Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Caribbean; North America; rare but regular fall migrant in the Northeast
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American avocets are found in western North America from March through October and in coastal California, southern Texas, Florida, Louisiana and south to Guatemala in winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Gill, F. 1995. Ornithology, Second Edition. New York: W.H. Freeman and Company.
  • Soothill, E., R. Soothill. 1982. Wading birds of the world. Poole, Dorset: Blandford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Northwest Territories (Kuyt and Johns 1992), southeastern British Columbia, central Alberta, southern Saskatchewan, southwestern Manitoba, southwestern Ontario, and Minnesota south locally to southern California, central Nevada, northern Utah, south-central Colorado, southern New Mexico, and San Luis Potosi, east to central Kansas and coastal Texas. Nonbreeders often in usual winter range in summer. NON-BREEDING: from California and southern Texas south through Mexico, casually to Guatemala, Belize, Honduras, and Costa Rica, locally in southern Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S Canada to n Mexico; winters s US to Costa Rica and Cuba.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Graceful and sleek, these long-legged waders have a black bill and light blue legs. Avocets are the tallest and longest-legged birds in their family. They are 400 to 500 mm in length and have a wingspan of 213 to 242 mm. They are often confused with black-necked stilts (Himantopus mexicanus), but are distinguishable by the bold black and white pattern on their back and wings and a strongly upcurved black bill. Females are similar in appearance to males but with a shorter and more upwardly-curved bill, male bills are longer and straighter. They are the only avocet with distinct breeding and non-breeding plumages. Breeding plumage is obtained in the first year and is a beautiful rusty cinnamon along the head and neck. Basic plumage is a gray head. Adult breeding plumage appears from January to March and is lost in July to September.

Average length: 400-500 mm.

Average wingspan: 213-242 mm.

Sexual Dimorphism: sexes shaped differently

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 340 g.

  • Kaufman, K. 2000. Birds of North America. New York, New York: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 46 cm

Weight: 316 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No other North American shorebird with a recurved bill has both a white belly and bold black and white patterning on the folded wings and back.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American avocets are numerous in mudflats, ponds, wetlands, and freshwater marshes and swamps. They are also common in lakes, rocky/sandy seashores, bay/coastal islands, and tidal flats.

Habitat Regions: temperate ; tropical ; terrestrial

Aquatic Biomes: lakes and ponds; coastal ; brackish water

Wetlands: marsh ; swamp

Other Habitat Features: estuarine

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A field guide to the natural history of North American birds. New York: Simon & Schuster Inc.
  • Hayman, P., J. Marchant, T. Prater. 1986. Shorebirds: an indentification guide to the waders of the world. London: Croom Helm, Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Lowland marshes, mudflats, ponds, alkaline lakes, and estuaries (AOU 1983). At Humboldt Bay, California, wintering birds used intertidal mud flats (mainly for for feeding and resting), a sewage oxidation pond (mainly for feeding and secondarily as a source of fresh water), high elevation mud flats (early high tide roost), and islands in a brackish lake (primary high tide roost); typically roosted on shallow, submerged bars of islands in deep nontidal ponds or less often in shallow water or on exposed mud near the water's edge of tidal mud flats (Evans and Harris 1994). Availability of sewage oxidation pond at Humboldt Bay enhanced habitat; the wintering population increased from 30-35 in 1960 (before pond construction) to 500-800 in the 1980s (after pond construction) (Evans and Harris 1994). In coastal South Carolina, most nonbreeding birds used habitats with water 10-17 cm deep (and relatively stable level) and little or no exposed substrate; among several brackish ponds, salinity was not an important factor in habitat selection (Boettcher et al. 1995).

Usually nests on open flats or areas with scattered tufts of grass on islands or along lakes (especially alkaline) and marshes. Readily nests on artificial islands (such as those created for waterfowl) in impoundments (Giroux 1985).

In Northwest Territories, Kuyt and Johns (1992) found two instances of avocet eggs in gull nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

May be nonmigratory in certain southern portions of range. Northern interior breeding populations make extensive seasonal migrations. Migrates mainly through western U.S. At Humboldt Bay California, arrives late-August to mid-November, departs February to late April and early May (Evans and Harris 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

American avocets swoop their open bills back and forth in shallow water to catch aquatic insects. They may feed in flocks of up to 100 plus birds, in deep water they will "tip up" like dabbling ducks and are reportedly good swimmers.

Foods eaten include: Insects and other invertebrates, shrimp and other crustaceans, aquatic vegetation and seeds.

Animal Foods: insects; terrestrial non-insect arthropods; aquatic crustaceans

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: omnivore

  • Alden, P. 1999. National Audubon Society, Field Guide to the Southwestern States 1st Edition. New York: Random House.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Walks slowly through the water; often feeding in flocks that number 12-300 birds. Eats a variety of aquatic insects and their larvae, crustaceans, and seeds of aquatic plants, obtained mainly from soft muddy bottom or water surface. May extend head, or dive, under surface of water while feeding. During fall-winter-spring at Humboldt Bay, California, foraged on intertidal mud flats within 3 km of roosts, usually within 100 m of tide edge, most often when tide levels were between 0.5 and 1.2 m Mean Lower Low Water; in October, fed mainly at sewage oxidation ponds with concentrations of invertebrate prey (Evans and Harris 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

American avocets are important members of their ecosystem; because of their food habits they likely have a regulatory influence on insect and crustacean populations, and they are an important food source for their predators. They also have an influence on the plants and seeds they eat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American avocets are mostly quiet and uncaring but become extremely aggressive on breeding and nesting grounds and protest loudly and dive bomb when intruders approach. They have few non-human predators, some known nest predators include skunks (subfamily Mephitinae) and foxes (family Canidae).

Known Predators:

  • skunks (Mephitinae)
  • foxes (Canidae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Recurvirostra americana is prey of:
Canidae
Mephitinae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Recurvirostra americana preys on:
non-insect arthropods
Arthropoda
Crustacea
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total population estimated at 450,000, with about 63,000 breeding in Canada (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

American avocets make loud "wheet" or "pleeet" and shrill "kleeap" sounds that are often repeated. They are very noisy when intruders approach active nests. They also communicate using complex displays that include dancing, bowing and crouching.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

1 brood per year, usually 3-5 eggs laid which are a pale ashy-yellow or olive-brown covered evenly with dark brown spots and blotches. Eggs are laid at intervals of 1-2 days, with a full clutch in 5 days (Hayman et al., 1986; Soothill & Soothill, 1982; Nethersole-Thompson, 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Banded American avocets have been recorded to live up to 9 years in the wild.

No records are available about life span in captivity, but presumably they live for 9 plus years!

Range lifespan

Status: wild:
9 (high) years.

Average lifespan

Status: wild:
168 months.

  • Klimkiewicz, M. 2002. "Longevity Records of North American Birds. Version 2002.1. Patuxent Wildlife Research Center. Bird Banding Laboratory. Laurel MD." (On-line). Accessed 02/19/04 at http://www.pwrc.usgs.gov/bbl/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but they have been reported to live up to 14 years in the wild (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm). Considering the longevity of similar species, however, maximum longevity could be significantly underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

American avocets are monogamous and loosely colonial. Pairs perform elaborate courtship displays that involve various crouching and bowing postures in and out of water, dancing with outspread wings and swaying from side to side.

Mating System: monogamous

Breeding occurs between April and June. Nests are built on shore and are usually scrapes in the ground; they are sometimes lined with dry grass or mud chips. The female lays 3 to 5 eggs (4 on average); eggs are olive colored with brown and black spots. Incubation lasts 22 to 29 days and the eggs hatch synchronously. Fledging occurs after 28 to 35 days.

Breeding season: April to June

Range eggs per season: 3 to 5.

Range time to hatching: 22 to 29 days.

Range fledging age: 28 to 35 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average eggs per season: 4.

Both male and female American avocets incubate the eggs. Incubation lasts 22 to 29 days. The precocial young are cared for by both sexes but the young feed themselves. Fledging occurs after 28 to 35 days.

Parental Investment: no parental involvement; precocial ; pre-fertilization; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A field guide to the natural history of North American birds. New York: Simon & Schuster Inc.
  • Hayman, P., J. Marchant, T. Prater. 1986. Shorebirds: an indentification guide to the waders of the world. London: Croom Helm, Ltd.
  • Nethersole-Thompson, D. 1986. Waders, their breeding, haunts and watchers. Staffordshire, England: T & AD Poyser, Ltd.
  • Soothill, E., R. Soothill. 1982. Wading birds of the world. Poole, Dorset: Blandford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins in mid-April in the south, as late as mid-May in the north. Clutch size usually is 3-4. Incubation lasts 23-25 days, by both sexes. Young are precocial, tended by both adults, independent in about 6 weeks. Nests usually in a loose colony.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Recurvirostra americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GAATTAGGCCAACCAGGGACCCTACTAGGAGATGACCAAATCTACAATGTAATCGTCACTGCCCACGCCTTCGTAATGATTTTCTTCATAGTTATACCAATTATGATTGGCGGATTCGGAAACTGACTAGTACCACTCATAATTGGTGCCCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTACTTCTCCTCGCCTCCTCTACAGTAGAAGCAGGGGCAGGAACAGGCTGAACTGTATACCCCCCCTTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACCTGGCAGGTGTATCCTCTATCCTAGGTGCAATCAACTTCATTACAACTGCTATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTCATCACCGCTGTCTTACTACTCCTCTCACTCCCAGTTCTAGCCGCCGGCATTACTATACTACTAACAGACCGAAACCTAAATACCACATTCTTTGACCCTGCCGGAGGAGGTGATCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTCTATATCTTAATCCTACCTGGCTTCGGAATCATCTCCCACGTAGTAACATACTACGCAGGCAAAAAAGAACCATTTGGCTATATGGGAATAGTATGAGCCATACTATCAATTGGATTCCTAGGCTTCATCGTCTGAGCCCACCACATATTTACAGTTGGAATAGACGTAGACACCCGAGCATACTTCACGTCAGCTACCATAATCATCGCTATCCCCACAGGCATTAAAGTATTCAGCTGACTGGCAACACTACACGGAGGAACAATTAAATGAGACCCTCCAATATTATGAGCCCTAGGATTCATCTTCCTCTTTACCATCGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Recurvirostra americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5