such as during egg-laying) when sufficiently numerous food sources are available.

Animal Foods: birds; mammals; fish; eggs; carrion ; insects; mollusks; terrestrial worms; aquatic crustaceans; echinoderms; other marine invertebrates; zooplankton

Plant Foods: roots and tubers; seeds, grains, and nuts; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Eats non-insect arthropods, Molluscivore ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically mostly on various animals and garbage. Often a scavenger around bays and harbors. In Ohio, Belant et al. (1993) found that nearby landfills were unimportant as a food source to a nesting population; diet of adults and young was dominated by fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish, crustaceans, mollusks, sea urchins, marine worms, birds, eggs, insects, garbage, and carrion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
fluke of Cryptocotyle lingua endoparasitises small intestine of Larus argentatus

Animal / parasite / endoparasite
fluke of Diplostomum spathaceum endoparasitises small intestine of Larus argentatus
Other: major host/prey

Animal / parasite / endoparasite
fluke of Spelotrema excellens endoparasitises small intestine of Larus argentatus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Though Larus argentatus is a predator of other birds, its attacks on predators sometimes serve to protect birds such as eiders (Somateria mollissima) and puffins (Fratercula artica) which live nearby. Herring gull consumption of dead animals on land and at sea is a form of biodegradation.

Ecosystem Impact: biodegradation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The preference of jerring gulls for living on cliff edges and on rocky off-shore islands with available hiding spots for chicks reflects anti-predator behavior. When a predator is first seen, herring gulls give an alarm call. If a predator approaches, herring gulls give a warning call and then take flight. Herring gulls mob flying predators by diving and striking with beaks and feet, and also dive at terrestrial predators, striking then with wings and feet, rather than with beaks. If a chick gives a shrill waver, its parents attack the involved predator while other herring gulls make intense calls described as "long-call notes."

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Larus argentatus is prey of:
Cryptocotyle lingua
Himasthla elongata
Renicola roscorita
Cryptocotyle jejuna
Maritrema subdolum
Parvatrema affine

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fox predation may result in reproductive failure of local breeding colonies (Southern et al. 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Herring gulls have no song, but have a complex system of anywhere from 8 to perhaps 15 calls; two are used by nestlings and another three are used only by breeding adults. Various calls serve to identify returning partners, demonstrate aggression, warn the colony of predators, and to dispute territory with neighboring gulls. When males are disputing territory, they may pull at grass with their beaks as part of their demonstration. Chicks begin making begging calls to demand food upon hatching; the call grows more intense as they grow and by 5 weeks of age, a chick begs by lifting its head with each peep and holding its head hunched against its body. When chicks are pursued, they emit a shrill waver. The begging call and shrill waver exhibited by chicks are both similar to noises that adult gulls make. Chicks also peck at the red spot on their parent's bills in order to stimulate food regurgitation.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Herring gulls live up to 30 years of age, but many die earlier, especially as chicks. Causes of mortality include injuries, being shot or poisoned by fishermen, ingesting contaminants such as bacteria and lead (especially in the Great Lakes, where many chicks have shown deformities related to toxins), fishing lines and nets, and occasional predation by predators such as owls and foxes. The dangers presented to Larus argentatus in the Great Lakes by contaminants have decreased since the 1980s, when contaminant levels began to decline. Most deaths occur during breeding, when both adults and young are vulnerable.

Range lifespan

Status: wild:
31 (high) years.

  • Weseloh, D., C. Pekarik, S. De Solla. 2006. Spatial patterns and rankings of contaminant concentrations in herring gull eggs from 15 sites in the Great Lakes and connecting channels, 1998–2002. Environmental Monitoring and Assessment, 113: 265-284.
  • Scottish Seabird Centre. 2007. Herring gull. Accessed April 13, 2008 at http://www.seabird.org/birds-herring-gull.asp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 49 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Herring gulls are almost always monogamous, with rare cases of 1 male and 2 females occupying a territory and incubating 1 or 2 nests. The secondary female rarely achieves breeding success. Pairs are formed on the male's territory or in loafing areas. Males and females choose territory for egg-laying together, once they have paired. Males regurgitate food for females before eggs are laid. Any late arrivals pair only after early-nesting pairs have already begun breeding. Pair bonds are maintained for the life of both partners. If a male fails to provide enough food to the female during egg formation or if the partners fail to synchronize their eggs (leaving eggs unattended and often lost or eaten), the pair may separate. Within the colony, pairs nest as far apart as space allows.

There are no displays specific to courtship, but females usually approach males in a hunched posture, producing a begging call. The male responds by assuming an upright posture or mew-calling (see Pierotti & Good for more information on specific types of calls). Head-tossing occurs repeatedly by both male and female and the male regurgitates food for the female; if she eats it, copulation often happens immediately. Otherwise, the female may walk away and prevent copulation. Males jump on females' backs with wings outspread in order to copulate. Mate-guarding is most intense in the week prior to egg laying. Males whose mates have already laid eggs may attempt to force copulation on neighboring incubating females; no such attempt has ever been observed as successful.

Mating System: monogamous ; polygynous

Herring gulls breed during spring, pairing around mid-March and laying eggs by mid-May. Adults breed beginning around four years of age, although breeding for the first time at three or five years of age is also observed. Females take 4 to 6 days to lay 3-egg clutches, and the eggs are incubated by both parents for about four weeks. Chicks are able to leave the nest on foot after just one day. Chicks fledge after about six weeks and are fed in the territory where they were born for until about 12 to 15 weeks old. Occasionally, they are cared for by parents off territory for as long as 6 months.

Breeding interval: Herring gulls breed once yearly.

Breeding season: Herring gulls breed from April to June, including nesting and copulation.

Range eggs per season: 1 to 3.

Average eggs per season: 3.

Average time to hatching: 30 days.

Range birth mass: 60 to 75 g.

Average fledging age: 6 weeks.

Range time to independence: 24 (high) weeks.

Average time to independence: 12 to 15 weeks.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both male and female parents incubate eggs. The female spends more time incubating than the male does, and incubates at night. The male spends more time away from the nest, procuring food for the female. Many parents remove broken shells once chicks have hatched. Chicks are semiprecocial at hatching, with gray and black down and open eyes. After one week they are able to run around on their own. Chicks are protected by both parents and, during dangerous weather, are brooded until 10 days of age. Chicks fledge at about 6 weeks of age and are fed by parents on parental territory until they are 11 to 12 weeks old; so long as chicks continue to beg, they may receive food from parents until about 6 months of age. Males feed more often before fledging, females feed chicks more after fledging. Studies have found that herring gull parents can feed lead-poisoned chicks, which are generally lighter than normal chicks when studied in the laboratory, enough so that the chicks maintain a close-to-average weight (Burger and Gochfeld, 2000). Chicks are fed regurgitated food that consists of small prey such as small fishes, insects, and earthworms.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Burger, J., M. Gochfeld. 2000. Effects of lead on birds (Laridae): a review of laboratory and field studies. Journal Of Toxicology And Environmental Health, 3/2: 59-78.
  • Goryaeva, A. 2007. Reproduction success of the herring gull Larus argentatus in Murmansk in 2006. Doklady Biological Sciences, 416: 389-390.
  • Canadian Wildlife Service & Canadian Wildlife Federation. 2008. "Hinterland Who's Who" (On-line). Herring Gull. Accessed April 05, 2008 at http://www.hww.ca/hww2.asp?cid=7&id=49.
  • Pierotti, R., T. Good. 1994. "Herring Gull (Larus argentatus)" (On-line). The Birds of North America Online. Accessed April 09, 2008 at http://bna.birds.cornell.edu/bna/species/124/articles/introduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lays clutch of 2-3 eggs, mostly May-June in U.S. Incubation 25-33 days, mostly by female. Young tended by both parents, first fly at about. 6-7 weeks. Attains adult plumage in 4 years. May form female-female pairs. Nests usually in colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

First breeds at 4-5 years old. Nests in colonies, frequently with other gull species. Nests on ground with windbreak nearby (rocks, etc.) 3 eggs, incubated by both sexes for 27-30 days. Parents feed young by regurgitating food. Capable of flight at 45-50 days old. Remain with parents for another month or so.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Larus argentatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAGACATGGGCACCCTATACTTTATCTTTGGCGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTTATCCGTGCAGAACTTGGCCAACCCGGAACCCTCCTAGGAGACGACCAAATCTATAACGTAATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTGATACCAATCATGATCGGTGGGTTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGATATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCCGGCACAGGGTGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCCCATGCTGGAGCCTCAGTAGACCTAGCAATCTTCTCTCTTCACTTAGCAGGTGTATCTTCCATTCTGGGTGCTATCAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATCACTGCCGTCCTATTACTACTTTCACTCCCAGTGCTTGCCGCAGGCATTACTATGCTACTCACAGACCGAAACCTAAACACAACATTCTTCGATCCCGCCGGAGGCGGCGACCCTGTACTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTACCAGGATTTGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Larus argentatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Herring gull populations seem to be stable and are not recognized as at risk by conservation agencies.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Estimate includes totals for 'Larus heuglini'.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by coastal oil pollution7 and is susceptible to avian influenza so may be threatened by future outbreaks of the virus5. Utilisation The species is hunted in Denmark6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Increased populations now pose a threat to terns and Atlantic puffin (Brown and Nettleship 1984). May pose threat to aircraft, especially where garbage dumps are near airports.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Preventative and control measures are frequently used against this species as it is regarded as a pest and a threat to many other colonial bird species (it usurps habitats and preys upon bird eggs and young), and also to airports (frequently causes collisions)1.

Conservation Actions Proposed

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See Griffin and Hoopes (1992) for management recommendations for JFK International Airport in New York. See Wronecki et al. (1989) for information on use of chemicals to reduce gull numbers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Herring gulls have an adverse effect on humans in areas where their population size, combined with their foraging habits (e.g., stealing human food), makes them a pest.

Gulls, including Larus argentatus, are involved in approximately 20.3% of collisions between aircraft and birds. Collisions between aircraft and birds have caused 159,504 hours of aircraft downtime in a 13-year period in the United States and result in economic losses of hundreds of millions of dollars annually.

  • Blackwell, B., G. Bernhardt. 2004. Efficacy of aircraft landing lights in stimulating avoidance behavior in birds. Journal of Wildlife Management, 68/3: 725-732.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Herring gulls are significant enough in population size to permit their use as experimental subjects both within the wild and the laboratory, with potentially positive results for humans gleaned from the research. In addition, the wide geographic range of herring gulls makes the species useful for making observations concerning pollutants for a great number of areas. For example, herring gulls in the wild have been used to study the behavioral effects of lead, and herring gull eggs from large parts of North America have been used to analyze levels and spread of a number of chemical contaminants.

Herring gulls can contribute to beach sanitation by eating dead fish and trash left behind by humans. The gulls, in the pursuit of food, also sometimes lead fishermen to schools of herring. A study in Murmansk, Russia, found that because the diet of urban herring gulls consisted of about 45% rat and town animal remains, herring gulls may contribute to urban sanitation.

During the late 19th century, along the Atlantic coast, herring gulls were a useful source of eggs and were also pursued for the decorative value of their feathers.

Positive Impacts: food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Activity at landfills near airports may affect aircraft safety (Belant et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European Herring Gull

The European Herring Gull (Larus argentatus) is a large gull (up to 26 inches or 66 cm long). One of the best known of all gulls along the shores of western Europe, it was once abundant.[2] It breeds across Northern Europe, Western Europe, Central Europe, Eastern Europe, Scandinavia and the Baltic states. Some European Herring Gulls, especially those resident in colder areas, migrate further south in winter, but many are permanent residents, e.g. in the British Isles, Iceland, or on the North Sea shores. European Herring Gulls are also abundant around inland rubbish dumps, and some have even adapted to life in inland cities.

Contents

Taxonomy [edit]

The taxonomy of the Herring Gull / Lesser Black-backed Gull complex is very complicated, different authorities recognising between two and eight species.

This group has a ring distribution around the northern hemisphere. Differences between adjacent forms in this ring are fairly small, but by the time the circuit is completed, the end members, Herring Gull and Lesser Black-backed Gull, are clearly different species.

The Association of European Rarities Committees recognises six species:

Subspecies [edit]

Two L. a. argenteus individuals on the shore of Coumeenoole Bay, Ireland
  • L. a. argentatus, the nominate form, sometimes known as the Scandinavian Herring Gull, breeds in Scandinavia and north-west Russia. Northern and eastern populations migrate south-west in winter. It is a large, bulky gull with extensive white in the wingtips.
  • L. a. argenteus, sometimes known as the British Herring Gull breeds in Western Europe in Iceland, the Faroes, Britain, Ireland, France, Belgium, the Netherlands and Germany. Many birds are resident while others make short-distance migratory journeys. It is smaller than L. a. argentatus with more black and less white in the wingtips and paler upperparts.

The two following taxa are classified as subspecies of Larus argentatus by some authorities such as the American Ornithologists' Union and Handbook of the Birds of the World. Others such as the Association of European Rarities Committees and British Ornithologists' Union now regard them as one or two separate species.[3][4]

  • L. (a.) smithsonianus, American Herring Gull, breeds in Alaska, Canada and the north-east United States. Many birds migrate southwards in winter, reaching as far as Central America and the West Indies. Immature birds tend to be darker and more uniformly brown than European Herring Gulls and have a dark tail.
  • L. (a.) vegae, Vega Gull, breeds in north-east Siberia. It winters in Japan, Korea, eastern China and Taiwan.

Several other gulls have been included in this species in the past but are now normally considered separate, e.g. Yellow-legged Gull (L. michahellis), Caspian Gull (L. cachinnans), Armenian Gull (L. armenicus) and Heuglin's Gull (L. heuglini).

Description [edit]

The male European Herring Gull is 60–67 cm (24–26 in) long and weighs 1,050–1,525 g (2.3–3.36 lb) while the female is 55–62 cm (22–24 in) and weighs 710–1,100 g (1.6–2.4 lb). The wingspan can range from 125 to 155 cm (49 to 61 in).[5][6][7][8] Among standard measurements, the wing chord is 38.1 to 48 cm (15.0 to 19 in), the bill is 4.4 to 6.5 cm (1.7 to 2.6 in) and the tarsus is 5.3 to 7.5 cm (2.1 to 3.0 in).[6] Adults in breeding plumage have a grey back and upperwings and white head and underparts. The wingtips are black with white spots known as "mirrors" . The bill is yellow with a red spot and there is a ring of bare yellow skin around the pale eye. The legs are normally pink at all ages but can be yellowish, particularly in the Baltic population which was formerly regarded as a separate subspecies "L. a. omissus". Non-breeding adults have brown streaks on the head and neck. Male and female plumage is identical at all stages of development, however adult males are often larger.[9]

Juvenile (2-3cy)

Juvenile and first-winter birds are mainly brown with darker streaks and have a dark bill and eyes. Second-winter birds have a whiter head and underparts with less streaking and the back is grey. Third-winter individuals are similar to adults but retain some of the features of immature birds such as brown feathers in the wings and dark markings on the bill. The European Herring Gull attains adult plumage and reaches sexual maturity at an average age of four years.[10]

Similar species [edit]

Adult European Herring Gulls are similar to Ring-billed Gulls but are much larger, have pinkish legs, and a much thicker yellow bill with more pronounced gonys. First-winter European Herring Gulls are much browner, but second and third-winter birds can be confusing since soft part colors are variable and third-year Herring Gull often show a ring around the bill. Such birds are most easily distinguished by the larger size and larger bill of European Herring Gull.

The European Herring Gull can be differentiated from the closely related, slightly smaller Lesser Black-backed Gull by the latter's dark grey (not actually black) back and upperwing plumage and its yellow legs and feet.

Voice [edit]

The loud laughing call is well known in the northern hemisphere. The European Herring Gull also has a yelping alarm call and a low barking anxiety call.

European Herring Gull chicks and fledglings emit a distinctive, repetitive high-pitched 'peep', accompanied by a head-flicking gesture when begging for food from, or calling to their parents. It should also be noted that adult gulls in urban areas will also exhibit this behaviour when fed by humans.

Behaviour [edit]

A Herring Gull producing waste near Île-de-Bréhat.

European Herring Gull flocks have a loose pecking order, based on size, aggressiveness and physical strength. Adult males are usually dominant over females and juveniles in feeding and boundary disputes, whilst adult females are typically dominant when selecting nest sites.[10] Communication between these birds is complex and highly developed — employing both calls and body language. Two identical vocalizations can have very different (sometimes opposite) meanings, for example — depending on the positioning of the head, body, wings and tail relative to each other and the ground in the calling gull.

Unlike many flocking birds, European Herring Gulls do not engage in social grooming and keep physical contact between individuals to a minimum. Outside of the male/female and parent/chick relationship, each gull attempts to maintain a respectful 'safe distance' from others of its kind. Any breach of this results in fighting, though severe injuries are seldom inflicted.

European Herring Gulls are known to be capable of seeing ultraviolet light.[11]

Parasites of European Herring Gulls include the fluke Microphallus piriformes.

Distribution [edit]

Ireland: Copeland Bird Observatory, Co Down.[12]

England: County Durham.[13]

Diet [edit]

Stealing an egg from a Common Murre
Seagulls fighting for a fish.

These are omnivores and opportunists like most Larus gulls, and will scavenge from garbage dumps, landfill sites, and sewage outflows, with refuse comprising up to half of the bird's diet. It also steals the eggs and young of other birds (including those of other gulls), as well as seeking suitable small prey in fields, on the coast or in urban areas, or robbing plovers or lapwings of their catches. European Herring Gulls may also dive from the surface of the water or engage in plunge diving in the pursuit of aquatic prey, though they are typically unable to reach depths of greater than 1–2 metres due to their natural buoyancy.[14] Despite their name, they have no special preference for herrings — in fact, examinations have shown that echinoderms and crustaceans comprised a greater portion of these gulls' stomach contents than fish, although fish is the principal element of regurgitations for nestlings.[15] European Herring Gulls can frequently be seen to drop shelled prey from a height in order to break the shell. In addition, the European Herring Gull has been observed using pieces of bread as bait with which to catch goldfish.[16] Vegetable matter such as roots, tubers, seeds, grains, nuts and fruit is also taken to an extent.[10]

European Herring Gulls may be observed rhythmically drumming their feet upon the ground for prolonged periods of time in a behaviour that superficially resembles Irish stepdancing. This is for the purpose of creating vibrations in the soil, driving earthworms to the surface, which are then consumed by the gull.[17] It is believed that these vibrations mimic those of digging moles, eliciting a surface escape behaviour from the earthworm, beneficial in encounters with this particular predator, which the European Herring Gull then exploits to its own benefit in a similar manner to human worm charmers.[18]

Whilst the European Herring Gull is fully capable (unlike humans) of consuming seawater, utilizing specialized glands located above the eyes to remove excess salt from the body (which is then excreted in solution through the nostrils and drips from the end of the bill), it will drink fresh water in preference, if available.[10][15]

Courtship and reproduction [edit]

During courtship, the hen will approach the cock on his own territory with a hunched, submissive posture whilst making begging calls (similar to those emitted by young gulls). If the cock chooses not to attack her and drive her away, he will respond by assuming an upright posture and making a mewing call. This is followed by a period of synchronised head-tossing movements, after which the cock will then regurgitate some food for his prospective mate. If this is accepted, copulation will follow. A nesting site will then be chosen by both birds.[10] European Herring Gulls are almost exclusively sexually monogamous and may pair up for life, provided that the couple are successful in hatching their eggs.[14]

Two to four eggs, usually three, are laid on the ground or cliff ledges in colonies, and are defended vigorously by this large gull. The eggs are a dark blotched, olive color. They are incubated for 28–30 days. Breeding colonies are predated by great black-backed gulls, harriers, corvids, herons and raccoons.

Juveniles use their beaks to "knock" on the red spot on the beaks of adults to indicate hunger. Parents typically disgorge food for their offspring when they are "knocked".[19] The young birds are able to fly 35–40 days after hatching and fledge at six weeks of age. Chicks are generally fed by their parents until they are 11–12 weeks old but the feeding may continue up to six months of age, if the young gull continues to beg. The male feeds the chick more often than the female before fledging, the female more often post-fledging.[10]

Like most gulls, European Herring Gulls are long lived, with a maximum age of 49 years recorded.[20] Raptors (especially owls, peregrine falcons and gyrfalcons) and seals (especially grey seals) occasionally prey on the non-nesting adults.[21]

Interactions with humans [edit]

Tearing open a bin bag
Stealing food from a man's hand
Perching on spikes designed to discourage perching birds
A rubbish bag designed to resist scavenging behaviour.

The European Herring Gull is an increasingly common roof-nesting bird in urban areas of the UK. The Clean Air Act 1956 forbade the burning of refuse at landfill sites, providing the European Herring Gull with a regular and plentiful source of food. As a direct result of this, European Herring Gull populations in Britain skyrocketed. Faced with a lack of space at their traditional colonies, the gulls ventured inland in search of new breeding grounds. Dwindling fish stocks in the seas around Britain may also have been a significant factor in the gulls' move inland.[22]

The gulls are found all year round in the streets and gardens of Britain, due to the presence of street lighting (which allows the gulls to forage at night), discarded food in streets, food waste contained in easy-to-tear plastic bin bags, food intentionally left out for other birds (or the gulls themselves), the relative lack of predators and readily available, convenient, warm and undisturbed rooftop nesting space in towns and cities. Particularly large urban gull colonies (composed primarily of European Herring Gulls and Lesser Black-backed Gulls) are now present in Cardiff, Bristol, Gloucester, London and Aberdeen.[22][23] to name but a few.

The survival rate for urban gulls is much higher than their counterparts in coastal areas, with an annual adult mortality rate of less than 5%. It is also common for each European Herring Gull pair to successfully rear three chicks per year. This, when combined with the long-lived nature of European Herring Gulls, has resulted in a massive increase in numbers over a relatively short period of time and has brought urban-dwelling members of the species into conflict with humans.[23]

Once familiar with humans, urban European Herring Gulls show little hesitation in swooping down to steal food from the hands of humans. During the breeding season, the gulls will also aggressively 'dive bomb' and attempt to strike with claws and wings (sometimes spraying faeces or vomit at the same time) at humans that they perceive to be a threat to their eggs and chicks — often innocent passers-by or residents of the buildings on which they have constructed their nests. Large amounts of gull excrement deposited on property and the noise from courting pairs and begging chicks in the summer months is also considered to be a nuisance by humans living alongside the European Herring Gull.[23]

Non-lethal attempts to deter the gulls from nesting in urban areas have been largely unsuccessful. The European Herring Gull is intelligent and will completely ignore most 'bird scaring' technology after determining that it poses no threat. Rooftop spikes, tensioned wires, netting and similar are also generally ineffective against this species, as it has large, wide feet with thick, leathery skin which affords the seagull excellent weight distribution and protection from sharp objects (the bird may simply balance itself on top of these obstacles with little apparent concern). If nests are removed and eggs are taken, broken, or oiled, the gulls will simply rebuild and/or re-lay, or choose another nest site in the same area and start again.[23]

Attempts to scare the gulls away using raptors are similarly ineffective. Although they are intimidated by birds of prey, European Herring Gulls, in addition to being social birds with strength in numbers, are large, powerful and aggressive as individuals and are more than capable of fighting back against the potential predator, particularly if they consider their chicks to be at risk - in fact the gulls may actually pose a greater threat to a raptor than vice-versa.[24] European Herring Gulls are also naturally accustomed to predators (such as Skuas and Great Black-backed Gulls) living in the vicinity of their nest sites in the 'wild' and are not particularly discouraged from breeding by their presence.[23]

Despite the increasing number of urban European Herring Gulls in the UK, the species, when taken as a whole is declining significantly across the country, its population having decreased by 50% in 25 years.[25] In 2009, the RSPB placed the European Herring Gull on its 'Red List' of threatened bird species, affording it the highest possible conservation status.[26] In response, Natural England in January 2010, following a public consultation, removed the European Herring Gull from the list of species covered by its general licenses, which had previously permitted authorized persons (e.g. landowners or occupiers) to kill the birds under certain circumstances (e.g. to prevent serious damage to crops or livestock, to prevent disease, or to preserve public health or safety) without requiring additional permission.[25]

Gallery [edit]

References [edit]

  1. ^ BirdLife International (2012). "Larus argentatus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Gilliard, E. Thomas. (1958). Living Birds of the World, p. 174. Doubleday & Company, New York.
  3. ^ AERC TAC (2003) AERC TAC's Taxonomic Recommendations. Accessed 05/05/2008.
  4. ^ Sangster, George et al. (2007) Taxonomic recommendations for British birds: Fourth report, Ibis, 149: 863-857.
  5. ^ Distinguishing Characteristics — Herring Gull — Birds of North America Online
  6. ^ a b Gulls: Of North America, Europe, and Asia by Klaus Malling Olsen & Hans Larsson. Princeton University Press (2004). ISBN 978-0691119977.
  7. ^ Harrison, Peter, Seabirds: An Identification Guide. Houghton Mifflin Harcourt (1991), ISBN 978-0-395-60291-1
  8. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  9. ^ All About Birds: Herring Gull
  10. ^ a b c d e f ""Larus argentatus" (On-line), Animal Diversity Web.". 2008. Retrieved 2009-06-12. 
  11. ^ Marcus, Adam (2006). "Feather Colors: What Birds See". Birder's World Magazine. Retrieved 2007-07-18. 
  12. ^ Copeland Bird Observatory. Annual Report for 2010
  13. ^ Bowey, K. and Newsome, M. 2012. The Birds of Durham. Durham Bird Club.ISBN 978-1-874701-03-3
  14. ^ a b Pierotti, R. J; T. P. Good (1994). "Herring Gull Behavior". The Birds of North America Online (A. Poole, Ed.). Cornell Lab of Ornithology. Retrieved 2009-11-05. 
  15. ^ a b Food Habits — Herring Gull — Birds of North America Online
  16. ^ Henry, Pierre-Yves; Jean-Christophe Aznar (June 2006). "Tool-use in Charadrii: Active Bait-Fishing by a Herring Gull". Waterbirds (The Waterbird Society) 29 (2): 233–234. doi:10.1675/1524-4695(2006)29[233:TICABB]2.0.CO;2. 
  17. ^ Tinbergen, N. (1960). The Herring Gull's World. New York: Basic Books, Inc. p. 297. 
  18. ^ Catania, Kenneth C.; Brosnan, Sarah Frances (22 October 2008). "Worm Grunting, Fiddling, and Charming—Humans Unknowingly Mimic a Predator to Harvest Bait". PLoS ONE 3 (10): e3472. doi:10.1371/journal.pone.0003472. PMC 2566961. PMID 18852902. Retrieved 28 December 2009. 
  19. ^ National Audubon Society - Waterbirds - Herring Gull
  20. ^ "AnAge entry for Larus argentatus". The Animal Ageing and Longevity Database. Retrieved 2008-11-23. 
  21. ^ Behavior — Herring Gull — Birds of North America Online
  22. ^ a b Harris, Paul (1 July 2004). "Gulls bringing fear to inland towns". The Daily Mail. Retrieved 2009-06-16. 
  23. ^ a b c d e Rock, Peter (May 2003). "Birds of a feather flock together". Envir Health Journ. Retrieved 2009-06-15. 
  24. ^ "Lethal Bird Control (Culling)". Pigeon Control Advisory Service. Retrieved 17 May 2011. 
  25. ^ a b "Guidance Note on applications for a licence to control gulls". Natural England - Wildlife Management & Licensing. Retrieved 18 June 2010. 
  26. ^ Fitch, Davey. "Red alert for one fifth of UK's bird species!". The Royal Society for the Protection of Birds. Retrieved 18 June 2010. 
  • AERC TAC's Taxonomic Recommendations
  • Harris, Alan; Tucker, Laurel & Vinicombe, Keith (1994) The Macmillan Field Guide to Bird Identification, Macmillan, London.
  • Seabirds by Harrison, ISBN 0-7470-1410-8
  • Snow, D. W. & Perrins, C. M. (1998) Birds of the Western Palearctic: Concise Edition Vol. 1. Oxford University Press, Oxford.

Further references [edit]

Leakey, Richard. 1979. Abridged and Introduced. The Illustrated Origin of Species. Darwin,Charles. Faber and Faber.ISBN 0-571-11477-6.p.64

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes the North American L. smithsonianus, separated as a species by Pons et al. (2005) and the Siberian L. vegae, separated as a distinct species by Crochet et al. (2002). Considered conspecific with Eurasian L. cachinnans by some authors; also has been considered conspecific with several other species (AOU 1983). Hybridization with L. hyperboreus in Iceland has been suggested, but morphological data indicate that the variably plumaged Icelandic herring gulls reflect intraspecific variation not hybridization (Snell 1991b). Allozyme data indicate a very close overall genetic similarity among L. argentatus, L. cachinnans, L. fuscus, L. glaucoides, L. hyperboreus, and L. marinus (Snell 1991a). See Wilds (1992) for a brief discussion of the taxonomy of the herring gull complex.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!