Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Comprehensive Description

They have long pink legs, a long thin black bill and are blackish above and white below, with a white head and neck with a varying amount of black. Males have a black back, often with greenish gloss. Females' backs have a brown hue, contrasting with the black remiges. In the populations that have the top of the head normally white at least in winter, females tend to have less black on head and neck all year round, while males often have much black, particularly in summer. This difference is not clear-cut, however, and males usually get all-white heads in winter. Immature birds are grey instead of black and have a markedly sandy hue on the wings, with light feather fringes appearing as a whitish line in flight.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Mediterranean and sub-Saharan Africa to SE Asia and Taiwan.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    * himantopus (Linnaeus, 1758) - France and Iberia S to sub-Saharan Africa and Madagascar, and E to C Asia and NC China, Indian Subcontinent, Indochina and Taiwan. * leucocephalus Gould, 1837 - Java E to New Guinea, and S to Australia and New Zealand; winters N to Philippines, Greater Sundas and Sulawesi. * knudseni Stejneger, 1887 - Hawaiian Is. * mexicanus (P. L. S. Müller, 1776) - W & S USA through Central America and West Indies to SW Peru, E Ecuador and NE Brazil. * melanurus Vieillot, 1817 - N Chile and EC Peru through Bolivia and Paraguay to SE Brazil, and S to SC Argentina.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Adults are 33-36 cm long.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 38 cm. Plumage: white with glossy black wings and back in male, less glossy in female; deep white V between wings; sometimes dark grey on crown of male, less so in female. Immature brown where adults black, sepia brown from crown to back and wings; extensive buff feather tipping. Bare parts: iris ruby red; bill black; feet and legs pinkish to red in adult, greyish pink in immature. Habitat: shallow waters of muddy creeks and estuaries or salt pans and inland waters. Resident, breeds in Africa, some palearctic migrants. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

They have long pink legs, a long thin black bill and are blackish above and white below, with a white head and neck with a varying amount of black. Males have a black back, often with greenish gloss. Females' backs have a brown hue, contrasting with the black remiges. In the populations that have the top of the head normally white at least in winter, females tend to have less black on head and neck all year round, while males often have much black, particularly in summer. This difference is not clear-cut, however, and males usually get all-white heads in winter. Immature birds are grey instead of black and have a markedly sandy hue on the wings, with light feather fringes appearing as a whitish line in flight.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Northern populations of this species make long-distance migratory movements, travelling southwards to their wintering grounds between August and November and returning to their breeding areas between March and April (Hayman et al. 1986). In more temperate regions the species is sedentary or only locally dispersive however (del Hoyo et al. 1996). The species breeds solitarily or in loose colonies of 2-50 or occasionally up to several hundred pairs (Urban et al. 1986, del Hoyo et al. 1996). It is typically a gregarious species, occurring in small groups (Snow and Perrins 1998) (up to 15 individuals) (Urban et al. 1986, del Hoyo et al. 1996) or larger flocks of several hundred up to a thousand individuals on migration, during the winter (Urban et al. 1986, Snow and Perrins 1998) and at nightly roosts (Urban et al. 1986). Habitat Breeding The species typically breeds in shallow freshwater and brackish wetlands with sand, mud or clay substrates and open margins, islets or spits near water level (Snow and Perrins 1998). Suitable habitats include marshes and swamps, shallow lake edges, riverbeds, flooded fields (del Hoyo et al. 1996), irrigated areas (Snow and Perrins 1998), sewage ponds (del Hoyo et al. 1996) and fish-ponds (Snow and Perrins 1998). The species may also breed around alkaline and high-altitude (montane) lakes (del Hoyo et al. 1996) or in more saline environments such as river deltas, estuaries (Snow and Perrins 1998), coastal lagoons (Johnsgard 1981, Snow and Perrins 1998) and shallow coastal pools with extensive areas of mudflats, salt meadows (Johnsgard 1981), saltpans, coastal marshes (del Hoyo et al. 1996) and swamps (Snow and Perrins 1998). Non-breeding Outside of the breeding season the species occupies the shores of large inland waterbodies and estuarine or coastal habitats (del Hoyo et al. 1996) such as river deltas (Snow and Perrins 1998), coastal lagoons (Johnsgard 1981, Snow and Perrins 1998) and shallow freshwater or brackish pools with extensive areas of mudflats, salt meadows (Johnsgard 1981), saltpans, coastal marshes (del Hoyo et al. 1996) and swamps (Snow and Perrins 1998). Diet Its diet is strongly seasonal (del Hoyo et al. 1996) but generally includes adult and larval aquatic insects (e.g. Coleoptera, Ephemeroptera, Trichoptera, Hemiptera, Odonata, Diptera, Neuroptera and Lepidoptera), molluscs, crustaceans, spiders, oligochaete and polychaete worms, tadpoles (del Hoyo et al. 1996) and amphibian spawn (Urban et al. 1986), small fish, fish eggs (del Hoyo et al. 1996) and occasionally seeds (Urban et al. 1986). Breeding site The nest is a depression (Flint et al. 1984) or shallow scrape positioned on hard ground near water on a hummock (Flint et al. 1984) or amongst grass and sedge (del Hoyo et al. 1996). Alternatively the nest may be a more elaborate platform of vegetation (Snow and Perrins 1998) constructed on a floating mass of aquatic vegetation (del Hoyo et al. 1996). The species nests singly or in loose colonies (del Hoyo et al. 1996), showing a preference for open areas close to foraging sites with good all-round (360 degree) visibility (Johnsgard 1981).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The breeding habitat of all these stilts is marshes, shallow lakes and ponds. Some populations are migratory and move to the ocean coasts in winter; those in warmer regions are generally resident or short-range vagrants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

These birds pick up their food from sand or water. They mainly eat insects and crustaceans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild) Observations: Oldest bird in banding studies was 10.2 years of age (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The nest site is a bare spot on the ground near water. These birds often nest in small groups, sometimes with Avocets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Himantopus himantopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATCAACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATACCTAATCTTCGGCGCATGAGCCGGTATAGTTGGTACCGCCCTCAGCTTACTCATCCGTGCAGAACTAGGCCAACCAGGGACCCTACTAGGAGACGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATGATCTTCTTCATGGTCATACCAATTATGATCGGCGGATTCGGAAACTGACTAGTACCACTCATAATTGGCGCTCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTACTCCTCCTCGCCTCCTCTACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTATATCCCCCCTTAGCTGGCAATTTAGCCCACGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACTTAGCAGGTGTATCCTCCATCCTAGGCGCAATCAACTTCATCACAACTGCTATCAACATAAAACCACCCGCCCTTTCACAATACCAAACCCCTCTATTCGTTTGATCTGTCCTCATCACCGCCGTCTTATTACTCCTATCACTCCCAGTCCTAGCCGCTGGCATTACCATACTACTAACAGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGTGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCTTAATCCTACCCGGCTTCGGAATCATCTCCCACGTAGTAACATACTACGCGGGCAAAAAAGAACCCTTCGGCTACATAGGAATGGTATGAGCCATACTATCAATTGGATTCCTAGGCTTCATTGTTTGAGCCCACCACATGTTTACAGTAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantopus himantopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.450,000-780,000 individuals (Wetlands International 2006), while national population estimates include: c.100-10,000 breeding pairs and c.1,000-10,000 individuals on migration in China; c.100-10,000 breeding pairs, c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in Taiwan; c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Korea; c.100-10,000 breeding pairs and c.50-10,000 individuals on migration in Japan and < c.10,000 breeding pairs < c.50 individuals on migration in Russia (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is susceptible to avian influenza (Melville and Shortridge 2006) and avian botulism (Blaker 1967, van Heerden 1974) so may be threatened by future outbreaks of these diseases.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black-winged stilt

The black-winged stilt, common stilt, or pied stilt (Himantopus himantopus) is a widely distributed very long-legged wader in the avocet and stilt family (Recurvirostridae). Opinions differ as to whether the birds treated under the scientific name H. himantopus ought to be treated as a single species and if not, how many species to recognize. The scientific name Himantopus comes from the Greek meaning "strap foot" or "thong foot".[2] Most sources today accept 2–4 species.[3][4][5][6][7][8]

Description[edit]

Adults are 33–36 cm long. They have long pink legs, a long thin black bill and are blackish above and white below, with a white head and neck with a varying amount of black. Males have a black back, often with greenish gloss. Females' backs have a brown hue, contrasting with the black remiges. In the populations that have the top of the head normally white at least in winter, females tend to have less black on head and neck all year round, while males often have much black, particularly in summer. This difference is not clear-cut, however, and males usually get all-white heads in winter.

Immature birds are grey instead of black and have a markedly sandy hue on the wings, with light feather fringes appearing as a whitish line in flight.

Recorded in China

Problems playing this file? See media help.

Taxonomy and systematics[edit]

The taxonomy of this bird is still somewhat contentious. Some describe as many as five distinct species; others consider some or all of these to be subspecies. In addition, two dubious subspecies are also sometimes listed, but not as independent species. In the most extensive circumscription, with one species and 5–7 subspecies, this bird is often called common stilt. The name black-winged stilt on the other hand can specifically refer to the Old World nominate subspecies. The commonly accepted taxa are:

W Europe and Mediterranean region to Central Asia, sub-Saharan Africa and Madagascar, South and Southeast Asia; localized breeder in East Asia (e.g. Taiwan) but more widespread during winter; has become a regular migrant to the Marianas and Saipan and sometimes is seen on other islands in western Micronesia (e.g. Koror, Ngeriungs Islet and Peleliu of Palau) since the late 20th-century.[9][10][11] NW populations migrate south to Africa in winter.
Head and neck vary from all-white to white with all-black cap and hindneck, usually with white band across upper back. Sometimes vestigial open black chest band.
Southern North America through Central America and Caribbean to N Peru and NE Brazil. Northernmost populations migrate south in winter. Intergrades with white-backed stilt in C Brazil.
Head and neck always white with black cap down to the eyeline, white spot above eye, black hindneck. Usually no white band across upper back. Often vestigial open black chest band.
South America from C Peru and N Chile to SE Brazil and south to SC Argentina. Intergrades with black-necked stilt in C Brazil.
Head and neck usually white with black hindneck and a black line from the nape to the eye. Usually has open black chest band and a white band across upper back.
Adult white-headed stilt wading
Java to New Guinea, Australia and New Zealand. Southern population winter in the Philippines region.
Head usually all-white, neck white, black behind and with open black chest band. Usually a white band across upper back.
Hawaiian Islands, where it is the only breeding shorebird
Generally similar to black-necked stilt, but black on head and neck more extensive, usually extending below the eye.

Ecology and status[edit]

The breeding habitat of all these stilts is marshes, shallow lakes and ponds. Some populations are migratory and move to the ocean coasts in winter; those in warmer regions are generally resident or short-range vagrants. In Europe, the Black-winged Stilt is a regular spring overshoot vagrant north of its normal range, occasionally remaining to breed in northern European countries, for example in Britain in 1987.[12]

These birds pick up their food from sand or water. They mainly eat insects and crustaceans.

The nest site is a bare spot on the ground near water. These birds often nest in small groups, sometimes with avocets.

The Hawaiian population is endangered due to habitat loss and probably also introduced predators. The IUCN recognizes 3 species at present, merging the Hawaiian and South American birds with the Black-necked Stilt; consequently, none of the three is listed as a threatened species.[3][4][5] The Black-winged Stilt is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds applies.

Immature plumages and flight view[edit]

References[edit]

  1. ^ BirdLife International (2012). "Himantopus himantopus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Jobling, James (2010). Helm Dictionary of Scientific Bird Names. London: Helm. p. 191. 
  3. ^ a b BirdLife International (BLI) (2008a). Himantopus himantopus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2 January 2009.
  4. ^ a b BirdLife International (BLI) (2008b). Himantopus leucocephalus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2 January 2009.
  5. ^ a b BirdLife International (BLI) (2008c). Himantopus mexicanus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2 January 2009.
  6. ^ BirdLife International (BLI) [2008d]: Black-necked Stilt Species Factsheet. Retrieved 2008-SEP-24.
  7. ^ BirdLife International (BLI) [2008e]: Black-winged Stilt Species Factsheet. Retrieved 2008-SEP-24.
  8. ^ BirdLife International (BLI) [2008f]: White-headed Stilt Species Factsheet. Retrieved 2008-SEP-24.
  9. ^ VanderWerf, Eric A.; Wiles, Gary J.; Marshall, Ann P. & Knecht, Melia (2006): Observations of migrants and other birds in Palau, April–May 2005, including the first Micronesian record of a Richard's Pipit. Micronesica 39(1): 11–29. PDF fulltext
  10. ^ Wiles, Gary J.; Worthington, David J.; Beck, Robert E. Jr.; Pratt, H. Douglas; Aguon, Celestino F. & Pyle, Robert L. (2000): Noteworthy Bird Records for Micronesia, with a Summary of Raptor Sightings in the Mariana Islands, 1988–1999. Micronesica 32(2): 257–284. PDF fulltext
  11. ^ Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004): New and Noteworthy Bird Records for Micronesia, 1986–2003. Micronesica 37(1): 69–96. HTML abstract
  12. ^ Boyd, Bill (1987): The Black-winged Stilts at Holme Norfolk Naturalists' Trust reserve. Twitching 1(6): 148–150.

Further reading[edit]

  • Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!