Overview

Distribution

Range Description

The Western Gull is found on the Pacific coast of North America, ranging from Vancouver Island (Canada) to the southern tip of Baja California (Mexico), and breeding from north-west Washington (USA) to central Baja California (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDING: coastally from southwestern British Columbia south to west-central Baja California and Guadalupe Island. NON-BREEDING: southern British Columbia south to southern Baja California; rare in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 64 cm

Weight: 1011 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is essentially confined to the coast, staying on a few kilometres inland. It has a very varied diet, including marine fish and invertebrates, eggs, chicks and adults of seabirds, carrion, spawning salmon, and it may attack and kill newborn seal pups. Some males may establish feeding territories in alcid or cormorant colonies feeding mainly by predation, piracy and scavenging, occupying the same territory year after year. It also drops shellfish on to rocks to break them. It lays from late April or early May, and later in the north, nesting on barren substrates in colonies on rocky islets with some herbaceous cover and gravelly beaches. Some populations are migratory whilst others are sedentary, and individuals tend to disperse depending on food availability (del Hoyo et al. 1996).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 27649 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9407 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 3.285 - 17.265
  Nitrate (umol/L): 0.038 - 4.675
  Salinity (PPS): 30.381 - 33.496
  Oxygen (ml/l): 5.540 - 7.715
  Phosphate (umol/l): 0.330 - 0.800
  Silicate (umol/l): 1.436 - 16.169

Graphical representation

Temperature range (°C): 3.285 - 17.265

Nitrate (umol/L): 0.038 - 4.675

Salinity (PPS): 30.381 - 33.496

Oxygen (ml/l): 5.540 - 7.715

Phosphate (umol/l): 0.330 - 0.800

Silicate (umol/l): 1.436 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: NON-BREEDING: at sea or along the coast; rocky shores and cliffs, bays, estuaries, beaches, garbage dumps. BREEDING: Nests typically on rocky ledges or grassy slopes near beaches on offshore islands; nests in greatest numbers on flatter sections of islands, usually in relatively open areas with bare rock or low vegetation (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Southern populations relatively sedentary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats fish, crustaceans, mollusks, worms, garbage. Catches food, scavenges after ships, or pirates fish from pelicans, cormorants, and other birds. May feed at garbage dumps or along beaches. Sometimes eats eggs and young of other birds (e.g., murres, Spear 1993). See Spear (1988) for information on feeding areas of gulls from Farallon Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Spear (1988) for information on movements of gulls breeding and reared on Farallon Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Clutch size usually 3. Incubation 25-29 days, by both sexes. Young semi-precocial, can fly at about 49 days, independent at average age of 70 days on offshore island; parental care may last longer along coast (Spear et al. 1986). Colonies tend to be small; less than 5 pairs not uncommon; less than 10% of colonies >100 pairs (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Larus occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGCGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTTATCCGTGCAGAACTTGGCCAACCCGGAACCCTCCTAGGAGACGACCAAATCTATAACGTAATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTGATACCAATCATGATCGGTGGGTTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGATATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCCGGCACAGGATGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCTCATGCTGGAGCCTCAGTAGACCTAGCAATCTTCTCTCTTCACTTAGCAGGTGTGTCTTCCATTCTGGGTGCTATCAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATCACTGCCGTCCTATTACTACTTTCACTCCCAGTGCTTGCCGCAGGCATTACTATGCTACTTACAGACCGAAACCTAAACACAACATTCTTCGATCCCGCCGGAGGCGGTGACCCTGTACTGTACCAACACCTCTTTTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Larus occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western Gull

The Western Gull (Larus occidentalis) is a large white-headed gull that lives on the western coast of North America. It was previously considered conspecific, the same species, with the Yellow-footed Gull (Larus livens) of the Gulf of California. The Western Gull ranges from British Columbia, Canada to Baja California, Mexico,[2] and because of its convenient colonies on the coast of California it is well studied. Despite being a well-known bird species on the West Coast of the US, it is of some slight conservation concern given its restricted range (for a gull).

Description[edit]

Western Gull calls, recorded at the Golden Gate National Recreation Area

Problems playing this file? See media help.

The Western Gull is a large gull that can measure 55 to 68 cm (22 to 27 in) in total length, spans 130 to 144 cm (51 to 57 in) across the wings and weighs 800 to 1,400 g (1.8 to 3.1 lb).[3][4] The average mass among a survey of 48 gulls of the species was 1,011 g (2.23 lb).[5] Among standard measurements, the wing chord is 38 to 44.8 cm (15 to 17.6 in), the bill is 4.7 to 6.2 cm (1.9 to 2.4 in) and the tarsus is 5.8 to 7.5 cm (2.3 to 3.0 in).[3] The Western Gull has a white head and body, and gray wings. It has a yellow bill with a red subterminal spot (this is the small spot near the end of the bill that chicks peck in order to stimulate feeding). It closely resembles the Slaty-backed Gull (Larus schistisagus). In the north of its range it forms a hybrid zone with its close relative the Glaucous-winged Gull (Larus glaucescens). Western gulls take approximately four years to reach their full plumage,[6] their layer of feathers and the patterns and colors on the feathers. The Western Gull typically lives about 15 years, but can live to at least 25 years.[citation needed] The largest Western gull colony is on the Farallon Islands, located about 26 mi (40 km) west of San Francisco, California;[7] an estimated 30,000 gulls live in the San Francisco Bay area.[8]

Behavior[edit]

Pair bonding behaviour
Western Gull chick about 3-weeks old flapping its developing wings

The Western Gull is rarely encountered inland or away from the ocean[9] and is almost an exclusively marine gull. It nests on offshore islands and rocks along the coast, and on islands inside estuaries, and a colony also exists on Alcatraz Island in San Francisco Bay. In the colonies, long term pairs aggressively defend territories whose borders may shift slightly from year to year, but are maintained for the life of the male.[citation needed]

Feeding[edit]

Western Gulls feed in pelagic environments, areas in the ocean not near the shore, and in intertidal environments, areas exposed to the air at low tide and underwater at high tide. At sea they take fish[7] and invertebrates like krill, squid and jellyfish. They cannot dive, and feed exclusively on the surface. On land they feed on seal and sea lion carcasses, as well as cockles, starfish, limpets and snails in the intertidal zone. They also feed on human food refuse, in human-altered habitats, including waste landfills, and taking food from people at marinas and beaches. At times some Western Gulls can be predatory, preying on the young of other birds and even adults of some species. One Western Gull at Oakland's Lake Merrit was known for killing and eating pigeons (Rock Doves) on a daily basis. Western Gulls also will snatch a fish from a cormorant's or pelican's mouth before it is swallowed.

Reproduction[edit]

A flock of Western Gulls in Morro Bay, California

A nest of vegetation is constructed inside the territory, and three eggs are laid. These eggs are incubated for a month. The chicks, once hatched, remain inside the territory until they have fledged. Chicks straying into the territory of another gull are liable to be killed by that territory's pair. Chick mortality is high, with on average one chick surviving to fledging. On occasion, abandoned chicks will be adopted by other gulls.

Hybridization[edit]

In Washington state, the Western Gull hybridizes frequently with the Glaucous-winged Gull, and may closely resemble a Thayer's Gull.[9] The hybrids have a flatter and larger head and a thicker bill with a pronounced angle on the lower part of the bill, which distinguishes it from the smaller Thayer's Gull.[9]

Western Gulls and humans[edit]

The Western Gull is currently not considered threatened. However, they have, for a gull, a restricted range. Numbers were greatly reduced in the 19th century by the taking of seabird eggs for the growing city of San Francisco. Western Gull colonies also suffered from disturbance where they were turned into lighthouse stations, or, in the case of Alcatraz, a prison.

Western Gulls are very aggressive when defending their territories and consequently were persecuted by some as a menace. The automating of the lighthouses, and the closing of Alcatraz Prison, allowed the species to reclaim parts of its range. They are currently vulnerable to climatic events like El Niño events and oil spills.

Western Gulls have become a serious nuisance to the San Francisco Giants baseball team. Thousands of gulls fly over AT&T Park in San Francisco during late innings of games. They swarm the field, defecate on fans, and after games eat leftovers of stadium food in the seats; how the birds know when games are about to end is unknown. The gulls left while a red-tailed hawk visited the park in late 2011, but returned after the hawk disappeared. Federal law prohibits shooting the birds, and hiring a falconer would cost the Giants $8,000 a game.[8]

Gallery[edit]

In California with a crab in beak
At the Port of Ensenada, Baja California, Mexico
A western Gull chick on Alcatraz Island, San Francisco
An up close view of the Western Gull
A Western Gull in California
Feeding on a Starfish
A squawking Western Gull
Dozens of Western Gulls feeding on the afterbirth of an Elephant Seal

In media[edit]

The Western Gull was one of the antagonists in Alfred Hitchcock's famous movie, The Birds, which was filmed in Bodega Bay, California.

References[edit]

  1. ^ BirdLife International (2012). "Larus occidentalis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Western Gull". U.S. National Audubon Society. Accessed July 2010.
  3. ^ a b Gulls: Of North America, Europe, and Asia by Klaus Malling Olsen & Hans Larsson. Princeton University Press (2004). ISBN 978-0691119977.
  4. ^ Harrison, Peter, Seabirds: An Identification Guide. Houghton Mifflin Harcourt (1991), ISBN 978-0-395-60291-1
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  6. ^ "Western Gull". BirdWeb: Seattle Audubon Society for Birds and Nature. Accessed July 2010.
  7. ^ a b Emslie, Steven D. and Messenger, Sharon L. (March 1991). "Pellet and Bone Accumulation at a Colony of Western Gulls". Volume 11, number 1: pages 133-136. Journal of Vertebrate Paleontology. Accessed July 2010.
  8. ^ a b Rogers, Paul (2013-07-20). "AT&T Park gulls vex San Francisco Giants". San Jose Mercury News. Retrieved 20 July 2013. 
  9. ^ a b c "Western Gull, Life History, All About Birds". The Cornell Lab of Ornithology. Accessed July 2010.

Additional sources[edit]

  • Pierotti, R. J., and C. A. Annett. 1995. Western Gull (Larus occidentalis). In The Birds of North America, No. 174 (A. Poole and F. Gill, eds.). The Academy of Natural Sciences, Philadelphia, and The American Ornithologists’ Union, Washington, D.C.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Closely related to several other species within the Larus californicus complex; this complex poses one of the most complicated problems in ornithological systematics today. Frequently hybridizes (and may be conspecific) with L. glaucescens from southern British Columbia to western Oregon (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!