Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Large range but localized. BREEDS: locally on Atlantic coast from mid-Atlantic states south to southern Florida, and from southern Oregon, Idaho, northern Utah, southern Colorado, eastern New Mexico, central Kansas, Gulf Coast of Texas, and southern Louisiana and the Bahamas south through Middle America, Antilles, and most of South America to southern Chile and southern Argentina (AOU 1983); may breed also in eastern Montana and western South Dakota; resident in Hawaii (all main islands except Lanai). Mainly resident south of U.S. Some authors treat populations at the southern end of the range from central to southern South America as a distinct species (H. MELANURUS). NORTHERN WINTER: mostly southern California, southern coastal Texas, and Florida south through breeding range (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; range generally extends from Cape Cod to Peru; it is a rare visitor north of this range
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 36 cm

Weight: 166 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Unmistakable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Moist Pacific Coast Mangroves Habitat

This taxon occurs in the Moist Pacific Coast mangroves, an ecoregion along the Pacific coast of Costa Rica with a considerable number of embayments that provide shelter from wind and waves, thus favouring mangrove establishment. Tidal fluctuations also directly influence the mangrove ecosystem health in this zone. The Moist Pacific Coast mangroves ecoregion has a mean tidal amplitude of three and one half metres,

Many of the streams and rivers, which help create this mangrove ecoregion, flow down from the Talamanca Mountain Range. Because of the resulting high mountain sediment loading, coral reefs are sparse along the Pacific coastal zone of Central America, and thus reef zones are chiefly found offshore near islands. In this region, coral reefs are associated with the mangroves at the Isla del Caño Biological Reserve, seventeen kilometres from the mainland coast near the Térraba-Sierpe Mangrove Reserve. The Térraba-Sierpe, found at the mouths of the Térraba and Sierpe Rivers, is considered a wetland of international importance.

Because of high moisture availability, the salinity gradient is more moderate than in the more northern ecoregion such as the Southern dry Pacific Coast ecoregion. Resulting mangrove vegetation is mixed with that of marshland species such as Dragonsblood Tree (Pterocarpus officinalis), Campnosperma panamensis, Guinea Bactris (Bactris guineensis), and is adjacent to Yolillo Palm (Raphia taedigera) swamp forest, which provides shelter for White-tailed Deer (Odocoileus virginianus) and Mantled Howler Monkeys (Alouatta palliata). Mangrove tree and shrub taxa include Red Mangrove (Rhizophora mangle), Mangle Caballero (R. harrisonii) R. racemosa (up to 45 metres in canopy height), Black Mangrove (Avicennia germinans) and Mangle Salado (A. bicolor), a mangrove tree restricted to the Pacific coastline of Mesoamerica.

Two endemic birds listed by IUCN as threatened in conservation status are found in the mangroves of this ecoregion, one being the Mangrove Hummingbird (Amazilia boucardi EN), whose favourite flower is the Tea Mangrove (Pelliciera rhizophorae), the sole mangrove plant pollinated by a vertebrate. Another endemic avain species to the ecoregion is the  Yellow-billed Cotinga (Carpodectes antoniae EN).  Other birds clearly associated with the mangrove habitat include Roseate Spoonbill (Ajaia ajaja), Gray-necked Wood Rail (Aramides cajanea), Rufous-necked Wood Rail (A. axillaris), Mangrove Black-hawk (Buteogallus anthracinus subtilis),Striated Heron (Butorides striata), Muscovy Duck (Cairina moschata), Boat-billed Heron (Cochlearius cochlearius), American White Ibis (Eudocimus albus), Amazon Kingfisher (Chloroceryle amazona), Mangrove Cuckoo (Coccyzus minor), Yellow Warbler (Setophaga petechia), and Black-necked Stilt (Himantopus mexicanus VU) among other avian taxa.

Mammals although not as numerous as birds, include species such as the Lowland Paca (Agouti paca), Mantled Howler Monkey (Alouatta palliata), White-throated Capuchin (Cebus capucinus), Silky Anteater (Cyclopes didactylus), Central American Otter (Lontra longicaudis annectens), White-tailed Deer (Odocoileus virginianus), feeds on leaves within A. bicolor and L. racemosa forests. Two raccoons: Northern Raccoon (Procyon lotor) and Crab-eating Raccoon (P. cancrivorus) can be found, both on the ground and in the canopy consuming crabs and mollusks. The Mexican Collared Anteater (Tamandua mexicana) is also found in the Moist Pacific Coast mangroves.

There are a number of amphibians in the ecoregion, including the anuran taxa: Almirante Robber Frog (Craugastor talamancae); Chiriqui Glass Frog (Cochranella pulverata); Forrer's Grass Frog (Lithobates forreri), who is found along the Pacific versant, and is at the southern limit of its range in this ecoregion. Example salamanders found in the ecoregion are the Colombian Worm Salamander (Oedipina parvipes) and the Gamboa Worm Salamander (Oedipina complex), a lowland organism that is found in the northern end of its range in the ecoregion. Reptiles including the Common Basilisk Lizard (Basiliscus basiliscus), Boa Constrictor (Boa constrictor), American Crocodile (Crocodilus acutus), Spectacled Caiman (Caiman crocodilus), Black Spiny-tailed Iguana (Ctenosaura similis) and Common Green Iguana (Iguana iguana) thrive in this mangrove ecoregion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Shallow salt or fresh water with soft muddy bottom; grassy marshes, wet savanna, mudflats, shallow ponds, flooded fields, borders of salt ponds and mangrove swamps (Tropical to Temperate zones) (AOU 1983, Raffaele 1983).

Nests along shallow water of ponds, lakes, swamps, or lagoons. May nest on the ground or in shallow water on a plant tussock.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Mainly resident south of U.S., though of variable abundance in winter in Puerto Rico (Raffaele 1983). Interior U.S. breeding populations make extensive seasonal migrations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds actively in shallow water; plucks food from surface of water or mud, or probes in soft mud; may peck or sweep bill to capture prey in water (Cullen, 1994, Wilson Bull. 106:508-513). Eats a variety of insects (e.g., bugs, beetles, caddisflies, mosquito larvae, grasshoppers), polychaetes, crustaceans, snails. Also feeds on some small fishes as well as the seeds of aquatic plants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total population estimated to be a minimum of 850,000, based on data from six of 10 populations. North American population estimate is 150,000 (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Social; usually in loose groups of up to 50 (Costa Rica, Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.1 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both adults, in turn, incubate 4 eggs about 25 days (Terres 1980). Nestlings are precocial. Young are tended by both adults, independent in about 4 weeks (Harrison 1978), first fly at 7-8 weeks (Berger 1981). Nests in small colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Himantopus mexicanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCTTATACCTAATCTTCGGCGCATGAGCCGGTATAGTTGGTACCGCCCTTAGCTTACTCATCCGTGCAGAACTAGGCCAACCAGGGACCCTACTAGGAGAT---GACCAAATCTACAATGTAATCGTCATTGCCCATGCCTTCGTAATGATCTTCTTCATGGTCATACCAATTATGATCGGCGGATTCGGAAACTGACTAGTACCACTCATAATTGGCGCTCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTACTCCTCCTCGCCTCCTCTACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTATATCCCCCCTTAGCTGGTAATTTAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACTTAGCAGGTGTATCCTCTATCCTAGGCGCAATCAACTTCATCACAACTGCTATCAACATAAAACCACCCGCCCTTTCACAATACCAAACCCCTCTATTCGTCTGATCTGTCCTCATCACCGCCGTCTTATTACTCCTATCACTCCCAGTCCTAGCCGCTGGCATTACCATGCTACTAACAGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGTGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCTTAATCCTACCCGGCTTCGGAATCATCTCCCACGTAGTAACATACTACGCGGGCAAAAAAGAACCCTTCGGCTACATAGGAATGGTATGAGCCATACTATCAATTGGATTCCTAGGCTTCATTGTTTGAGCCCACCACATATTTACAGTAGGGATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantopus mexicanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2B - Imperiled

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Globally secure due primarily to large range, but occurrence tends to be much localized; population trends are poorly known for many regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black-necked Stilt

The black-necked stilt (Himantopus mexicanus) is a locally abundant shorebird of American wetlands and coastlines. It is found from the coastal areas of California through much of the interior western United States and along the Gulf of Mexico as far east as Florida, then south through Central America and the Caribbean to northwest Brazil southwest Peru, east Ecuador and the Galápagos Islands. The northernmost populations, particularly those from inland, are migratory, wintering from the extreme south of the United States to southern Mexico, rarely as far south as Costa Rica; on the Baja California peninsula it is only found regularly in winter.[2]

Taxonomy[edit]

Black-necked stilt of Quintana, Texas

It is often treated as a subspecies of the common or black-winged stilt, using the trinomial name Himantopus himantopus mexicanus.[3] However, the AOU has always considered it a species in its own right, and the scientific name Himantopus mexicanus is often seen. Matters are more complicated though; sometimes all five distinct lineages of the Common Stilt are treated as different species. But the White-necked Stilt from southern South America (H. h. melanurus when only one species is recognized), parapatric and intergrading to some extent with its northern relative where their ranges meet, would warrant inclusion with the Black-necked stilt when this is separated specifically, becoming Himantopus mexicanus melanurus. Similarly, the Hawaiian stilt, H. m. knudseni, is likely to belong to the American species when this is considered separate; while some treat it as another distinct species, the AOU, BirdLife International and the IUCN do not.[4] Thus, in their scheme the black-necked stilt is properly named Himantopus mexicanus mexicanus.[5]

Description[edit]

Flying in California, USA
Calls from an agitated black-necked stilt in Palo Alto, California

Problems playing this file? See media help.

Adults have long pink legs and a long thin black bill. They are white below and have black wings and backs. The tail is white with some grey banding. A continuous area of black extends from the back along the hindneck to the head. There, it forms a cap covering the entire head from the top to just below eye-level, with the exception of the areas surrounding the bill and a small white spot above the eye. Males have a greenish gloss to the back and wings, particularly in the breeding season. This is less pronounced or absent in females, which have a brown tinge to these areas instead. Otherwise, the sexes look alike.[5]

Downy young are light olive brown with lengthwise rows of black speckles (larger on the back) on the upperparts – essentially where adults are black – and dull white elsewhere, with some dark barring on the flanks.[5]

Where their ranges meet in central Brazil, the black-necked and white-backed stilts intergrade. Such individuals often have some white or grey on top of the head and a white or grey collar separating the black of the hindneck from that of the upper back.

The black-necked stilt is distinguished from non-breeding vagrants of the Old World black-winged stilt by the white spot above the eye. Vagrants of the northern American form in turn is hard to tell apart from the resident Hawaiian stilt, in which only the eye-spot is markedly smaller. But though many stilt populations are long-distance migrants and during their movements can be found hundreds of miles offshore,[6] actual trans-oceanic vagrants are nonetheless a rare occurrence.[5]

Distribution and habitat[edit]

The Hawaiian stilt is sometimes considered a subspecies of the black-necked stilt.

The black-necked stilt is found in estuarine, lacustrine, salt pond and emergent wetland habitats; it is generally a lowland bird but in Central America has been found up to 8,200 ft (2,500 m) ASL and commonly seen in llanos habitat in northern South America.[5] It is also found in seasonally flooded wetlands. Use of salt evaporation ponds has increased significantly since 1960 in the USA, and they may now be the primary wintering habitat; these salt ponds are especially prevalent in southern San Francisco Bay. At the Salton Sea, the black-necked stilt is resident year-round.[7]

This bird is locally abundant in the San Joaquin Valley, where it commonly winters.[8] It is common to locally abundant in appropriate habitat in southern California from April to September.[7]

It also breeds along lake shores in northeastern California and southeastern Oregon as well as along the Colorado River. In North America outside California, the black-necked stilt rarely breeds inland, but it is known as a breeding bird in riparian locales in Arizona[9] and elsewhere in the southern USA. In Arizona, black-necked stilts may be seen along artificially created lakes and drainage basins in the Phoenix metropolitan area, in remnant riparian habitat.

In the San Francisco Bay Area, specific locations where one would expect to see this bird are Richardson Bay (especially, according to mudflat bird sightings, the mouth of Pickleweed Creek),[10] mudflats of Belmont Slough, mudflats of Seal Slough in San Mateo, salt ponds in Hayward, California, exposed bay muds on the Burlingame estuarine shore, and Heron's Head Park at India Basin.

For the populations that summer in the Sierra Nevada of northeast California and southeastern Oregon as well as the plateau lakes of those areas, breeding occurs after those flocks migrate to lowland and coastal areas each August or September[verification needed]. For flocks that summer in the northern Central Valley of California, a migration occurs to the San Joaquin Valley to consolidate with flocks that were already summering there. In coastal areas flocks both summer and winter in these estuarine settings.

Fall migration of the northernly birds takes place from July to September, and they return to the breeding grounds between March and May. Usually, the entire population breeding at any one site arrives, mates, incubates eggs for about a month, and protects and broods the young until they are capable of sustained flight (at 27–31 days old) and leaves again migrating in flocks of about 15 individuals sometimes juveniles congregating in small groups and other times siblings with family groups.[11][12] There is some seasonal movement of the tropical populations, but this is not long-range and poorly understood.[5]

The parasitic cyclocoeline flatworm Neoallopyge americanensis was described from the air sacs of a black-necked stilt from Texas. Its genus is presently monotypic and seems to be closely related to the similar genus Allopyge, found in Old World cranes.[13]

Food and feeding[edit]

Black-necked stilts foraging on Richardson Bay mudflats

The black-necked stilt forages by probing and gleaning primarily in mudflats and lakeshores, but also in very shallow waters near shores; it seeks out a range of aquatic invertebrates – mainly crustaceans and other arthropods, and mollusks – and small fish, tadpoles and very rarely plant seeds. Its mainstay food varies according to availability; inland birds usually feed mainly on aquatic insects and their larvae, while coastal populations mostly eat other aquatic invertebrates. For feeding areas they prefer coastal estuaries, salt ponds, lakeshores, alkali flats and even flooded fields.[7] For roosting and resting needs, this bird selects alkali flats (even flooded ones), lake shores, and islands surrounded by shallow water.[5]

Breeding[edit]

Black-necked stilt eggs Quintana, Texas
Hatchling of the black-winged stilt, H. (h.) himatopus.
Those of the black-winged stilt look identical.

This stilt chooses mudflats, desiccated lacustrine verges, and levees for nest locations, as long as the soil is friable. Reproduction occurs from late April through August in North America, with peak activity in June,[14] while tropical populations usually breed after the rainy season. The nests are typically sited within 1 km (0.62 mi) of a feeding location, and the pairs defend an extensive perimeter around groups of nests, patrolling in cooperation with their neighbors.[15] Spacing between nests is approximately 65 ft (20 m), but sometimes nests are within 7 ft (2.1 m) of each other and some nests in the rookery are as far as 130 ft (40 m) from the nearest neighbor. The black-necked stilt is actually classified as semicolonial since the nests are rarely found alone and colonies usually number dozens, rarely hundreds of pairs.[16] The nests are frequently established rather close to the water edge, so that their integrity is affected by rising water levels of ponds or tides. This is particularly a hazard in the case of managed salt ponds where water levels may be altered rapidly in the salt pond flooding process.[5][17]

The clutch size generally is 3–5 eggs with an average of four. For 22–26 days both sexes take turns incubating the eggs. The young are so precocial that they are seen swimming within two hours after hatching[18] and are also capable of rapid land velocity at that early time. In spite of this early development the young normally return to the nest for resting for one or two more days. They fledge after about one month but remain dependent on their parents for some more weeks. Birds begin to breed at 1–2 years of age.[5]

Status[edit]

Particularly the North American populations of the black-necked stilt have somewhat declined in the 20th century, mainly due to conversion of habitat for human use and pollution affecting both the birds directly as well as their food stocks. But altogether, the population is healthy and occurs over a large range. This stilt is therefore classified as a Species of Least Concern by the IUCN.[19] The Hawaiian stilt, separated with the black-necked stilt in a distinct species by some (including the IUCN), is very rare however and numbers less than 2,000 individuals.[5] Predation by the small Indian mongoose (Herpestes javanicus auropunctatus), introduced to hunt rats, is suspected to have contributed to its decline.[20]

Notes[edit]

  1. ^ BirdLife International (2013). "Himantopus mexicanus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 15 April 2014. 
  2. ^ Pierce (1996), Sibley (2003)
  3. ^ E.g. Pierce (1996)
  4. ^ Though the IUCN considers the white-necked stilt a separate species, this is likely to change at the next revision: BLI (2004ab, [2008])
  5. ^ a b c d e f g h i j Pierce (1996)
  6. ^ E.g. as a casual visitor on Clarión in the Revillagigedo Islands: Brattstrom & Howell (1953)
  7. ^ a b c Garrett & Dunn (1981)
  8. ^ McCaskie et al. (1979)
  9. ^ Corman & Wise-Gervais (2005)
  10. ^ Ransom et al. (1984)
  11. ^ Robinson, Julie A., J. Michael Reed, Joseph P. Skorupa and Lewis W. Oring. 1999. Black-necked Stilt (Himantopus mexicanus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: bna.birds.cornell.edu/bna/species/449
  12. ^ Sordahl, T. A. 1980. Antipredator behavior and parental care in the American Avocet and Black-necked Stilt (Aves: Recurvirostridae). Phd Thesis. Utah State Univ. Logan.
  13. ^ Dronen et al. (2006)
  14. ^ Bent (1927)
  15. ^ Hamilton (1975)
  16. ^ Zeiner et al. (1988)
  17. ^ Rigney & Rigney (1981)
  18. ^ Harrison (1978)
  19. ^ BLI (2004b)
  20. ^ Hays & Conant (2007)

References[edit]

Further reading[edit]

  • Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Black-necked Stilt

The Black-necked Stilt (Himantopus mexicanus) is a locally abundant shorebird of American wetlands and coastlines. It is found from the coastal areas of California through much of the interior western United States and along the Gulf of Mexico as far east as Florida, then south through Central America and the Caribbean to NW Brazil SW Peru, E Ecuador and the Galápagos Islands. The northernmost populations, particularly those from inland, are migratory, wintering from the extreme south of the USA to southern Mexico, rarely as far south as Costa Rica; on the Baja California peninsula it is only found regularly in winter.[1]

Contents

Taxonomy

Black-necked Stilt of Quintana, Texas
The Hawaiian Stilt is sometimes considered a subspecies of the Black-necked Stilt.

It is often treated as a subspecies of the Common or Black-winged Stilt, using the trinomial name Himantopus himantopus mexicanus.[2] However, the AOU has always considered it a species in its own right, and the scientific name Himantopus mexicanus is often seen. Matters are more complicated though; sometimes all five distinct lineages of the Common Stilt are treated as different species. But the White-necked Stilt from southern South America (H. h. melanurus when only one species is recognized), parapatric and intergrading to some extent with its northern relative where their ranges meet, would warrant inclusion with the Black-necked stilt when this is separated specifically, becoming Himantopus mexicanus melanurus. Similarly, the Hawaiian Stilt, H. h. knudseni, is likely to belong to the American species when this is considered separate; while some treat it as another distinct species, the AOU, BirdLife International and the IUCN do not.[3] Thus, in their scheme the Black-necked Stilt is properly named Himantopus mexicanus mexicanus.[4]

Description

Flying in San Francisco Bay, USA

Adults have long pink legs and a long thin black bill. They are white below and have black wings and backs. The tail is white with some grey banding. A continuous area of black extends from the back along the hindneck to the head. There, it forms a cap covering the entire head from the top to just below eye-level, with the exception of the areas surrounding the bill and a small white spot above the eye. Males have a greenish gloss to the back and wings, particularly in the breeding season. This is less pronounced or absent in females, which have a brown tinge to these areas instead. Otherwise, the sexes look alike.[4]

Downy young are light olive brown with lengthwise rows of black speckles (larger on the back) on the upperparts – essentially where adults are black – and dull white elsewhere, with some dark barring on the flanks.[4]

Where their ranges meet in central Brazil, the Black-necked and White-backed stilts intergrade. Such individuals often have some white or grey on top of the head and a white or grey collar separating the black of the hindneck from that of the upper back.

The Black-necked Stilt is distinguished from non-breeding vagrants of the Old World Black-winged Stilt by the white spot above the eye. Vagrants of the northern American form in turn is hard to tell apart from the resident Hawaiian Stilt, in which only the eye-spot is markedly smaller. But though many stilt populations are long-distance migrants and during their movements can be found hundreds of miles offshore,[5] actual trans-oceanic vagrants are nonetheless a rare occurrence.[4]

Distribution and habitat

The Black-necked Stilt is found in estuarine, lacustrine, salt pond and emergent wetland habitats; it is generally a lowland bird but in Central America has been found up to 8,200 ft (2,500 m) ASL and commonly seen in llanos habitat in northern South America.[4] It is also found in seasonally flooded wetlands. Use of salt evaporation ponds has increased significantly since 1960 in the USA, and they may now be the primary wintering habitat; these salt ponds are especially prevalent in southern San Francisco Bay. At the Salton Sea, the Black-necked Stilt is resident year-round.[6]

This bird is locally abundant in the San Joaquin Valley, where it commonly winters.[7] It is common to locally abundant in appropriate habitat in southern California from April to September.[6]

It also breeds along lake shores in northeastern California and southeastern Oregon as well as along the Colorado River. In North America outside California, the Black-necked Stilt rarely breeds inland, but it is known as a breeding bird in riparian locales in Arizona[8] and elsewhere in the southern USA. In Arizona, Black-necked Stilts may been seen along artificially created lakes and drainage basins in the Phoenix metropolitan area, in remnant riparian habitat.

In the San Francisco Bay Area, specific locations where one would expect to see this bird are Richardson Bay (especially, according to mudflat bird sightings, the mouth of Pickleweed Creek),[9] mudflats of Belmont Slough, mudflats of Seal Slough in San Mateo, salt ponds in Hayward, California, exposed bay muds on the Burlingame estuarine shore, and Heron's Head Park at India Basin.

For the populations that summer in the Sierra Nevada of northeast California and southeastern Oregon as well as the plateau lakes of those areas, breeding occurs after those flocks migrate to lowland and coastal areas each August or September[verification needed]. For flocks that summer in the northern Central Valley of California, a migration occurs to the San Joaquin Valley to consolidate with flocks that were already summering there. In coastal areas flocks both summer and winter in these estuarine settings.

Fall migration of the northernly birds takes place from July to September, and they return to the breeding grounds between March and May Usually, the entire population breeding at any one site arrives and leaves again within one month or less, migrating in flocks of about 15 individuals. There is some seasonal movement of the tropical populations, but this is not long-range and poorly understood.[4]

The parasitic cyclocoeline flatworm Neoallopyge americanensis was described from the air sacs of a Black-necked Stilt from Texas. Its genus is presently monotypic and seems to be closely related to the similar genus Allopyge, found in Old World cranes.[10]

Food and feeding

Black-necked Stilts foraging on Richardson Bay mudflats

The Black-necked Stilt forages by probing and gleaning primarily in mudflats and lakeshores, but also in very shallow waters near shores; it seeks out a range of aquatic invertebrates – mainly crustaceans and other arthropods, and mollusks – and small fish, tadpoles and very rarely plant seeds. Its mainstay food varies according to availability; inland birds usually feed mainly on aquatic insects and their larvae, while coastal populations mostly eat other aquatic invertebrates. For feeding areas they prefer coastal estuaries, salt ponds, lakeshores, alkali flats and even flooded fields.[6] For roosting and resting needs, this bird selects alkali flats (even flooded ones), lake shores, and islands surrounded by shallow water.[4]

Breeding

Black-necked Stilt Eggs Quintana, Texas
Hatchling of the Black-winged Stilt, H. (h.) himatopus.
Those of the Black-winged Stilt look identical.

This stilt chooses mudflats, desiccated lacustrine verges, and levees for nest locations, as long as the soil is friable. Reproduction occurs from late April through August in North America, with peak activity in June,[11] while tropical populations usually breed after the rainy season. The nests are typically sited within one kilometer of a feeding location, and the pairs defend an extensive perimeter around groups of nests, patrolling in cooperation with their neighbors.[12] Spacing between nests is approximately 65 ft (c.20 m), but sometimes nests are within 7 ft (2 m) of each other and some nests in the rookery are as far as 130 ft (40 m) from the nearest neighbor. The Black-necked Stilt is actually classified as semicolonial since the nests are rarely found alone and colonies usually number dozens, rarely hundreds of pairs.[13] The nests are frequently established rather close to the water edge, so that their integrity is affected by rising water levels of ponds or tides. This is particularly a hazard in the case of managed salt ponds where water levels may be altered rapidly in the salt pond flooding process.[4][14]

The clutch size generally is 3-5 eggs with an average of four. For 22–26 days both sexes take turns incubating the eggs. The young are so precocial that they are seen swimming within two hours after hatching[15] and are also capable of rapid land velocity at that early time. In spite of this early development the young normally return to the nest for resting for one or two more days. They fledge after about one month but remain dependent on their parents for some more weeks. Birds begin to breed at 1–2 years of age.[4]

Status

Particularly the North American populations of the Black-necked Stilt have somewhat declined in the 20th century, mainly due to conversion of habitat for human use and pollution affecting both the birds directly as well as their food stocks. But altogether, the population is healthy and occurs over a large range. This stilt is therefore classified as a Species of Least Concern by the IUCN.[16] The Hawaiian Stilt, separated with the Black-necked Stilt in a distinct species by some (including the IUCN), is very rare however and numbers less than 2,000 individuals.[4] Predation by the Small Indian Mongoose (Herpestes javanicus auropunctatus), introduced to hunt rats, is suspected to have contributed to its decline.[17]

Notes

  1. ^ Pierce (1996), Sibley (2003)
  2. ^ E.g. Pierce (1996)
  3. ^ Though the IUCN considers the White-necked Stilt a separate species, this is likely to change at the next revision: BLI (2004ab, [2008])
  4. ^ a b c d e f g h i j Pierce (1996)
  5. ^ E.g. as a casual visitor on Clarión in the Revillagigedo Islands: Brattstrom & Howell (1953)
  6. ^ a b c Garrett & Dunn (1981)
  7. ^ McCaskie et al. (1979)
  8. ^ Corman & Wise-Gervais (2005)
  9. ^ Ransom et al. (1984)
  10. ^ Dronen et al. (2006)
  11. ^ Bent (1927)
  12. ^ Hamilton (1975)
  13. ^ Zeiner et al. (1988)
  14. ^ Rigney & Rigney (1981)
  15. ^ Harrison (1978)
  16. ^ BLI (2004b)
  17. ^ Hays & Conant (2007)

References

Further reading

  • Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: H. m. mexicanus and H. m. knudseni are regarded as distinct species by some authors. H. mexicanus (including knudseni) may be conspecific with the several other nominal Himantopus species, in which case the name would be H. himantopus (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!